FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2003643174> ?p ?o ?g. }

• W2003643174 endingPage "1876" @default.
• W2003643174 startingPage "1869" @default.
• W2003643174 abstract "The hypothesis that wound repair is augmented by delivery of platelet-derived growth factor (PDGF) from platelets and macrophages is an attractive extrapolation from the known activities of PDGF in cell culture and in vivo. To test this hypothesis in mice, we prepared hematopoietic chimeras, in which the hematopoietic system of a normal adult mouse was replaced by the hematopoietic system of a PDGF B-chain −/− or +/+ donor. We initiated local granulation tissue formation either by implanting small surgical sponges to elicit a foreign body granulation tissue response, or by ligating the left common carotid to form an organized thrombus. We found that the absence of hematopoietic PDGF B-chain did not decrease the extent of granulation tissue or vascular lesion formation, and that the vascularization of both lesions increased by ∼100%. We conclude that PDGF B-chain from cells of hematopoietic origin, including platelets and macrophages, is not important for granulation tissue formation, and that it reduces vascularization of granulation issue, probably through disabling of the short-range chemotactic gradients of PDGF that are important for recruiting pericytes/smooth muscle cells to the endothelium of new vessels. The hypothesis that wound repair is augmented by delivery of platelet-derived growth factor (PDGF) from platelets and macrophages is an attractive extrapolation from the known activities of PDGF in cell culture and in vivo. To test this hypothesis in mice, we prepared hematopoietic chimeras, in which the hematopoietic system of a normal adult mouse was replaced by the hematopoietic system of a PDGF B-chain −/− or +/+ donor. We initiated local granulation tissue formation either by implanting small surgical sponges to elicit a foreign body granulation tissue response, or by ligating the left common carotid to form an organized thrombus. We found that the absence of hematopoietic PDGF B-chain did not decrease the extent of granulation tissue or vascular lesion formation, and that the vascularization of both lesions increased by ∼100%. We conclude that PDGF B-chain from cells of hematopoietic origin, including platelets and macrophages, is not important for granulation tissue formation, and that it reduces vascularization of granulation issue, probably through disabling of the short-range chemotactic gradients of PDGF that are important for recruiting pericytes/smooth muscle cells to the endothelium of new vessels. Platelet-derived growth factor (PDGF) is a family of disulfide-bonded homo- or heterodimers of four possible subunits (A-chain, B-chain, C-chain, and D-chain) that act on cells via binding to homo- or heterodimers of one the two known PDGF receptor proteins: PDGFRα and PDGFRβ. PDGF A-chain and PDGF B-chain were identified almost 20 years ago, and much is known about their binding specificities and activities. PDGF B-chain binds to PDGFRα and PDGFRβ, whereas PDGF A-chain can bind only to PDGFRα.1Seifert RA Hart CE Phillips PE Forstrom JW Ross R Murray MJ Bowen-Pope DF Two different subunits associate to create isoform-specific platelet-derived growth factor receptors.J Biol Chem. 1989; 264: 8771-8778Abstract Full Text PDF PubMed Google Scholar PDGF-C and PDGF-D have been identified only recently, and much less is known about their sources and roles.2Bergsten E Uutela M Li X Pietras K Ostman A Heldin CH Alitalo K Eriksson U PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor.Nat Cell Biol. 2001; 3: 512-516Crossref PubMed Scopus (459) Google Scholar, 3LaRochelle WJ Jeffers M McDonald WF Chillakuru RA Giese NA Lokker NA Sullivan C Boldog FL Yang M Vernet C Burgess CE Fernandes E Deegler LL Rittman B Shimkets J Shimkets RA Rothberg JM Lichenstein HS PDGF-D, a new protease-activated growth factor.Nat Cell Biol. 2001; 3: 517-521Crossref PubMed Scopus (313) Google Scholar, 4Uutela M Lauren J Bergsten E Li X Horelli-Kuitunen N Eriksson U Alitalo K Chromosomal location, exon structure, and vascular expression patterns of the human PDGFC and PDGFD genes.Circulation. 