FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2004116877> ?p ?o ?g. }

• W2004116877 endingPage "9816" @default.
• W2004116877 startingPage "9808" @default.
• W2004116877 abstract "In the present work, we characterized H+ and HCO3−transport mechanisms in the submandibular salivary gland (SMG) ducts of wild type, NHE2−/−, NHE3−/−, and NHE2−/−;NHE3−/− double knock-out mice. The bulk of recovery from an acid load across the luminal membrane (LM) of the duct was mediated by a Na+-dependent HOE and ethyl-isopropyl-amiloride (EIPA)-inhibitable and 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (DIDS)-insensitive mechanism. HCO3− increased the rate of luminal Na+-dependent pHi recovery but did not change inhibition by HOE and EIPA or the insensitivity to DIDS. Despite expression of NHE2 and NHE3 in the LM of the duct, the same activity was observed in ducts from wild type and all mutant mice. Measurements of Na+-dependent OH−and/or HCO3− cotransport (NBC) activities in SMG acinar and duct cells showed separate DIDS-sensitive/EIPA-insensitive and DIDS-insensitive/EIPA-sensitive NBC activities in both cell types. Functional and immunocytochemical localization of these activities in the perfused duct indicated that pNBC1 probably mediates the DIDS-sensitive/EIPA-insensitive transport in the basolateral membrane, and splice variants of NBC3 probably mediate the DIDS-insensitive/EIPA-sensitive NBC activity in the LM of duct and acinar cells. Notably, the acinar cell NBC3 variants transported HCO3− but not OH−. By contrast, duct cell NBC3 transported both OH− and HCO3−. Accordingly, reverse transcription-polymerase chain reaction analysis revealed that both cell types expressed mRNA for pNBC1. However, the acini expressed mRNA for the NBC3 splice variants NBCn1C and NBCn1D, whereas the ducts expressed mRNA for NCBn1B. Based on these findings we propose that the luminal NBCs in the HCO3−secreting SMG acinar and duct cells function as HCO3− salvage mechanisms at the resting state. These studies emphasize the complexity but also begin to clarify the mechanism of HCO3−homeostasis in secretory epithelia. In the present work, we characterized H+ and HCO3−transport mechanisms in the submandibular salivary gland (SMG) ducts of wild type, NHE2−/−, NHE3−/−, and NHE2−/−;NHE3−/− double knock-out mice. The bulk of recovery from an acid load across the luminal membrane (LM) of the duct was mediated by a Na+-dependent HOE and ethyl-isopropyl-amiloride (EIPA)-inhibitable and 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (DIDS)-insensitive mechanism. HCO3− increased the rate of luminal Na+-dependent pHi recovery but did not change inhibition by HOE and EIPA or the insensitivity to DIDS. Despite expression of NHE2 and NHE3 in the LM of the duct, the same activity was observed in ducts from wild type and all mutant mice. Measurements of Na+-dependent OH−and/or HCO3− cotransport (NBC) activities in SMG acinar and duct cells showed separate DIDS-sensitive/EIPA-insensitive and DIDS-insensitive/EIPA-sensitive NBC activities in both cell types. Functional and immunocytochemical localization of these activities in the perfused duct indicated that pNBC1 probably mediates the DIDS-sensitive/EIPA-insensitive transport in the basolateral membrane, and splice variants of NBC3 probably mediate the DIDS-insensitive/EIPA-sensitive NBC activity in the LM of duct and acinar cells. Notably, the acinar cell NBC3 variants transported HCO3− but not OH−. By contrast, duct cell NBC3 transported both OH− and HCO3−. Accordingly, reverse transcription-polymerase chain reaction analysis revealed that both cell types expressed mRNA for pNBC1. However, the acini expressed mRNA for the NBC3 splice variants NBCn1C and NBCn1D, whereas the ducts expressed mRNA for