FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2003476798> ?p ?o ?g. }

• W2003476798 endingPage "5611" @default.
• W2003476798 startingPage "5605" @default.
• W2003476798 abstract "Annetocin is a structurally and functionally oxytocin-related peptide isolated from the earthworm Eisenia foetida. We present the characterization of the annetocin cDNA. Sequence analyses of the deduced precursor polypeptide revealed that the annetocin precursor is composed of three segments: a signal peptide, an annetocin sequence flanked by a Gly C-terminal amidation signal and a Lys-Arg dibasic processing site, and a neurophysin domain, similar to other oxytocin family precursors. The proannetocin showed 37.4–45.8% amino acid homology to other prohormones. In the neurophysin domain, 14 cysteines and amino acid residues essential for association of a neurophysin with a vasopressin/oxytocin superfamily peptide were conserved, suggesting that the Eisenia neurophysin can bind to annetocin. Furthermore, in situ hybridization experiments demonstrated that the annetocin gene is expressed exclusively in neurons of the central nervous system predicted to be involved in regulation of reproductive behavior. These findings confirm that annetocin is a member of the vasopressin/oxytocin superfamily. This is the first identification of the cDNA encoding the precursor of an invertebrate oxytocin-related peptide and also the first report of the identification of an annelid vasopressin/oxytocin-related precursor. Annetocin is a structurally and functionally oxytocin-related peptide isolated from the earthworm Eisenia foetida. We present the characterization of the annetocin cDNA. Sequence analyses of the deduced precursor polypeptide revealed that the annetocin precursor is composed of three segments: a signal peptide, an annetocin sequence flanked by a Gly C-terminal amidation signal and a Lys-Arg dibasic processing site, and a neurophysin domain, similar to other oxytocin family precursors. The proannetocin showed 37.4–45.8% amino acid homology to other prohormones. In the neurophysin domain, 14 cysteines and amino acid residues essential for association of a neurophysin with a vasopressin/oxytocin superfamily peptide were conserved, suggesting that the Eisenia neurophysin can bind to annetocin. Furthermore, in situ hybridization experiments demonstrated that the annetocin gene is expressed exclusively in neurons of the central nervous system predicted to be involved in regulation of reproductive behavior. These findings confirm that annetocin is a member of the vasopressin/oxytocin superfamily. This is the first identification of the cDNA encoding the precursor of an invertebrate oxytocin-related peptide and also the first report of the identification of an annelid vasopressin/oxytocin-related precursor. vasopressin oxytocin rapid amplification of cDNA ends polymerase chain reaction digoxigenin phosphate-buffered saline The cyclic nonapeptides vasopressin (VP)1 and oxytocin (OT) and their structurally related peptides are well known as neurohypophysial hormones involved in osmoregulation and reproduction in all vertebrates (1Acher R. Kobayashi H. Bern H.A. Urano A. Neurosecretion and the Biology of Neuropeptides. Japan Scientific Societies Press, Tokyo1985: 11-25Google Scholar, 2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 3Acher R. Gen. Comp. Endocrinol. 1996; 102: 157-172Crossref PubMed Scopus (96) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). They are classified into the VP and OT families based on the amino acid residue present at position 8: the VP family peptides contain a basic amino acid, and the OT family peptides contain a neutral amino acid at this position (1Acher R. Kobayashi H. Bern H.A. Urano A. Neurosecretion and the Biology of Neuropeptides. Japan Scientific Societies Press, Tokyo1985: 11-25Google Scholar, 2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 3Acher R. Gen. Comp. Endocrinol. 1996; 102: 157-172Crossref PubMed Scopus (96) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). Both the VP and OT family peptides are present in all vertebrate species except the cyclostomes, which have only the VP-related peptide vasotocin (2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 3Acher R. Gen. Comp. Endocrinol. 