2001; 103: 2242-2247Crossref PubMed Scopus (105) Google Scholar In binding specificity, PDGF-C seems most similar to PDGF-A in that it binds to PDGFRα5Li X Ponten A Aase K Karlsson L Abramsson A Uutela M Backstrom G Hellstrom M Bostrom H Li H Soriano P Betsholtz C Heldin CH Alitalo K Ostman A Eriksson U PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor.Nat Cell Biol. 2000; 2: 302-309Crossref PubMed Scopus (499) Google Scholar and PDGF-D is most similar to PDGF-B, in that it binds to PDGFRβ, but unlike PDGF B-chain, does not bind to PDGFRα.2Bergsten E Uutela M Li X Pietras K Ostman A Heldin CH Alitalo K Eriksson U PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor.Nat Cell Biol. 2001; 3: 512-516Crossref PubMed Scopus (459) Google Scholar, 3LaRochelle WJ Jeffers M McDonald WF Chillakuru RA Giese NA Lokker NA Sullivan C Boldog FL Yang M Vernet C Burgess CE Fernandes E Deegler LL Rittman B Shimkets J Shimkets RA Rothberg JM Lichenstein HS PDGF-D, a new protease-activated growth factor.Nat Cell Biol. 2001; 3: 517-521Crossref PubMed Scopus (313) Google ScholarPDGF-A chain plays an important role in the development of specific populations of mesenchymal cells involved in epithelial-mesenchymal interaction as well as of neural crest-derived mesenchyme and glial cells of the oligodendrocyte lineage.6Betsholtz C Karlsson L Lindahl P Developmental roles of platelet-derived growth factors.Bioessays. 2001; 23: 494-507Crossref PubMed Scopus (289) Google Scholar Little is known about the roles of PDGF-C and PDGF-D. In adult animals, PDGF B-chain is highly expressed by megakaryocytes/platelets, endothelial cells (ECs), and macrophages.7Shimokado K Raines EW Madtes DK Barrett TB Benditt EP Ross R A significant part of macrophage-derived growth factor consists of at least two forms of PDGF.Cell. 1985; 43: 277-286Abstract Full Text PDF PubMed Scopus (499) Google Scholar, 8Bowen-Pope DF Hart CE Seifert RA Sera and conditioned media contain different isoforms of platelet-derived growth factor (PDGF) which bind to different classes of PDGF receptor.J Biol Chem. 1989; 264: 2502-2508Abstract Full Text PDF PubMed Google Scholar, 9Ross R Masuda J Raines EW Gown AM Katsuda S Sasahara M Malden LT Masuko H Sato H Localization of PDGF-B protein in macrophages in all phases of atherogenesis.Science. 1990; 248: 1009-1012Crossref PubMed Scopus (469) Google Scholar It has long been recognized as a potent mitogen and chemotactic agent for connective tissue and stromal cells.10Ross R Raines EW Bowen-Pope DF The biology of platelet-derived growth factor.Cell. 1986; 46: 155-169Abstract Full Text PDF PubMed Scopus (1573) Google Scholar This suggested the following simple and elegant hypothesis. At sites of injury, PDGF sequestered in the secretory granules of platelets, and PDGF synthesized by activated macrophages, is released and stimulates local connective tissue cells to proliferate and/or immigrate into the damaged area as part of the wound repair process.9Ross R Masuda J Raines EW Gown AM Katsuda S Sasahara M Malden LT Masuko H Sato H Localization of PDGF-B protein in macrophages in all phases of atherogenesis.Science. 1990; 248: 1009-1012Crossref PubMed Scopus (469) Google Scholar In pathological situations, including chronic injury in cardiovascular disease, and in inappropriate secretion by tumor cells, this connective tissue proliferation could be excessive and deleterious.The response to injury hypothesis has considerable support from experiments in which exogenous PDGF was shown to be able to promote aspects of wound repair.11Grotendorst GR Martin GR Pencev D Sodek J Harvey AK Stimulation of granulation tissue formation by platelet-derived growth factor in normal and diabetic rats.J Clin Invest. 1985; 76: 2323-2329Crossref PubMed Scopus (225) Google Scholar, 12Pierce GF Mustoe TA Senior RM Reed J Griffin GL Thomason A Deuel TF In vivo incisional wound healing augmented by platelet-derived growth factor and recombinant c-sis gene homodimeric proteins.J Exp Med. 1988; 167: 974-987Crossref PubMed Scopus (212) Google Scholar, 13Greenhalgh DG Sprugel KH Murray MJ Ross R PDGF and FGF stimulate wound healing in the genetically diabetic mouse.Am J Pathol. 