NCBn1B. Based on these findings we propose that the luminal NBCs in the HCO3−secreting SMG acinar and duct cells function as HCO3− salvage mechanisms at the resting state. These studies emphasize the complexity but also begin to clarify the mechanism of HCO3−homeostasis in secretory epithelia. cystic fibrosis cystic fibrosis transmembrane conductance regulator Na+/H+ exchanger Na+- HCO3− co-transporter wild type luminal membrane basolateral membrane submandibular gland 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid base pairs 2′7′-bis (carboxyethyl)-5-carboxyfluorescence)-acetoxy methyl reverse transcriptase-polymerase chain reaction HCO3− is an anion of paramount biological importance. Among other functions, it determines the pH and controls the solubility of proteins and ions in biological fluids. Yet, the mechanism of HCO3− secretion at the tissue and cellular levels is poorly understood. This is exemplified in studies of ion transport by cystic fibrosis transmembrane conductance regulator (CFTR)1-expressing cells. When stimulated, most CFTR-expressing cells absorb Cl− and secrete HCO3− (1Cook D.I. van Lennep E.W. Roberts M.L. Young J.A. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1061-1117Google Scholar, 2Argent B.E. Case R.M. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1478-1498Google Scholar, 3Pilewski J.M. Frizzell R.A. Physiol. Rev. 1999; 79: S215-S255Crossref PubMed Scopus (384) Google Scholar, 4Grubb B.R. Boucher R.C. Physiol. Rev. 1999; 79: S193-S213Crossref PubMed Scopus (341) Google Scholar, 5Johansen P.G. Anderson C.M. Hadorn B. Lancet. 1968; 1: 455-460Abstract Google Scholar, 6Kopelman H. Corey M. Gaskin K. Durie P. Weizman Z. Forstner G. Gastroenterology. 1988; 95: 349-355Abstract Full Text PDF PubMed Scopus (0) Google Scholar). Although the mechanism of Cl− absorption by these cells has been extensively studied, few studies have examined the mechanism of HCO3− secretion (1Cook D.I. van Lennep E.W. Roberts M.L. Young J.A. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1061-1117Google Scholar, 2Argent B.E. Case R.M. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1478-1498Google Scholar, 3Pilewski J.M. Frizzell R.A. Physiol. Rev. 1999; 79: S215-S255Crossref PubMed Scopus (384) Google Scholar, 4Grubb B.R. Boucher R.C. Physiol. Rev. 1999; 79: S193-S213Crossref PubMed Scopus (341) Google Scholar, 5Johansen P.G. Anderson C.M. Hadorn B. Lancet. 1968; 1: 455-460Abstract Google Scholar, 6Kopelman H. Corey M. Gaskin K. Durie P. Weizman Z. Forstner G. Gastroenterology. 1988; 95: 349-355Abstract Full Text PDF PubMed Scopus (0) Google Scholar). Commonly, fluid and electrolyte secretion by epithelia occurs in two steps. Acinar cells secrete a plasma-like fluid containing about 140 mm NaCl and 25 mmHCO3− into the duct lumen. The duct absorbs the Cl− (and sometime the Na+, as is the case in the lung (3Pilewski J.M. Frizzell R.A. Physiol. Rev. 1999; 79: S215-S255Crossref PubMed Scopus (384) Google Scholar) and the submandibular salivary gland (SMG) (1Cook D.I. van Lennep E.W. Roberts M.L. Young J.A. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1061-1117Google Scholar)) and secretes as much as 140 mmHCO3− (1Cook D.I. van Lennep E.W. Roberts M.L. Young J.A. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1061-1117Google Scholar, 2Argent B.E. Case R.M. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1478-1498Google Scholar, 5Johansen P.G. Anderson C.M. Hadorn B. Lancet. 1968; 1: 455-460Abstract Google Scholar, 6Kopelman H. Corey M. Gaskin K. Durie P. Weizman Z. Forstner G. Gastroenterology. 1988; 95: 349-355Abstract Full Text PDF PubMed Scopus (0) Google Scholar). CFTR plays a prominent role in Cl− absorption and HCO3− secretion, as is evident from the high Cl−-low HCO3− in fluids secreted by glands of CF patients (5Johansen P.G. Anderson C.M. Hadorn B. Lancet. 