1996; 102: 157-172Crossref PubMed Scopus (96) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). The difference in the polarity of this amino acid residue is believed to enable the VP and OT peptides to interact with the respective receptor. The structural organization of the precursor polypeptides of neurohypophysial hormones is highly conserved in all vertebrates (2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 3Acher R. Gen. Comp. Endocrinol. 1996; 102: 157-172Crossref PubMed Scopus (96) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). The preprohormones are also structurally divided into the same two classes. The mammalian VP family precursors are composed of four regions: a signal peptide, a nonapeptide, a neurophysin, and a copeptin domain. The architecture of non-mammalian precursors is quite similar, except that the copeptin is not generated due to the absence of post-translational cleavage in the precursor. Thus, a non-mammalian neurophysin contains a C-terminal extended domain (2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 3Acher R. Gen. Comp. Endocrinol. 1996; 102: 157-172Crossref PubMed Scopus (96) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). The OT family precursors are organized similarly, but they completely lack copeptin(-like) domains, except for the isotocin precursor of the white sucker fish, which also contains an extension of the C-terminal region (2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 3Acher R. Gen. Comp. Endocrinol. 1996; 102: 157-172Crossref PubMed Scopus (96) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). Phylogenetic studies of the primary sequence of hormones, the structural organizations of the hormone precursor, and gene structure (5Ivell R. Richter D. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 2006-2010Crossref PubMed Scopus (389) Google Scholar, 6Sausville E. Carney D. Batttey J. J. Biol. Chem. 1985; 260: 10236-10241Abstract Full Text PDF PubMed Google Scholar, 7Figueroa J. Morley S.D. Heierhorst J. Krentler C. Lederis K. Richter D. EMBO J. 1989; 8: 2873-2877Crossref PubMed Scopus (28) Google Scholar, 8Hamann D. Hunt N. Ivell R. J. Neuroendocrinol. 1992; 4: 505-513Crossref PubMed Scopus (42) Google Scholar, 9Heierhorst J. Lederis K. Richter D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6798-6802Crossref PubMed Scopus (66) Google Scholar, 10Hyodo S. Ishii S. Joss J.M.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13339-13344Crossref PubMed Scopus (33) Google Scholar) led to the hypothesis that the VP and OT families separately evolved from a common ancestral gene via gene duplication (2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). In addition, only vasotocin is present in the lowest vertebrate cyclostomes (9Heierhorst J. Lederis K. Richter D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6798-6802Crossref PubMed Scopus (66) Google Scholar), suggesting that a duplication of the ancestral gene might have occurred after the evolutionary process of the Agenta (2Acher R. Regul. Pept. 1993; 45: 1-13Crossref PubMed Scopus (101) Google Scholar, 4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar,11Acher R. Proc. R Soc. Lond. B Biol. Sci. 1980; 210: 21-43Crossref PubMed Scopus (95) Google Scholar). The VP/OT superfamily peptides have also been characterized from invertebrates, including insects (12Proux J.P. Miller C.A. Li J.P. Carney R.L. Giradie A. Delaage M. Schooley D.A. Biochem. Biophys. Res. Commun. 1987; 149: 180-186Crossref PubMed Scopus (185) Google Scholar), molluscs (13Cruz L.J. de Santos V. Zafaralla G.C. Ramio C.A. Zeikus R. Gray W.R. Olivera B.M. J. Biol. Chem. 1987; 262: 15821-15824Abstract Full Text PDF PubMed Google Scholar, 14Mcmaster D. Kobayashi Y. Lederis K. Peptides (Elsevier). 1992; 13: 413-421Crossref PubMed Scopus (26) Google Scholar, 15Van Kesteren R.E. Smit A.B. De Lange P.R.J. Kits K.S. Van Goden F.A. Van Der Schors R.C. De With N.D. Bruke J.F. Geraerts W.P.M. J. Neurosci. 1995; 15: 5989-5998Crossref PubMed Google Scholar, 16Reich G. Neurosci. Lett. 1992; 134: 191-194Crossref PubMed Scopus (58) Google Scholar), and Annelida (17Salzet M. Bulet P. Van Dorsselear A. Malecha J. Eur. J. Biochem. 1993; 217: 897-903Crossref PubMed Scopus (79) Google Scholar, 18Oumi T. Ukena K. Matsushima O. Ikeda T. Fujita T. Minakata H. Nomoto K. Biochem. Biophys. Res. Commun. 