1990; 136: 1235-1246PubMed Google Scholar Many reports have also demonstrated that exogenous PDGF can enhance angiogenesis. In mice, implantation of PDGF B-chain-transfected melanoma cells resulted in increased fibrovascular stroma development relative to untransfected cells.14Forsberg K Valyi-Nagy I Heldin CH Herlyn M Westermark B Platelet-derived growth factor (PDGF) in oncogenesis: development of a vascular connective tissue stroma in xenotransplanted human melanoma producing PDGF-BB.Proc Natl Acad Sci USA. 1993; 90: 393-397Crossref PubMed Scopus (204) Google Scholar Administration of PDGF B-chain to the chick chorioallantoic membrane resulted in increased numbers of vessels with little inflammation.15Risau W Drexler H Mironov V Smits A Siegbahn A Funa K Heldin CH Platelet-derived growth factor is angiogenic in vivo.Growth Factors. 1992; 7: 261-266Crossref PubMed Scopus (230) Google Scholar, 16Oikawa T Onozawa C Sakaguchi M Morita I Murota S Three isoforms of platelet-derived growth factors all have the capability to induce angiogenesis in vivo.Biol Pharm Bull. 1994; 17: 1686-1688Crossref PubMed Scopus (37) Google Scholar In vitro studies similarly suggested that PDGF B-chain could be proangiogenic under some conditions, and that its target could be either ECs, or vascular smooth muscle cells (SMCs), or both. Most ECs, in culture or in vivo, do not express detectable PDGFRβ and do not respond to PDGF. However, some in vitro models of angiogenesis demonstrate that PDGF B-chain is capable of stimulating EC proliferation, movement, and tube formation.17Bar RS Boes M Booth BA Dake BL Henley S Hart MN The effects of platelet-derived growth factor in cultured microvessel endothelial cells.Endocrinology. 1989; 124: 1841-1848Crossref PubMed Scopus (92) Google Scholar, 18Battegay EJ Rupp J Iruela-Arispe L Sage EH Pech M PDGF-BB modulates endothelial proliferation and angiogenesis in vitro via PDGF beta-receptors.J Cell Biol. 1994; 125: 917-928Crossref PubMed Scopus (329) Google Scholar, 19Nicosia RF Nicosia SV Smith M Vascular endothelial growth factor, platelet-derived growth factor, and insulin-like growth factor-1 promote rat aortic angiogenesis in vitro.Am J Pathol. 1994; 145: 1023-1029PubMed Google Scholar PDGF also acts on vascular support cells, including pericytes, vascular SMCs, and adventitial fibroblasts. In vitro, PDGF B-chain from ECs can recruit perivascular cells via chemotaxis20Hirschi KK Rohovsky SA D'Amore PA PDGF, TGF-beta, and heterotypic cell-cell interactions mediate endothelial cell-induced recruitment of 10T1/2 cells and their differentiation to a smooth muscle fate.J Cell Biol. 1998; 141: 805-814Crossref PubMed Scopus (696) Google Scholar, 21Hirschi KK Rohovsky SA Beck LH Smith SR D'Amore PA Endothelial cells modulate the proliferation of mural cell precursors via platelet-derived growth factor-BB and heterotypic cell contact.Circ Res. 1999; 84: 298-305Crossref PubMed Scopus (284) Google Scholar and by stimulating proliferation. The addition of PDGF B-chain to aortic organ cultures results in an outgrowth of fibroblast-like cells followed by numerous small vascular outgrowths.19Nicosia RF Nicosia SV Smith M Vascular endothelial growth factor, platelet-derived growth factor, and insulin-like growth factor-1 promote rat aortic angiogenesis in vitro.Am J Pathol. 1994; 145: 1023-1029PubMed Google ScholarThe studies above demonstrate that experimentally added PDGF is sufficient, under at least some circumstances, to promote connective tissue formation and/or vascularization. It has been more difficult to test the hypothesis that endogenous PDGF plays an important role in response to injury. Homozygous deletion of either PDGF B-chain or PDGFRβ in mice results in perinatal lethality. The most prominent defect in both the PDGF B-chain−/− and PDGFRβ−/− mice is abnormal blood vessels and renal glomeruli.22Leveen P Pekny M Gebre-Medhin S Swolin B Larsson E Betsholtz C Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities.Genes Dev. 1994; 8: 1875-1887Crossref PubMed Scopus (861) Google Scholar, 23Soriano P Abnormal kidney development and hematological disorders in PDGF beta-receptor mutant mice.Genes Dev. 1994; 8: 1888-1896Crossref PubMed Scopus (791) Google Scholar, 24Lindahl P Johansson BR Leveen P Betsholtz C Pericyte loss and microaneurysm formation in PDGF-B-deficient mice.Science. 1997; 277: 242-245Crossref PubMed Scopus (1716) Google Scholar The primary defect seems to be in pericytes rather than ECs. The pericytes express PDGFRβ and are likely targeted by PDGF B-chain expressed by the ECs.24Lindahl P Johansson BR Leveen P Betsholtz C Pericyte loss and microaneurysm formation in PDGF-B-deficient mice.Science. 