1968; 1: 455-460Abstract Google Scholar, 6Kopelman H. Corey M. Gaskin K. Durie P. Weizman Z. Forstner G. Gastroenterology. 1988; 95: 349-355Abstract Full Text PDF PubMed Scopus (0) Google Scholar). Ductal HCO3− secretion and Cl−absorption are tightly coupled (1Cook D.I. van Lennep E.W. Roberts M.L. Young J.A. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1061-1117Google Scholar, 2Argent B.E. Case R.M. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1478-1498Google Scholar, 3Pilewski J.M. Frizzell R.A. Physiol. Rev. 1999; 79: S215-S255Crossref PubMed Scopus (384) Google Scholar, 4Grubb B.R. Boucher R.C. Physiol. Rev. 1999; 79: S193-S213Crossref PubMed Scopus (341) Google Scholar), which is interpreted in most models to mean that Cl− absorption and HCO3− secretion are mediated by a luminal Cl−/HCO3− exchange mechanism (1Cook D.I. van Lennep E.W. Roberts M.L. Young J.A. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1061-1117Google Scholar, 2Argent B.E. Case R.M. Johnson L.R. Physiology of the Gastrointestinal Tract.in: Raven Press, Ltd., New York1994: 1478-1498Google Scholar, 3Pilewski J.M. Frizzell R.A. Physiol. Rev. 1999; 79: S215-S255Crossref PubMed Scopus (384) Google Scholar, 4Grubb B.R. Boucher R.C. Physiol. Rev. 1999; 79: S193-S213Crossref PubMed Scopus (341) Google Scholar). Recently we showed that CFTR regulates Cl−/HCO3− exchange activity in model systems (7Lee M.G. Wigley W.C. Zeng W. Noel L.E. Marino C.R. Thomas P.J. Muallem S. J. Biol. Chem. 1999; 274: 3414-3421Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar) and native cells (8Lee M.G. Choi J.Y. Luo X. Strickland E. Thomas P.J. Muallem S. J. Biol. Chem. 1988; 274: 14670-14677Abstract Full Text Full Text PDF Scopus (169) Google Scholar). At the resting state HCO3−-secreting cells and tissues need to salvage the HCO3−leaking to or entering the duct lumen. That is, HCO3−-secreting cells should have HCO3−-absorbing mechanisms that are active in the resting state and are inhibited in the stimulated state. There is no knowledge in acinar cells and very little is known of the molecular and functional nature of these mechanisms in duct cells of any secretory gland. Early work with the rat SMG duct identified a ductal Na+/H+ exchange activity with pharmacological characteristics of isoform 2 of the NHE family (NHE2) (9Paulais M. Cragoe Jr., E.J. Turner R.J. Am. J. Physiol. 1994; 266: C1594-C1602Crossref PubMed Google Scholar, 10Chaturapanich G. Ishibashi H. Dinudom A. Young J.A. Cook D.I. J. Physiol. 1997; 503: 583-598Crossref PubMed Scopus (18) Google Scholar). Subsequently, we used RT-PCR analysis and immunocytochemistry to show expression of NHE1 in the basolateral membrane (BLM) and NHE2 and NHE3 in the luminal membrane (LM) of the rat SMG duct (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar). A similar approach was used to report expression of NHE1 in the BLM and NHE3 in the LM of the rat parotid gland duct (12Park K. Olschowka J.A. Richardson L.A. Bookstein C. Chang E.B. Melvin J.E. Am. J. Physiol. 1999; 276: G470-G478PubMed Google Scholar). Nevertheless, based on functional assays and pharmacological characterization, we concluded that only NHE1 and NHE2 are functional in the SMG duct (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar), and Park et al. (12Park K. Olschowka J.A. Richardson L.A. Bookstein C. Chang E.B. Melvin J.E. Am. J. Physiol. 1999; 276: G470-G478PubMed Google Scholar) conclude that NHE1 and NHE3 are functional in the parotid duct. In a more recent work, we used animals in which the NHE2 and theNHE3 genes were disrupted to show that NHE3 and a novel, unidentified Na+-dependent HOE 694 (HOE)- and EIPA-sensitive mechanism mediate HCO3−salvage mechanism in the pancreatic duct (13Lee M.G. Ahn W. Choi J.Y. Luo X. Seo J.T. Schultheis P.J. Shull G.E. Kim K.H. Muallem S. J. Clin. Invest. 