1994; 198: 393-399Crossref PubMed Scopus (97) Google Scholar), as well as vertebrates (TableI) (4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). The peptides from invertebrates are all amidated at the C terminus and share five residues, namely Cys1, Asn5, Cys6, Pro7, and Gly9 (Table I) (4Hoyle C.H.V. Regul. Pept. 1998; 73: 1-33Crossref PubMed Scopus (146) Google Scholar). Annetocin has been isolated from the lumbricid earthworm Eisenia foetida. The primary sequence Cys-Phe-Val-Arg-Asn-Cys-Pro-Thr-Gly-NH2 is homologous to sequences of OT-related peptides (18Oumi T. Ukena K. Matsushima O. Ikeda T. Fujita T. Minakata H. Nomoto K. Biochem. Biophys. Res. Commun. 1994; 198: 393-399Crossref PubMed Scopus (97) Google Scholar), and injection of annetocin into the earthworm and leech results in induction of egg-laying behavior (19Oumi T. Ukena K. Matsushima O. Ikeda T. Fujita T. Minakata H. Nomoto K. J. Exp. Zool. 1996; 276: 151-156Crossref PubMed Scopus (98) Google Scholar). The similarity of not only the primary structure but also the reproductive function implies that annetocin is a member of the OT family. However, whether annetocin belongs to the superfamily remains to be concluded since the organized structure of an annetocin precursor polypeptide has not been characterized. In invertebrates, the structure of the Lymnaea Lys-conopressin precursor has been identified, demonstrating that the typical architecture of the precursor of the VP/OT superfamily peptide is also highly conserved in molluscs (20Van Kestern R.E. Smit A.B. Dirks R.W. De With N.D. Geraerts W.P.M. Joosse J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4593-4597Crossref PubMed Scopus (112) Google Scholar). This is the only identification of the invertebrate VP/OT superfamily precursor, and thus, the phylogenetic relationship of the VP/OT superfamily among invertebrates has not been understood. To determine the feature of the precursor polypeptide of the annelid VP/OT-related peptide and to investigate the molecular evolution or divergence of the VP/OT superfamily in invertebrates, we isolated and characterized the annetocin precursor polypeptide cDNA. In this report, we present indisputable evidence for the existence of the VP/OT superfamily in Annelida. The annetocin precursor, very much like other precursors of the OT family, consists of the typical three segments, i.e. a signal peptide, annetocin, and a neurophysin-like domain with 14 cysteine residues positioned identically to those of other neurophysins. The proannetocin displays amino acid sequence identities between 37.4 and 45.8%. A comparative study of amino acid sequences of prohormones also revealed the presence of amino acid residues crucial for interaction of a neurophysin with a hormone peptide in the Eisenianeurophysin domain. Furthermore, in situ hybridization directly detected expression of the annetocin gene in neurons of the subesophageal ganglion, which is known to be the central nervous tissue of the earthworm, confirming the specific synthesis of annetocin in the central nervous system as a neuropeptide. To the best of our knowledge, this is the first report on the precursor structure of the invertebrate OT-related peptide and also the first identification of cDNA encoding the VP/OT-related peptide from Annelida, the most primitive species from which a VP/OT-related peptide has ever been isolated.Table IThe invertebrate VP/OT-related peptides and species from which the peptide was characterized (13Cruz L.J. de Santos V. Zafaralla G.C. Ramio C.A. Zeikus R. Gray W.R. Olivera B.M. J. Biol. Chem. 1987; 262: 15821-15824Abstract Full Text PDF PubMed Google Scholar, 14Mcmaster D. Kobayashi Y. Lederis K. Peptides (Elsevier). 1992; 13: 413-421Crossref PubMed Scopus (26) Google Scholar, 15Van Kesteren R.E. Smit A.B. De Lange P.R.J. Kits K.S. Van Goden F.A. Van Der Schors R.C. De With N.D. Bruke J.F. Geraerts W.P.M. J. Neurosci. 1995; 15: 5989-5998Crossref PubMed Google Scholar, 16Reich G. Neurosci. Lett. 1992; 134: 191-194Crossref PubMed Scopus (58) Google Scholar, 17Salzet M. Bulet P. Van Dorsselear A. Malecha J. Eur. J. Biochem. 1993; 217: 897-903Crossref PubMed Scopus (79) Google Scholar, 18Oumi T. Ukena K. Matsushima O. Ikeda T. Fujita T. Minakata H. Nomoto K. Biochem. Biophys. Res. Commun. 