1997; 277: 242-245Crossref PubMed Scopus (1716) Google Scholar Pericytes are reduced in number in both knockouts,24Lindahl P Johansson BR Leveen P Betsholtz C Pericyte loss and microaneurysm formation in PDGF-B-deficient mice.Science. 1997; 277: 242-245Crossref PubMed Scopus (1716) Google Scholar, 25Hellstrom M Kalen M Lindahl P Abramsson A Betsholtz C Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse.Development. 1999; 126: 3047-3055Crossref PubMed Google Scholar whereas ECs are increased in number.26Hellstrom M Gerhardt H Kalen M Li X Eriksson U Wolburg H Betsholtz C Lack of pericytes leads to endothelial hyperplasia and abnormal vascular morphogenesis.J Cell Biol. 2001; 153: 543-554Crossref PubMed Scopus (813) Google Scholar The vessels are dilated and hyperpermeable, leading to edema and hemorrhage.Because PDGF B-chain and PDGFRβ null mice do not survive to adulthood, they cannot be used to assess the roles of PDGF in pathological processes or in normal wound repair. To circumvent this limitation, and to obtain quantitative information about the role of the PDGF B-chain/PDGFRβ system in cell proliferation and migration, we have previously used a form of quantitative chimera analysis. In that approach, we prepared chimeric mouse embryos by fusing embryos from wild-type and genomically-marked PDGFRβ−/− lines. As these chimeric embryos develop, we could use changes in the relative abundance of wild-type and mutant cells to calculate the selective advantage conferred by PDGFRβ expression in different cell lineages during growth and differentiation. This technique demonstrated that PDGFRβ plays a role in the development of SMCs, but not ECs or fibroblasts.27Crosby JR Seifert RA Soriano P Bowen-Pope DF Chimaeric analysis reveals role of Pdgf receptors in all muscle lineages.Nat Genet. 1998; 18: 385-388Crossref PubMed Scopus (95) Google Scholar By contrast, PDGFRβ expression was very important for EC and fibroblast participation in the formation of granulation tissue in an adult model of response to injury.28Crosby JR Tappan KA Seifert RA Bowen-Pope DF Chimera analysis reveals that fibroblasts and endothelial cells require platelet-derived growth factor receptor-beta expression for participation in reactive connective tissue formation in adults but not during development.Am J Pathol. 1999; 154: 1315-1321Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar In that report, we speculated that the importance of PDGFRβ for ECs and fibroblasts in granulation tissue formation reflected an important role for PDGF B-chain delivered by platelets and macrophages to the injured/inflamed tissue.Although quantitative chimera analysis of PDGFRβ function in aggregation chimeras is able to demonstrate a requirement for PDGF in granulation tissue formation, it is not able to discern the source of this PDGF. In this report, we prepared a different kind of chimeric mouse to test the hypothesis that the PDGF that drives wound repair in injured adult tissue is primarily derived from platelets and macrophages. Because these cells are of hematopoietic origin, we could specifically eliminate their ability to provide PDGF by creating hematopoietic chimeras, in which the hematopoietic system of a wild-type mouse was ablated by irradiation and replaced by hematopoietic cells from PDGF B-chain −/− mice.29Kaminski WE Lindahl P Lin NL Broudy VC Crosby JR Hellstrom M Swolin B Bowen-Pope DF Martin PJ Ross R Betsholtz C Raines EW Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF beta-receptor null mice.Blood. 2001; 97: 1990-1998Crossref PubMed Scopus (58) Google Scholar We were surprised to find that the lack of PDGF B-chain of hematopoietic origin did not reduce the granulation tissue that formed in two models of response to injury: implantation of a sponge and formation of an organized intravascular thrombus. In fact, the absence of PDGF B-chain from hematopoietic cells actually increased the extent of vascularization of these lesions. We conclude that delivery of PDGF B-chain by platelets and macrophages is not important for granulation tissue formation, at least in these situations, and discuss two possible mechanisms through which disruption of normal spatial-temporal patterns of PDGF delivery could result in reduced vascularity of the tissue.Materials and MethodsCreation of Hematopoietic ChimerasB6.SJL Ly5a mice were purchased from the Jackson Laboratory (Bar Harbor, ME) or bred at the Fred Hutchinson Cancer Research Center (Seattle, WA). 