2000; 105: 1651-1658Crossref PubMed Scopus (58) Google Scholar). However, these studies (13Lee M.G. Ahn W. Choi J.Y. Luo X. Seo J.T. Schultheis P.J. Shull G.E. Kim K.H. Muallem S. J. Clin. Invest. 2000; 105: 1651-1658Crossref PubMed Scopus (58) Google Scholar) did not identify the novel luminal Na+-dependent, HOE- and EIPA-sensitive mechanism and did not exclude the possibility that disruption of one gene resulted in a compensatory up-regulation of the second gene to increase luminal NHE activity back to normal, thus resulting in a lack of phenotype in ducts from NHE2−/− and/or NHE3−/− mice. H+/HCO3− transport mechanisms by acinar cells are only partially known, and their possible role in transcellular HCO3− transport is completely unknown. Salivary gland (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar, 12Park K. Olschowka J.A. Richardson L.A. Bookstein C. Chang E.B. Melvin J.E. Am. J. Physiol. 1999; 276: G470-G478PubMed Google Scholar) and pancreatic acinar cells (14Muallem S. Loessberg P.A. J. Biol. Chem. 1990; 265: 12806-12812Abstract Full Text PDF PubMed Google Scholar) express NHE1 in the basolateral membrane. Na+/HCO3−cotransport (NBC) activity of pancreatic acinar cells (14Muallem S. Loessberg P.A. J. Biol. Chem. 1990; 265: 12806-12812Abstract Full Text PDF PubMed Google Scholar, 15Muallem S. Loessberg P.A. J. Biol. Chem. 1990; 265: 12813-12819Abstract Full Text PDF PubMed Google Scholar) was attributed recently to the pancreatic NBC isoform pNBC1 (16Abuladze N. Lee I. Newman D. Hwang J. Boorer K. Pushkin A. Kurtz I. J. Biol. Chem. 1998; 273: 17689-17695Abstract Full Text Full Text PDF PubMed Scopus (235) Google Scholar). An antibody that recognizes kNBC1 and pNBC1 was used to suggest localization of the protein in the BLM (17Marino C.R. Jeanes V. Boron W.F. Schmitt B.M. Am. J. Physiol. 1999; 277: G487-G494PubMed Google Scholar, 18Thevenod F. Roussa E. Schmitt B.M. Romero M.F. Biochem. Biophys. Res. Commun. 1999; 264: 291-298Crossref PubMed Scopus (62) Google Scholar). Which NBC isoforms are expressed in salivary gland acinar and duct cells, their properties, and physiological roles are not known. In the present work, we first analyzed H+/HCO3− transport in interlobular and the microperfused main SMG ducts from WT, NHE2−/−, NHE3−/−, and NHE2−/−;NHE3−/− double knock-out mice. We found functional NHE1-like activity in the BLM, and although expressed in duct cells, neither NHE2 nor NHE3 participates in H+/HCO3− fluxes by these cells. Measurement of Na+-dependent H+/HCO3− transport showed that in the absence of HCO3− SMG acinar cells recovered from an acid load by a mechanism that was inhibited by HOE and EIPA with an IC50 of 130 and 23 nm, respectively. HCO3− activated two transporters, a DIDS-sensitive and EIPA-insensitive and a DIDS-insensitive mechanism that was inhibited by EIPA with an IC50 of about 1.3 μm. Duct cells also expressed similar mechanisms except that the mechanism with the IC50 for EIPA of 1.3 μm in the LM transported both OH− and HCO3−. RT-PCR analysis and immunolocalization showed that pNBC1 is expressed in the BLM of SMG acinar and duct cells, consistent with the presence of a DIDS-sensitive/EIPA-insensitive mechanism in these cells. Acinar and duct cells also expressed selective NBC3 splice variants. NBC3 was localized to the LM of both cell types and may account for the cell-specific DIDS-insensitive/EIPA-sensitive Na+-dependent HCO3− or OH−/HCO3− transport by acinar and duct cells, respectively. 