1994; 198: 393-399Crossref PubMed Scopus (97) Google Scholar)PeptideSequenceAnimal (species)AnnetocinC F V R N C P T G-amideEarthworm (E. foetida)Lys-conopressinC F I R N C P K G-amidePond snail (Lymnaea stagnalis), geography cone (Conus geographus), sea hare (Aplysia kurodai), leech (Erpbdella octoculata)Arg-conopressinC I I R N C P R G-amideStriped cone (Conus striatus)CephalotocinC F I R N C P I G-amideOctopus (Octopus vulgaris)Lom-DHC L I T N C P I G-amideLocust (Locusta migratoria)The sequence of annetocin is in boldface. The amino acids conserved in all VP/OT-related peptides are underlined. Open table in a new tab The sequence of annetocin is in boldface. The amino acids conserved in all VP/OT-related peptides are underlined. E. foetida lumbricid earthworms were purchased from a fishing/bait store and kept in wet compost at 25 °C. All nucleotides were ordered from Sawady Technology. Frozen partial earthworm heads (1 g) were pulverized by grinding under liquid nitrogen. The ground tissues were dissolved in 10 ml of TRizol reagent (Life Technologies, Inc.), and total RNA was extracted according to the manufacturer's protocol. All PCR amplifications were carried out in a reaction mixture containing Taq polymerase (EXTaq polymerase (Takara Shuzo) or rTaq DNA polymerase (TOYOBO)) and 200 μm dNTP in a thermal cycler (Perkin-Elmer GeneAmp PCR System 2400). First strand cDNA was synthesized with the oligo(dT)-anchor primer supplied in the 5′/3′-RACE kit (Boehringer Mannheim) and amplified using the anchor primer and the first degenerate primer, TG(T/C)TT(T/C)GTI(A/C)GIAA(T/C)TG(T/C)CC (where I represents inosine), corresponding to the N-terminal part of annetocin, Cys-Phe-Val-Arg-Asn-Cys-Pro. First-round PCR products were reamplified using the anchor primer and the second degenerate primer, GTI (A/C)GIAA(T/C)TG(T/C)CCIACIGGIGG, corresponding to the C-terminal part of annetocin, Val-Arg-Asn-Cys-Pro-Thr-Gly-Gly, where the last Gly was regarded as a C-terminal amidation signal. Both first- and second-round PCRs consisted of 30 cycles for 30 s at 94 °C, 30 s at 51 °C, and 2.5 min at 72 °C (5 min for the last cycle). The second-round PCR products were subcloned into a TA cloning vector (Invitrogen) according to the manufacturer's instructions. The DNA inserts of the positive clones were amplified by PCR using universal M13 primers. Template cDNA was synthesized using a primer complementary to nucleotides 416–435 (ATTCCTTCGACAGCGCAGAC), followed by dA-tailing of the cDNA using dATP and terminal transferase (Boehringer Mannheim). The tailed cDNA was amplified using the oligo(dT)-anchor primer and the gene-specific primer 1 (TCGACAGAT-GGTTCTCGAGG, complementary to nucleotides 349–368), followed by reamplification of the first-round PCR products using the anchor primer and the gene-specific primer 2 (GTGTTGACGAAGCAGAAGAAG, complementary to nucleotides 309–328). Both first- and second-round PCRs were performed for 30 cycles consisting of 30 s at 94 °C, 30 s at 55 °C, and 1.5 min at 72 °C. The second-round PCR products were subcloned, and the inserts were amplified as described in 3′-RACE. All nucleotide sequences were determined using Big-Dye sequencing kits (Perkin-Elmer) and an automated DNA sequencer (Perkin-Elmer Model 373A) and analyzed on GENETYX-MAC software (Software Development). Universal M13 primers or gene-specific primers were used to sequence both strands. A full-length digoxigenin (DIG)-labeled annetocin precursor cDNA was synthesized using a DNA labeling kit (Boehringer Mannheim) and was used as a probe for Northern blot analysis. Total RNA was separated on a denaturing formaldehyde-containing 1% agarose gel and fixed onto Hybond N+ membrane (Amersham Pharmacia Biotech) by UV irradiation. Hybridization and detection were carried out according to the manufacturer's standard procedure (Boehringer Mannheim). RNA size was estimated using DIG-labeled RNA molecular markers (Boehringer Mannheim). An earthworm head was dissected and incubated in 4% paraformaldehyde/PBS (10 mm sodium phosphate buffer (pH 7.5) and 0.9% NaCl) at 4 °C overnight. After washing five times with 10 mm sodium phosphate (pH 7.5) and 0.1% Tween 20 at 4 °C for 30 min, the fixed head was dehydrated in ethanol and benzene and embedded in 96% polyester wax (BDH). Transverse sections 6-μm thick were cut, arranged on 3-aminopropyltriethoxysilane-coated