129SV-C 57BL/6J Ly5b mice heterozygous for PDGF B-chain22Leveen P Pekny M Gebre-Medhin S Swolin B Larsson E Betsholtz C Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities.Genes Dev. 1994; 8: 1875-1887Crossref PubMed Scopus (861) Google Scholar were bred in the Department of Medical Biochemistry, University of Goteborg (Goteborg, Sweden). Hematopoietic chimeras lacking PDGF B-chain expression in cells of hematopoietic origin (hematopoietic B−/− chimeras) were created as previously described.29Kaminski WE Lindahl P Lin NL Broudy VC Crosby JR Hellstrom M Swolin B Bowen-Pope DF Martin PJ Ross R Betsholtz C Raines EW Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF beta-receptor null mice.Blood. 2001; 97: 1990-1998Crossref PubMed Scopus (58) Google Scholar Briefly, 129SV-C57BL/6J PDGF B-chain +/− heterozygotes were mated and E16.5 embryos collected and genotyped. Livers from PDGF B-chain +/+ and −/− embryonic littermates were disaggregated as a source of hematopoietic progenitors. These were injected into the tail vein of wild-type 6-to 12-week-old host B6.SJL Ly5a mice that had been exposed to 14 Gy total body irradiation 1 day before transplantation to eliminate the host hematopoietic system. Recipients were transferred to conventional housing 6 to 8 weeks after transplantation. Complete replacement of host with donor hematopoietic cells had occurred by 3 months29Kaminski WE Lindahl P Lin NL Broudy VC Crosby JR Hellstrom M Swolin B Bowen-Pope DF Martin PJ Ross R Betsholtz C Raines EW Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF beta-receptor null mice.Blood. 2001; 97: 1990-1998Crossref PubMed Scopus (58) Google Scholar and all experiments were performed after this time.Surgical Implantation of SpongesMice were anesthetized by intraperitoneal injection of 100 mg/kg of ketamine and 8 mg/kg of xylazine. Four sterile 5 mm in diameter, 3-mm high polyvinyl alcohol sponges (IVALON; Unipont Industries, Thomasville, NC) were implanted subcutaneously into each mouse via small dorsal midline incisions over the cranial thoracic area and over the lumbar area. One sponge was implanted on each side of the incisions and the incisions were closed using Clay Adams 9-mm wound clips (Becton Dickinson, Sparks, MD). At 6 and 8 weeks after implantation, three mice of each hematopoietic genotype were humanely euthanized and the sponges harvested.Carotid LigationMice were anesthetized by intraperitoneal injection of 100 mg/kg of ketamine and 8 mg/kg of xylazine. A midventral cervical incision was made followed by blunt dissection to isolate the left common carotid artery that was ligated with 6-0 silk just proximal to the bifurcation into external and internal branches. The skin incision was closed using Michel wound clips. At 4 weeks after ligation, six mice of each hematopoietic genotype were humanely euthanized and carotids harvested.Vessel Identification and QuantitationExcised sponges were fixed in methyl Carnoy’s fixative, embedded in paraffin, and cut into 5-μm sections. Vessels within the sponge-induced granulation tissue were identified using four techniques: 1) lumens surrounded by flattened cells visualized after staining with Masson’s trichrome stain; 2) vascular basement membrane profiles immunostained using rabbit anti-mouse laminin (Collaborative Biomedical Products, Bedford, MA) followed by biotinylated goat anti-rabbit IgG then Vectastain elite ABC peroxidase (Vector Laboratories, Burlingame, CA) and visualized using diaminobenzidine with methyl green nuclear counterstain; 3) histologically recognizable vessels associated with smooth muscle α-actin-positive cells identified by immunostaining using monoclonal anti-α-actin conjugated to peroxidase (catalog no. U7033; DAKO, Carpinteria, CA) and visualized using diaminobenzidine with methyl green nuclear counterstain; and 4) histologically recognizable vessels associated with desmin-positive cells identified by immunostaining with monoclonal anti-desmin conjugated to peroxidase (catalog no. U7023, DAKO) and visualized using diaminobenzidine with methyl green nuclear counterstain.Excised carotid arteries were fixed in formalin, paraffin embedded, serially sectioned at 5 μm, and