2′7′-bis (carboxyethyl)-5-carboxyfluorescein)-AM (BCECF-AM) and H2DIDS were from Molecular Probes, and collagenase CLS4 was from Worthington, Freehold, NJ. EIPA was from Research Biochemicals International, and DIDS was from Sigma. HOE 694 was a generous gift from Dr. Hans Lang, Avertis, Frankfurt am Main, Germany. Two affinity-purified polyclonal antibodies were raised against synthetic peptides derived from the N terminus of pNBC1: pNBC1a (amino acids 1–19) and pNBC1b (amino acids 51- 69, coupled to an N-terminal cysteine). The affinity-purified polyclonal antibody to kNBC1 was raised against a synthetic peptide corresponding to amino acids 11–24, coupled to an N-terminal cysteine. The polyclonal antibody against NBC3 was raised against a synthetic peptide corresponding to amino acids 1197–1214 of the C terminus of NCB3 (19Pushkin A. Abuladze N. Lee I. Newman D. Hwang J. Kurtz I. J. Biol. Chem. 1999; 274: 16569-16575Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). This sequence is almost identical to the C-terminal sequence of the known rodent NBC3 splice variants (20Choi I. Aalkjaer C. Boulpaep E.L. Boron W.F. Nature. 2000; 405: 571-575Crossref PubMed Scopus (220) Google Scholar). The standard perfusion solution (solution A) contained 140 mm NaCl, 5 mm KCl, 1 mmMgCl2, 1 mm CaCl2, 10 mm HEPES (pH 7.4 with NaOH), and 10 mm glucose. Na+-free solutions were prepared by replacing Na+ withN-methyl-d-glucamine+. HCO3−-buffered solutions were prepared by replacing 25 mm NaCl orN-methyl-d-glucamine+-Cl−with 25 mm NaHCO3 or choline-HCO3, respectively, and reducing HEPES to 5 mm. HCO3−-buffered solutions were gassed with 5% CO2, 95% O2. The osmolarity of all solutions was adjusted to 310 mosmol with the major salt. Animals were anesthetized (40 mg/kg) or killed (200–250 mg/kg) by intraperitoneal injection of sodium pentobarbital and cervical dislocation according to NIH Guidelines for the Care and Use of Laboratory Animals. Mice with targeted disruption of the NHE2 and NHE3 genes were generated as described previously (21Schultheis P.J. Clarke L.L. Meneton P. Harline M. Boivin G.P. Stemmermann G. Duffy J.J. Doetschman T. Miller M.L. Shull G.E. J. Clin. Invest. 1998; 101: 1243-1253Crossref PubMed Scopus (222) Google Scholar, 22Schultheis P.J. Clarke L.L. Meneton P. Miller M.L. Soleimani M. Gawenis L.R. Riddle T.M. Duffy J.J. Doetschman T. Wang T. Giebisch G. Aronson P.S. Lorenz J.N. Shull G.E. Nat. Genet. 1998; 19: 282-285Crossref PubMed Scopus (708) Google Scholar). Heterozygote NHE2+/−;NHE3+/− mice were mated to generate the homozygote double knock-out NHE2−/−;NHE3−/− mice. Animals were typed by tail DNA before use. Deletion of the proteins was verified by Western blot (23Shah M. Lee M.G. Schulcheis P.J. Shull G.E. Muallem S. Baum M. J. Clin. Invest. 2000; 105: 1141-1146Crossref PubMed Scopus (111) Google Scholar) and immunocytochemistry (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar, 12Park K. Olschowka J.A. Richardson L.A. Bookstein C. Chang E.B. Melvin J.E. Am. J. Physiol. 1999; 276: G470-G478PubMed Google Scholar). Animals had free access to food and water and were used at 1–2 months of age. The procedures for preparation of isolated interlobular ducts and acini and for preparation and perfusion of the main SMG duct were similar to those described before (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar). In brief, for preparation of a mixture of acini and interlobular ducts, the mouse SMGs were removed into solution A supplemented with 10 mm sodium pyruvate, 0.02% trypsin inhibitor, and 0.1% bovine serum albumin (PSA), minced, and digested in the same solution that contained 0.5 mg/ml collagenase CLS4. The digested tissue was washed three times with PSA, and the cells were used for measurement of pHi. For perfusion of the main duct, the mice were anesthetized, and the SMGs were exposed and cleared of connective tissue around the