slides (Mathunami), and dried for 5 h at 50 °C and further overnight at room temperature. The sections were deparaffinized in xylene (2 × 5 min, room temperature) and rehydrated in ethanol and PBS, followed by successive treatment with a 10 μg/ml proteinase K solution (Nakalai Tesque; 10 min, room temperature), PBS (3 × 5 min, room temperature), 4% paraformaldehyde/PBS (10 min, room temperature), PBS (3 × 5 min, room temperature), 0.2 n HCl (10 min, room temperature), PBS (3 × 5 min, room temperature), 0.25% acetic anhydride in 0.1m triethanolamine HCl buffer (pH 8.0) (10 min, room temperature), and PBS (3 × 5 min, room temperature). The sections were then incubated for 2 h at 50 °C in prehybridization medium containing 50% formamide, 10% dextran sulfate (Sigma), 1% blocking reagent (Boehringer Mannheim), 5× SSC (1× SSC = 0.15m NaCl and 0.015 m sodium citrate (pH 4.5)), and 50 μg/ml denatured herring sperm DNA. To prepare a sense or antisense probe, 53-mer oligonucleotides complementary or identical to a preproannetocin cDNA located between nucleotides 152 and 204 were tailed at the 3′-terminus by DIG-11-dUTP using a DIG oligonucleotide tailing kit (Boehringer Mannheim). Hybridization was performed for 16 h at 50 °C in hybridization medium containing a 1 pmol/ml concentration of each labeled probe. Hybridized sections were washed with 50% formamide and 2× SSC (2 × 20 min, room temperature), 2× SSC (2 × 20 min, 50 °C), and 0.2× SSC (2× 20 min, 50 °C). After incubation in blocking buffer diluted with washing buffer prepared from the DIG Wash and Block Buffer Set (Boehringer Mannheim) for 1 h at room temperature, slides were incubated in a 1:1000 dilution of alkaline phosphatase-conjugated anti-digoxigenin Fab (Boehringer Mannheim) for 1 h at room temperature. Subsequently, slides were washed in washing buffer (2 × 20 min, room temperature); covered with a chromogen mixture consisting of 100 mm Tris (pH 9.5), 100 mm NaCl, 10 mm MgCl2, 337.5 μg/ml nitro blue tetrazolium, and 175 μg/ml 5-bromo-4-chloro-3-indolyl phosphate; and kept at room temperature in the dark until sufficient color had developed (∼36 h). Staining was stopped by washing with 10 mm Tris (pH 7.5) and 1 mm EDTA. In an attempt to obtain annetocin precursor polypeptide cDNA fragments, we performed a 3′-RACE experiment using degenerate primers corresponding to the N-terminal part of annetocin (Cys-Phe-Val-Arg-Asn-Cys-Pro) and the anchor primer (see “Experimental Procedures”). To increase abundance and specificity, the first-round PCR products were further amplified with degenerate primers corresponding to the C-terminal part of annetocin (Val-Arg-Asn-Cys-Pro-Thr-Gly-Gly) and the same anchor primer. Here, the C-terminal amide group was thought to be derived from a C-terminal Gly residue that is well known as the typical amidation signal. Electrophoresis of the second-round PCR mixture revealed a single product of ∼0.5 kilobases (data not shown). Sequencing of the subcloned second-round PCR products showed that all clones had essentially identical nucleotide sequences, except for minor differences in the 3′-terminal sequence, probably attributable to utilization of the alternate polyadenylation signal AATAAA and various lengths of the poly(A) tract. The predicted amino acid sequence comprised a cysteine-rich domain preceded by the endoproteolytic dibasic sequence Lys-Arg after a partial annetocin sequence derived from the second-round PCR primers, indicating that an annetocin precursor might be organized similarly to precursors of the VP/OT superfamily. To determine the 5′-end sequence, we performed 5′-RACE using specific primers for the clone (see “Experimental Procedures”). A single product of ∼0.3 kilobases (data not shown) was obtained and sequenced after subcloning and amplification as described for the 3′-RACE products and contained two putative ATG initiation codons in addition to a TGA stop codon upstream of the first ATG codon. PCR products amplified using different polymerases had identical nucleotide sequences, confirming that these cDNA clones were not generated by artifacts. By combining nucleotide sequences determined by 3′- and 5′-RACE, the entire cDNA sequence encoding a preproannetocin was identified. Fig. 1shows the complete sequence of the longest cDNA. The annetocin precursor