stained with hematoxylin and eosin. Vessels within the organized thrombus were identified by histology.To evaluate vessel density, vessels identified using each of the above methods were counted using an intraocular grid. To ensure that only newly formed vessels were included in the data, only vessels at least 0.5-mm interior to the sponge margin, or inside the internal elastic lamella of the carotid, were counted. To determine the fractional area occupied by vessels, a 121-point grid was placed over a video monitor onto which ×200 images of the sponge were displayed from a Hamamatsu charge-coupled device camera attached to the microscope. The number of points on the grid that fell within a vessel lumen or on the endothelium were counted as a measure of vascular area. All analyses were done blinded to tissue source.Quantitation of PDGF B-Chain Transcript Expression in Fixed Sponge Granulation TissueRNA was isolated from paraffin-embedded sponge granulation tissue by cutting two 50-μm thick sections and incubating at room temperature in xylene for 10 minutes with gentle mixing, followed by centrifugation at 14,000 rpm for 5 minutes, and removal of the supernatant. Ethanol (100%) was added and the tissue sections resuspended, microfuged at 14,000 rpm for 5 minutes, the ethanol aspirated off, and the sections air-dried for 5 minutes. The sections were solubilized by the addition of 1 ml of Trizol, vortexing for 1 minute, and passage through 22- and 25-gauge needles. Four μl of molecular biology grade glycogen, 20 mg/ml, was added to each sample, mixed, and incubated at room temperature for 5 minutes. Two hundred μl of CHCl3 was added to each sample, followed by 15 seconds of vigorous shaking, a 5-minute room temperature incubation, and 15 minutes of microfugation at 12,000 rpm at 4°C. The upper aqueous phase was transferred to a new tube and an equal volume of isopropanol was added, mixed, and incubated at room temperature for 10 minutes followed by centrifugation at 10,000 rpm, 4°C, for 10 minutes. The supernatant was removed and discarded and the RNA washed by adding 1 ml of −20°C 75% ethanol, vortexing, and centrifugation at 8000 rpm, 4°C, for 5 minutes. The supernatant was discarded and the RNA dried at room temperature for 5 minutes and resuspended in 10 μl of diethyl pyrocarbonate water. cDNA primed by random hexamers was made from the extracted RNA using the Gibco BRL Superscript Preamplification System.Transcript levels were quantitated by real time polymerase chain reaction. Standard 18s primers and TaqMan probe and custom-made PDGF B-chain primers and TaqMan probe were obtained from PE Biosystems (Foster City, CA). PDGF B-chain forward primer: tccggagtcgagttggaaag; reverse primer: ggcgattacagcaggctctg; probe: FAM-tcgagggaggaggagccta-TAMRA. Thermocycling was performed on the GeneAmp 5700 Sequence Detection System (Perkin Elmer) using the following parameters: 50°C for 2 minutes, 95°C for 10 minutes, then alternating 40 times between 95°C for 20 seconds and 50°C for 60 seconds. Threshold (CT) values were calculated by the GeneAmp 5700 SDS Detector software. Each sample was analyzed in triplicate polymerase chain reaction reactions accompanied by a standard curve and two no-template control reactions.ResultsPDGF B-Chain Levels Are Significantly Reduced in Granulation Tissue of Hematopoietic B−/− ChimerasWe created hematopoietic chimeras by high-dose irradiation of wild-type donor mice followed by intravenous injection of hematopoietic progenitors from donor PDGF B-chain−/− embryos, or from PDGF B-chain +/+ embryos as controls (see Materials and Methods).29Kaminski WE Lindahl P Lin NL Broudy VC Crosby JR Hellstrom M Swolin B Bowen-Pope DF Martin PJ Ross R Betsholtz C Raines EW Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF beta-receptor null mice.Blood. 2001; 97: 1990-1998Crossref PubMed Scopus (58) Google Scholar, 30Crosby JR Kaminski WE Schatteman G Martin PJ Raines EW Seifert RA Bowen-Pope DF Endothelial cells of hematopoietic origin make a significant contribution to adult blood vessel formation.Circ Res. 2000; 87: 728-730Crossref PubMed Scopus (454) Google Scholar We have already found that lack of PDGF B-chain expression by hematopoietic cells and their progenitors does not affect the establishment of a normal hematopoietic system in the host mice, with platelets and all leukocyte cell types present at their normal levels.29Kaminski WE Lindahl P Lin NL Broudy VC Crosby JR Hellstrom M Swolin B Bowen-Pope DF Martin PJ Ross R Betsholtz C Raines EW Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF beta-receptor null mice.Blood. 