ducts. The ducts were cut and transferred to a perfusion chamber and prepared for luminal and bath perfusion. For pHi measurement, ducts were loaded with BCECF by including the BCECF-AM in the luminal perfusate. Isolated ducts and acini were incubated with 2 μm BCECF-AM for 10 min at room temperature, washed once with PSA, and kept on ice until plating on coverslips in the perfusion chamber. Fluorescence of isolated cells or the perfused ducts was measured by photon counting using a Photon Technology International system. BCECF fluorescence was recorded at excitation wavelengths of 440 and 490 nm and an emission wavelength above 530 nm. The 490/440 fluorescence ratios were calibrated using the high potassium nigericin procedure described before (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar, 14Muallem S. Loessberg P.A. J. Biol. Chem. 1990; 265: 12806-12812Abstract Full Text PDF PubMed Google Scholar). For preparation of mRNA, digested cells were placed in a Petri dish, and about 30–50 acinar clusters of 3–5 cells or small duct fragments were collected by glass micropipettes pre-soaked in solution A containing 25 mg/ml bovine serum albumin. This procedure was used to avoid possible contamination of the preparations with nerve terminals and blood vessels and contamination of acinar and duct cells with each other. The cells were ejected into an mRNA extraction solution to prepare mRNA and then cDNA, as detailed before (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar). The PCR primers used to detect the transcripts shown in Fig. 5 are as follows: β-actin sense, TGTTACCAACTGGGACGACA, antisense, TCTCAGCTGTGGTGGTGAAG (392 bp); pNBC1 sense, ATGTGTGTGATGAAGAAGAAGTAGAAG, antisense, GACCGAAGGTTGGATTTCTTG (622 bp); kNBC1 sense, CACTGAAAATGTGGAAGGGAAG, antisense, GACCGAAGGTTGGATTTCTTG (531 bp); NBCn1B+D sense, CTGACCCTCACTTGCTTGAA, antisense, CTATGTCTTCCTCAGGCGGAT (342 bp); NBCn1C sense, ATAGGGAAAGGCCTGTCAGCCTC, antisense, GAGAAGCCAAAATCCCTGG (389 bp); NBCn1B sense, TCCGATGCCAGTTCTATATGG, antisense, CAGGGCTATATTTTAGGGTC (473 bp); NBCn1C+D sense, AGAGCAGAAGAATGAGGAA, antisense, TCATGGAAAGTGCCTTCCAC (2.54 kilobase pairs); NBCn1D sense, CTGACCCTCACTTGCTTGAA, antisense, TCATGGAAAGTGCCTTCCAC (2.9 kilobase pairs). Except for NBCn1C+D and NBCn1D, the conditions for all PCR reactions were a hot start of 3 min at 95 °C followed by 35 cycles of 1 min at 94 °C, 90 s at 58 °C, and 1 min at 72 °C. Reactions were terminated by a 5-min incubation at 72 °C and cooling to 10 °C. For NBCn1C+D and NBCn1D, the 35 cycles were 1 min at 94 °C, 150 s at 60 °C, and 150 s at 72 °C. All short amplified PCR products were isolated and sequenced to verify their identity. Between 600–700 bases were sequenced from each end of NBCn1C+D and NBCn1D fragments and found to be 100% identical to the corresponding sequences. The NBCn1C+D primers were used to ascertain the lack of mRNA for these NBC3 splice variants in the duct. Isolated cells and tissue sections were placed on a polylysine-coated glass coverslips and allowed to attach for at least 30 min at room temperature before fixation and permeabilization with cold methanol. The staining procedure and various solutions used are listed in Refs. 11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar and 13Lee M.G. Ahn W. Choi J.Y. Luo X. Seo J.T. Schultheis P.J. Shull G.E. Kim K.H. Muallem S. J. Clin. Invest. 