cDNA is composed of 668 nucleotides containing a 417-base pair single open reading frame flanked by a short 5′-untranslated sequence of 58 base pairs and a 3′-untranslated sequence of 193 base pairs followed by various lengths of poly(A) tail. The open reading frame region begins with two putative start codons present at positions 59 and 86 and terminates with a stop codon at position 473. Both putative initiation codons conform to the Kozak rule (AAAATGG and AACATGA) (22Kozak M. Nucleic Acids Res. 1987; 15: 8125-8148Crossref PubMed Scopus (4172) Google Scholar). Two polyadenylation signals (AATAAA) were found in the 3′-untranslated region at positions 637 and 647. Nucleotide sequence analysis of all clones indicated that the second polyadenylation signal was used relatively more frequently than the first one; however, the biological significance of this remains to be elucidated. Northern blot analysis of total RNA using a DIG-labeled preproannetocin cDNA as a probe detected a single band of ∼0.8 kilobases (Fig.2 A) even after longer exposure (data not shown), suggesting that the annetocin gene produces a single transcript. The apparent migration of the 0.8-kilobase sequence was well in accordance with the estimated length of the cDNA, confirming that the longest cDNA sequence identified by combination of 3′- and 5′-RACE includes a full-length nucleotide sequence encoding an annetocin preprohormone.Figure 2Northern blot analysis of total RNA (A), schematic representation of the annetocin precursor polypeptide (B), and hydropathy plot analysis of the predicted precursor (C). InA, total RNA was extracted from the anterior part of the earthworm, and ∼25 μg of RNA was subject to Northern blot hybridization using a DIG-labeled annetocin cDNA probe. RNA molecular markers are shown on the left in kilobases (kb). In B, the hydrophobic leader sequence is labeledS. The annetocin sequence and neurophysin-like domain are represented by the hatched and black bars, respectively. The endoproteolytic sites are shown asblack lines. In C, the plot was generated according to the method of Kyte and Doolittle (21Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17296) Google Scholar) using GENETYX-MAC software.View Large Image Figure ViewerDownload (PPT) The open reading frame region encodes a 139-residue polypeptide with a predicted molecular mass of ∼14.6 kDa. Amino acid sequence analysis revealed that the structural organization of the annetocin precursor polypeptide was quite homologous to that of the VP/OT-related preprohormones: the precursor was composed of a signal peptide, a nonapeptide, and a neurophysin domain, as shown in Fig.2 B. The annetocin transcript was predicted to be translated with the Met present at position 1 or 10 since the nucleotide sequences surrounding the two start codons are entirely consistent with the Kozak rule as described above. Hydropathy plot analysis of preproannetocin identified the N-terminal sequence as the most hydrophobic (Fig.2 C), suggesting that this region serves as a signal peptide. The cleavage site of the signal peptide may be the Ala32–Cys33 bond (or Ala23–Cys24 if the Met at position 10 is used as the initiating signal), as seen in other precursor polypeptides of the VP/OT superfamily. Furthermore, this prediction is supported by the −3,−1 rule (23von Heijne G. Nucleic Acids Res. 1986; 14: 4683-4690Crossref PubMed Scopus (3693) Google Scholar). The annetocin sequence CFVRNCPTG, flanked by Gly as an amidation signal and the typical dibasic processing sequence Lys-Arg, was found to follow a signal sequence. The following moiety showed the properties of a neurophysin domain. The striking feature of this neurophysin domain is that 14 cysteine residues are positioned almost identically to those in the neurophysin domains of other VP/OT-related prohormones (Fig. 3). This result suggests that an essential tertiary structure of theEisenia neurophysin domain is also highly conserved because disulfide pairings by 14 cysteine residues in the neurophysin domain are believed to play a significant role in conformation essential for interaction with a hormone peptide (27Burman S. Wellner D. Chait B. Chaudhary T. Breslow E. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 429-433Crossref PubMed Scopus (40) Google Scholar, 28Chen L. Rose J.P. Breslow E. Yang D. Chang W. Furey W.F. Sax M. Wang B. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4240-4244Crossref PubMed Scopus (163) Google Scholar, 29Rose J.P. Wu C.-K. Hsiao C.-D. Breslow E. Wang B.-C. Nat. Struct. Biol. 1996; 3: 163-169Crossref PubMed Scopus (106) Google Scholar, 30de Bree F.M. Burbach J.P.H. Cell. Mol. Neurobiol. 1998; 18: 173-191Crossref PubMed Scopus (94) Google Scholar). A copeptin-like region (another typical domain in the prohormones of the VP family, but not in those of the OT family) is entirely absent in preproannetocin since a TGA stop codon is found immediately after the fourteenth cysteine. These findings indicate that the principal architecture of VP/OT superfamily preprohormones is also highly conserved in Annelida and that a precursor polypeptide of annetocin is structurally closer to precursors of OT-related peptides since a C-terminal extension is not seen in the preprohormones. In addition, no consensus sequence for any other post-translational modification such as glycosylation or phosphorylation was found in the precursor polypeptide. The amino acid sequence of the annetocin prohormone is aligned with the sequences of other species' prohormones of the VP/OT superfamily in Fig. 3. The neurophysin domain of the annetocin prohormone includes the longest sequence between the cleavage site Lys-Arg and the third conserved cysteine residue (position 41). Furthermore, seven amino acids are present between the ninth and tenth cysteines of the invertebrate prohormones, whereas the vertebrate counterparts contain five or six amino acids in the corresponding region. Generally, lower animal prohormones seem to include longer sequences in these regions. Comparative sequence analyses showed that several amino acids such as Arg23, Gly34, Glu67, Pro73, and Gly93 in the annetocin prohormone are completely conserved in the neurophysin domains of any species, in addition to the 14 cysteine residues. Other than the nonapeptide sequences flanked by the Gly C-terminal amidation signal and the endoproteolytic Lys-Arg site, only the Glu67-Asn68-His69-Leu70-Ser71-Thr72-Pro73region is relatively homologous to the corresponding regions in vertebrates and Lymnaea. The total amino acid sequence of the annetocin prohormone is 37.4–45.8% homologous to the sequences of other prohormones (Table II). Interestingly, the similarity of the annetocin prohormone to theLymnaea Lys-conopressin prohormone is not significantly distinct from the similarities to the prohormones of vertebrates. This result is somewhat surprising because we expected the amino acid homology of the invertebrate prohormone to another relatively close invertebrate or lower vertebrate (for example, cyclostomes) prohormone to be much higher than to advanced vertebrate prohormones. However, the highest and lowest similarities were found with the bovine vasopressin prohormone (45.8%) and the white sucker vasotocin I prohormone (37.4%), respectively. These findings suggest that the amino acid sequence of the invertebrate VP/OT superfamily prohormone may show a remarkable interphyletic difference that is not correlated with phyletic distance.Table IIAmino acid sequence homology of proannetocin to other vasopressin/oxytocin superfamily prohormonesSpecies (peptide)Homology%Lymnaea(Lys-conopressin)42.1Bovine (vasopressin)45.8Bovine (oxy" @default.
• W2003476798 created "2016-06-24" @default.
• W2003476798 creator A5014132611 @default.
• W2003476798 creator A5015766404 @default.
• W2003476798 creator A5021772849 @default.
• W2003476798 creator A5079221911 @default.
• W2003476798 date "1999-02-01" @default.
• W2003476798 modified "2023-09-28" @default.
• W2003476798 title "Evidence for Conservation of the Vasopressin/Oxytocin Superfamily in Annelida" @default.
• W2003476798 cites W102481855 @default.
• W2003476798 cites W1482798859 @default.
• W2003476798 cites W1493670259 @default.
• W2003476798 cites W1507638436 @default.
• W2003476798 cites W1516996751 @default.
• W2003476798 cites W1570126067 @default.
• W2003476798 cites W1647810205 @default.
• W2003476798 cites W1658399278 @default.
• W2003476798 cites W1967945214 @default.
• W2003476798 cites W1968032473 @default.
• W2003476798 cites W1974928792 @default.
• W2003476798 cites W1975111175 @default.
• W2003476798 cites W1975304761 @default.
