FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2003610192> ?p ?o ?g. }

• W2003610192 endingPage "6461" @default.
• W2003610192 startingPage "6456" @default.
• W2003610192 abstract "Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5′AAACATGTTT3′) and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5′AAACATGTTTTAAAACATGTTT3′). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer–dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K d = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability." @default.
• W2003610192 created "2016-06-24" @default.
• W2003610192 creator A5006017457 @default.
• W2003610192 creator A5026830739 @default.
• W2003610192 creator A5063253432 @default.
• W2003610192 creator A5072432337 @default.
• W2003610192 date "2011-04-04" @default.
• W2003610192 modified "2023-10-14" @default.
• W2003610192 title "Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements" @default.
• W2003610192 cites W1482923899 @default.
• W2003610192 cites W1534987406 @default.
• W2003610192 cites W1968754848 @default.
• W2003610192 cites W1979206664 @default.
• W2003610192 cites W1986384390 @default.
• W2003610192 cites W1992192194 @default.
• W2003610192 cites W1998414525 @default.
• W2003610192 cites W2000854021 @default.
• W2003610192 cites W2005955161 @default.
• W2003610192 cites W2007232912 @default.
• W2003610192 cites W2007401366 @default.
• W2003610192 cites W2014938226 @default.
• W2003610192 cites W2025670719 @default.
• W2003610192 cites W2026203131 @default.
• W2003610192 cites W2061434768 @default.
• W2003610192 cites W2064074669 @default.
• W2003610192 cites W2075334136 @default.
• W2003610192 cites W2078242867 @default.
• W2003610192 cites W2079328211 @default.
• W2003610192 cites W2080413331 @default.
• W2003610192 cites W2092665840 @default.
• W2003610192 cites W2096276671 @default.
• W2003610192 cites W2101139097 @default.
• W2003610192 cites W2116269086 @default.
• W2003610192 cites W2119742986 @default.
• W2003610192 cites W2135963245 @default.
• W2003610192 cites W2156159819 @default.
• W2003610192 cites W2166476348 @default.
• W2003610192 cites W2168497623 @default.
• W2003610192 doi "https://doi.org/10.1073/pnas.1013657108" @default.
• W2003610192 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3080992" @default.
• W2003610192 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21464285" @default.
• W2003610192 hasPublicationYear "2011" @default.
• W2003610192 type Work @default.
• W2003610192 sameAs 2003610192 @default.
• W2003610192 citedByCount "40" @default.
• W2003610192 countsByYear W20036101922012 @default.
• W2003610192 countsByYear W20036101922013 @default.
• W2003610192 countsByYear W20036101922014 @default.
• W2003610192 countsByYear W20036101922015 @default.
• W2003610192 countsByYear W20036101922016 @default.
• W2003610192 countsByYear W20036101922017 @default.
• W2003610192 countsByYear W20036101922018 @default.
• W2003610192 countsByYear W20036101922019 @default.
• W2003610192 countsByYear W20036101922020 @default.
• W2003610192 countsByYear W20036101922021 @default.
• W2003610192 countsByYear W20036101922022 @default.
• W2003610192 countsByYear W20036101922023 @default.
• W2003610192 crossrefType "journal-article" @default.
• W2003610192 hasAuthorship W2003610192A5006017457 @default.
• W2003610192 hasAuthorship W2003610192A5026830739 @default.
• W2003610192 hasAuthorship W2003610192A5063253432 @default.
• W2003610192 hasAuthorship W2003610192A5072432337 @default.
• W2003610192 hasBestOaLocation W20036101921 @default.
• W2003610192 hasConcept C101762097 @default.
• W2003610192 hasConcept C104317684 @default.
• W2003610192 hasConcept C107824862 @default.
• W2003610192 hasConcept C121608353 @default.
• W2003610192 hasConcept C12554922 @default.
• W2003610192 hasConcept C132376346 @default.
• W2003610192 hasConcept C150194340 @default.
• W2003610192 hasConcept C178790620 @default.
• W2003610192 hasConcept C185592680 @default.
• W2003610192 hasConcept C2779546866 @default.
• W2003610192 hasConcept C33987129 @default.
• W2003610192 hasConcept C3662595 @default.
• W2003610192 hasConcept C51445715 @default.
• W2003610192 hasConcept C5179208 @default.
• W2003610192 hasConcept C530470458 @default.
• W2003610192 hasConcept C54355233 @default.
• W2003610192 hasConcept C552990157 @default.
• W2003610192 hasConcept C84606932 @default.
• W2003610192 hasConcept C86339819 @default.
• W2003610192 hasConcept C86803240 @default.
• W2003610192 hasConcept C94966510 @default.
• W2003610192 hasConceptScore W2003610192C101762097 @default.
• W2003610192 hasConceptScore W2003610192C104317684 @default.
• W2003610192 hasConceptScore W2003610192C107824862 @default.
• W2003610192 hasConceptScore W2003610192C121608353 @default.
• W2003610192 hasConceptScore W2003610192C12554922 @default.
• W2003610192 hasConceptScore W2003610192C132376346 @default.
• W2003610192 hasConceptScore W2003610192C150194340 @default.
• W2003610192 hasConceptScore W2003610192C178790620 @default.
• W2003610192 hasConceptScore W2003610192C185592680 @default.
• W2003610192 hasConceptScore W2003610192C2779546866 @default.
• W2003610192 hasConceptScore W2003610192C33987129 @default.
• W2003610192 hasConceptScore W2003610192C3662595 @default.
• W2003610192 hasConceptScore W2003610192C51445715 @default.
• W2003610192 hasConceptScore W2003610192C5179208 @default.

• next