2000; 105: 1651-1658Crossref PubMed Scopus (58) Google Scholar. All primary antibodies used in the present work were affinity-purified. Each of the primary antibodies was incubated with the peptide used to raise the antibodies, and the peptide-blocked antibodies were used as controls. The antibodies were used at a 1:250–1:500 dilution and detected by a fluorescein-tagged secondary donkey anti-rabbit antibodies. Images were collected by a Bio-Rad MRC 1024 confocal microscope. Previous work reported an EIPA- and HOE-sensitive, Na+-dependent H+efflux (or OH− influx) mechanism in isolated rat SMG acinar and duct cells (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar, 24Zhao H. Xu X. Diaz J. Muallem S. J. Biol. Chem. 1995; 270: 19599-19605Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). Fig. 1extends these findings to cells from the mouse SMG so that mice with disrupted genes can be used to study the role of the transporters of interest in cellular H+/OH−/HCO3−fluxes. Fig. 1 A shows measurement of Na+-dependent pHi increase in intralobular duct fragment isolated from the SMG of a WT mouse. The ducts were acidified by a transient exposure to a solution containing 20 mm NH4+ and incubation in a Na+-free solution. pHi increase was initiated by perfusing the ducts with a Na+-containing solution. The ducts were treated with different concentrations of the NHE inhibitor HOE 694 (HOE) to measure the sensitivity of the Na+-dependent pHi increase to HOE. Similar experiments were performed with acinar cells, and all experiments are summarized in Fig. 4 below. In the absence of HCO3−, the Na+-dependent recovery from an acid load in acinar cells is about 20-fold more sensitive to HOE than that in duct cells. Fig. 1 B shows the HOE sensitivity of the Na+-dependent H+ efflux (or OH− influx) in the BLM and LM of the perfused mouse SMG duct. Similar to findings with the rat SMG (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar), the BLM activity was completely inhibited by 5 μm HOE. By contrast, 50 μm HOE were needed to inhibit the LM activity by about 86 ± 11% (n = 7).Figure 4HOE sensitivity of Na+-dependent H+/OH−transport by the SMG intralobular duct of WT and mutant mice.Results of experiments similar to those in Figs. Figure 1, Figure 2, Figure 3 were summarized and plotted to calculate the IC50 for HOE in acini from WT mice and ducts from WT and mutant mice.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Fig. 1 indicates that the mouse SMG duct expresses HOE-sensitive, Na+-dependent H+/OH−transporters in both the BLM and the LM. RT-PCR analysis with mRNA preparations from the mouse SMG acinar and duct cells, similar to that we reported for the rat SMG cells (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar) and the mouse pancreatic duct (13Lee M.G. Ahn W. Choi J.Y. Luo X. Seo J.T. Schultheis P.J. Shull G.E. Kim K.H. Muallem S. J. Clin. Invest. 2000; 105: 1651-1658Crossref PubMed Scopus (58) Google Scholar), showed that the mouse SMG acinar cells express mRNA for NHE1, and the mouse SMG duct expresses mRNA for NHE1, NHE2, and NHE3 but not for NHE4 and NHE5 (not shown). Based on the sensitivity to HOE of the known NHE isoforms (25Noel J. Pouyssegur J. Am. J. Physiol. 1995; 268: C283-C296Crossref PubMed Google Scholar), the results in Fig. 1 B suggest that the duct expresses functional NHE1 in the BLM and NHE2 in the LM. However, further analysis of Na+-dependent H+/OH− transport in ducts from NHE knockout mice showed that this is not the case. Fig.2 shows individual examples, and Fig. 4summarizes the results of multiple experiments performed with SMG ducts prepared from NHE2−/− and NHE3−/− mice. The Na+-dependent H+/OH−fluxes and their sensitivity to HOE were the same in SMG ducts of WT, NHE2−/−, and NHE3−/− mice. The results in Fig. 2 are different from those obtained in the kidney proximal tubule (23Shah M. Lee M.G. Schulcheis P.J. Shull G.E. Muallem S. Baum M. J. Clin. Invest. 2000; 105: 1141-1146Crossref PubMed Scopus (111) Google Scholar) and the pancreatic duct (13Lee M.G. Ahn W. Choi J.Y. Luo X. Seo J.T. Schultheis P.J. Shull G.E. Kim K.H. Muallem S. J. Clin. Invest. 