• W2003476798 cites W1979458705 @default.
• W2003476798 cites W1980877862 @default.
• W2003476798 cites W1982984996 @default.
• W2003476798 cites W2001785728 @default.
• W2003476798 cites W2009599534 @default.
• W2003476798 cites W2014035772 @default.
• W2003476798 cites W2014441770 @default.
• W2003476798 cites W2021778417 @default.
• W2003476798 cites W2043177320 @default.
• W2003476798 cites W2045348184 @default.
• W2003476798 cites W2046255214 @default.
• W2003476798 cites W2052947960 @default.
• W2003476798 cites W2053349628 @default.
• W2003476798 cites W2062928754 @default.
• W2003476798 cites W2074709477 @default.
• W2003476798 cites W2084406941 @default.
• W2003476798 cites W2088953252 @default.
• W2003476798 cites W2092162966 @default.
• W2003476798 cites W2093692530 @default.
• W2003476798 cites W2094184035 @default.
• W2003476798 cites W2102290655 @default.
• W2003476798 cites W2106697928 @default.
• W2003476798 cites W2133950380 @default.
• W2003476798 cites W2138879032 @default.
• W2003476798 cites W2149668396 @default.
• W2003476798 cites W2155375581 @default.
• W2003476798 cites W262355943 @default.
• W2003476798 doi "https://doi.org/10.1074/jbc.274.9.5605" @default.
• W2003476798 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10026177" @default.
• W2003476798 hasPublicationYear "1999" @default.
• W2003476798 type Work @default.
• W2003476798 sameAs 2003476798 @default.
• W2003476798 citedByCount "74" @default.
• W2003476798 countsByYear W20034767982012 @default.
• W2003476798 countsByYear W20034767982013 @default.
• W2003476798 countsByYear W20034767982014 @default.
• W2003476798 countsByYear W20034767982015 @default.
• W2003476798 countsByYear W20034767982016 @default.
• W2003476798 countsByYear W20034767982017 @default.
• W2003476798 countsByYear W20034767982018 @default.
• W2003476798 countsByYear W20034767982019 @default.
• W2003476798 countsByYear W20034767982020 @default.
• W2003476798 countsByYear W20034767982021 @default.
• W2003476798 crossrefType "journal-article" @default.
• W2003476798 hasAuthorship W2003476798A5014132611 @default.
• W2003476798 hasAuthorship W2003476798A5015766404 @default.
• W2003476798 hasAuthorship W2003476798A5021772849 @default.
• W2003476798 hasAuthorship W2003476798A5079221911 @default.
• W2003476798 hasBestOaLocation W20034767981 @default.
• W2003476798 hasConcept C104317684 @default.
• W2003476798 hasConcept C134018914 @default.
• W2003476798 hasConcept C2776176026 @default.
• W2003476798 hasConcept C2776370428 @default.
• W2003476798 hasConcept C505870484 @default.
• W2003476798 hasConcept C54355233 @default.
• W2003476798 hasConcept C86803240 @default.
• W2003476798 hasConcept C90856448 @default.
• W2003476798 hasConcept C92028520 @default.
• W2003476798 hasConceptScore W2003476798C104317684 @default.
• W2003476798 hasConceptScore W2003476798C134018914 @default.
• W2003476798 hasConceptScore W2003476798C2776176026 @default.
• W2003476798 hasConceptScore W2003476798C2776370428 @default.
• W2003476798 hasConceptScore W2003476798C505870484 @default.
• W2003476798 hasConceptScore W2003476798C54355233 @default.
• W2003476798 hasConceptScore W2003476798C86803240 @default.
• W2003476798 hasConceptScore W2003476798C90856448 @default.
• W2003476798 hasConceptScore W2003476798C92028520 @default.
• W2003476798 hasIssue "9" @default.
• W2003476798 hasLocation W20034767981 @default.
• W2003476798 hasOpenAccess W2003476798 @default.
• W2003476798 hasPrimaryLocation W20034767981 @default.
• W2003476798 hasRelatedWork W1481215243 @default.
• W2003476798 hasRelatedWork W2040117060 @default.
• W2003476798 hasRelatedWork W2066641576 @default.
• W2003476798 hasRelatedWork W2070022138 @default.
• W2003476798 hasRelatedWork W2072568231 @default.

• next