2001; 97: 1990-1998Crossref PubMed Scopus (58) Google Scholar The hematopoietic B−/− chimeras are expected to show no PDGF B-chain expression in platelets, macrophages, or other hematopoietic derivatives, but expression of PDGF B-chain in nonhematopoietic cell types, including ECs, should be normal. To verify the absence of PDGF B-chain from hematopoietic cells, we isolated peritoneal macrophages and evaluated B-chain transcript levels by semiquantitative reverse transcriptase-polymerase chain reaction. Stimulated peritoneal macrophages from hematopoietic B+/+ chimeras produced abundant PDGF B-chain transcripts whereas stimulated peritoneal macrophages from hematopoietic B−/− chimeras did not produce detectable PDGF B-chain transcripts (data not shown). To evaluate PDGF B-chain expression by other cell types within granulation tissue, we isolated mRNA from the sponge-induced granulation tissue (see below). Figure 1 shows that PDGF B-chain transcript levels in hematopoietic B−/− chimeras are 18% (at 6 weeks) and 21% (at 8 weeks) of the levels in hematopoietic B+/+ chimeras. This demonstrates that the majority of PDGF B chain transcript within granulation tissue is of hematopoietic origin, but that a substantial portion is of nonhematopoietic origin, probably from ECs. It should be noted, however, that because the great majority of the PDGF B-chain protein present in platelets was synthesized in the megakaryocyte precursors of platelets, the contribution of PDGF B-chain protein from platelets will be underestimated by measurement of transcript levels.PDGF B-Chain of Hematopoietic Origin Is Not Necessary for Foreign Body-Induced Granulation Tissue Formation and Its Absence Promotes VascularizationAs a model system in which to evaluate granulation tissue formation and vascularization, we implanted polyvinyl alcohol sponges subcutaneously into the hematopoietic chimeric mice. A highly vascularized granulation tissue forms in and around the sponge matrix. Because the sponge is initially devoid of cells, any tissue found inside the sponge can be considered newly formed, and this is where we focused our evaluation. The granulation tissue in the hematopoietic B−/− chimeras contained a noticeably greater density of blood vessels than did hematopoietic B+/+ chimeras. We quantitated the density of vessels within the sponge at 6 and 8 weeks after implantation. We identified vessels by combining morphology with one of the following: 1) Masson’s trichrome, a connective tissue stain with which vessels are easily identified (Figure 2, A and D); 2) anti-smooth muscle α-actin antibody, which delineates a subset of vessels surrounded by α-actin-positive cells (SMCs and pericytes); 3) anti-desmin antibody, which delineates a subset of vessels surrounded by desmin-expressing cells (SMCs and pericytes); and 4) anti-laminin antibody, which clearly stains vascular basement membranes (Figure 2, B and E). As shown in Figure 3, regardless of the method used to identify vessels, there are significantly more vessels within the granulation tissue of hematopoietic B−/− chimeras at both 6 and 8 weeks after implantation. Depending on the method used to assess vascularity, and the time point selected, vascularity was increased by 1.7-fold to 2.5-fold and, on the average, it doubled the" @default.
• W2003643174 created "2016-06-24" @default.
• W2003643174 creator A5009460254 @default.
• W2003643174 creator A5035241714 @default.
• W2003643174 creator A5035813072 @default.
• W2003643174 creator A5041237749 @default.
• W2003643174 creator A5048344255 @default.
• W2003643174 creator A5051005847 @default.
• W2003643174 creator A5059063645 @default.
• W2003643174 creator A5073970670 @default.
• W2003643174 creator A5080417828 @default.
• W2003643174 creator A5085424678 @default.
• W2003643174 date "2001-11-01" @default.
• W2003643174 modified "2023-10-15" @default.
• W2003643174 title "Platelet-Derived Growth Factor B-Chain of Hematopoietic Origin Is Not Necessary for Granulation Tissue Formation and Its Absence Enhances Vascularization" @default.
• W2003643174 cites W1483090589 @default.
• W2003643174 cites W1493414055 @default.
• W2003643174 cites W1495712810 @default.
• W2003643174 cites W1525012305 @default.
• W2003643174 cites W1631150466 @default.
• W2003643174 cites W1973418567 @default.
• W2003643174 cites W1974659616 @default.
• W2003643174 cites W1974790290 @default.
• W2003643174 cites W1976964404 @default.
• W2003643174 cites W1979356105 @default.
• W2003643174 cites W2002513158 @default.
• W2003643174 cites W2002621910 @default.
• W2003643174 cites W2012390831 @default.
• W2003643174 cites W2012460154 @default.
• W2003643174 cites W2028245130 @default.
• W2003643174 cites W2048258133 @default.
• W2003643174 cites W2061892936 @default.
• W2003643174 cites W2074940237 @default.
• W2003643174 cites W2076345713 @default.
• W2003643174 cites W2087890016 @default.
• W2003643174 cites W2095504227 @default.
• W2003643174 cites W2097146615 @default.
• W2003643174 cites W2103423185 @default.
• W2003643174 cites W2108337314 @default.
• W2003643174 cites W2110153861 @default.
• W2003643174 cites W2112913335 @default.
• W2003643174 cites W2113436661 @default.
• W2003643174 cites W2115515762 @default.
• W2003643174 cites W2116385071 @default.
• W2003643174 cites W2123521997 @default.
• W2003643174 cites W2125302698 @default.
• W2003643174 cites W2131393213 @default.
• W2003643174 cites W2131419480 @default.
• W2003643174 cites W2137577023 @default.
• W2003643174 cites W2148371225 @default.
• W2003643174 cites W2149442576 @default.
• W2003643174 cites W2156606731 @default.
• W2003643174 cites W2169199162 @default.
• W2003643174 cites W2170346765 @default.
• W2003643174 cites W2331618042 @default.
• W2003643174 doi "https://doi.org/10.1016/s0002-9440(10)63033-7" @default.
• W2003643174 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1867078" @default.
• W2003643174 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11696447" @default.
• W2003643174 hasPublicationYear "2001" @default.
• W2003643174 type Work @default.
• W2003643174 sameAs 2003643174 @default.
• W2003643174 citedByCount "22" @default.
• W2003643174 countsByYear W20036431742012 @default.
• W2003643174 countsByYear W20036431742013 @default.
• W2003643174 countsByYear W20036431742014 @default.
• W2003643174 crossrefType "journal-article" @default.
• W2003643174 hasAuthorship W2003643174A5009460254 @default.
• W2003643174 hasAuthorship W2003643174A5035241714 @default.
• W2003643174 hasAuthorship W2003643174A5035813072 @default.
• W2003643174 hasAuthorship W2003643174A5041237749 @default.
• W2003643174 hasAuthorship W2003643174A5048344255 @default.
• W2003643174 hasAuthorship W2003643174A5051005847 @default.
• W2003643174 hasAuthorship W2003643174A5059063645 @default.
• W2003643174 hasAuthorship W2003643174A5073970670 @default.
• W2003643174 hasAuthorship W2003643174A5080417828 @default.
• W2003643174 hasAuthorship W2003643174A5085424678 @default.
• W2003643174 hasBestOaLocation W20036431741 @default.
• W2003643174 hasConcept C109159458 @default.
• W2003643174 hasConcept C142724271 @default.
• W2003643174 hasConcept C159973064 @default.
• W2003643174 hasConcept C159985019 @default.
• W2003643174 hasConcept C170493617 @default.
• W2003643174 hasConcept C180361614 @default.
• W2003643174 hasConcept C192562407 @default.
• W2003643174 hasConcept C203014093 @default.
• W2003643174 hasConcept C2775960820 @default.
• W2003643174 hasConcept C2776055305 @default.
• W2003643174 hasConcept C2780269544 @default.
• W2003643174 hasConcept C2781294074 @default.
• W2003643174 hasConcept C28328180 @default.
• W2003643174 hasConcept C55493867 @default.
• W2003643174 hasConcept C71924100 @default.
• W2003643174 hasConcept C86803240 @default.
• W2003643174 hasConcept C88463166 @default.
• W2003643174 hasConcept C89560881 @default.
• W2003643174 hasConcept C95444343 @default.
• W2003643174 hasConceptScore W2003643174C109159458 @default.
• W2003643174 hasConceptScore W2003643174C142724271 @default.

• next