2000; 105: 1651-1658Crossref PubMed Scopus (58) Google Scholar), in which deletion of NHE3 reduced the rate of Na+-dependent H+/OH− fluxes across the LM by about 50%. One possibility is that deletion of NHE3 from the SMG resulted in a compensatory increase in NHE2 activity. To address this possibility, we obtained a double NHE2−/−;NHE3−/− knock-out mice and measured H+/OH− fluxes in SMG acinar and duct cells of these mice. Figs.3 A and4 show that the HOE sensitivity of Na+-dependent H+/OH−fluxes in SMG intralobular ducts of WT and NHE2−/−;NHE3−/− mice are no different. Fig. 3 B shows that in the absence of HCO3−, 2 μm HOE inhibited better than 90% (n = 3) of NHE activity in SMG acinar cells of NHE2−/−; NHE3−/− mice. Finally, Fig. 3 C shows that the properties of the BLM and the LM H+/OH− fluxes in the main SMG duct of the NHE2−/−;NHE3−/− mice are not different from those found for the SMG ducts of WT mice (Fig. 1). Semi-quantitative RT-PCR analysis and immunolocalization led us (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Scholar) and others (12Park K. Olschowka J.A. Richardson L.A. Bookstein C. Chang E.B. Melvin J.E. Am. J. Physiol. 1999; 276: G470-G478PubMed Google Scholar) to conclude expression of functional NHE1 in the BLM of acinar and duct cells, NHE2 in the LM of SMG and NHE3 in the LM of the parotid gland (11Lee M.G. Schultheis P.J. Yan M. Shull G.E. Bookstein C. Chang E. Tse M. Donowitz M. Park K. Muallem S. J. Physiol. 1998; 513: 341-357Crossref PubMed Scopus (64) Google Schol" @default.
• W2004116877 created "2016-06-24" @default.
• W2004116877 creator A5015017040 @default.
• W2004116877 creator A5026789821 @default.
• W2004116877 creator A5027256048 @default.
• W2004116877 creator A5034176785 @default.
• W2004116877 creator A5048085772 @default.
• W2004116877 creator A5068367436 @default.
• W2004116877 creator A5079414919 @default.
• W2004116877 creator A5083325292 @default.
• W2004116877 date "2001-03-01" @default.
• W2004116877 modified "2023-10-15" @default.
• W2004116877 title "HCO<mml:math xmlns:mml=http://www.w3.org/1998/Math/MathML altimg=si3.gif><mml:msubsup><mml:mrow /><mml:mrow><mml:mn>3</mml:mn></mml:mrow><mml:mrow><mml:mo>−</mml:mo></mml:mrow></mml:msubsup></mml:math> Salvage Mechanisms in the Submandibular Gland Acinar and Duct Cells" @default.
• W2004116877 cites W1535881345 @default.
• W2004116877 cites W1579420356 @default.
• W2004116877 cites W1589657989 @default.
• W2004116877 cites W1603459178 @default.
• W2004116877 cites W1627569217 @default.
• W2004116877 cites W1651780926 @default.
• W2004116877 cites W1685820984 @default.
• W2004116877 cites W1965351900 @default.
• W2004116877 cites W1979369057 @default.
• W2004116877 cites W2026771151 @default.
• W2004116877 cites W2027071672 @default.
• W2004116877 cites W2042679775 @default.
• W2004116877 cites W2043543051 @default.
• W2004116877 cites W2053805555 @default.
• W2004116877 cites W2062805140 @default.
• W2004116877 cites W2063977457 @default.
• W2004116877 cites W2064094026 @default.
• W2004116877 cites W2091025692 @default.
• W2004116877 cites W2118527116 @default.
• W2004116877 cites W2119877451 @default.
• W2004116877 cites W2122457010 @default.
• W2004116877 cites W2122868566 @default.
• W2004116877 cites W2125494677 @default.
• W2004116877 cites W2132786536 @default.
• W2004116877 cites W2152534793 @default.
• W2004116877 cites W2166900847 @default.
• W2004116877 cites W2403598783 @default.
• W2004116877 cites W2415450428 @default.
• W2004116877 cites W2777476097 @default.
• W2004116877 cites W4232216965 @default.
• W2004116877 doi "https://doi.org/10.1074/jbc.m008548200" @default.
• W2004116877 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11139574" @default.
• W2004116877 hasPublicationYear "2001" @default.
• W2004116877 type Work @default.
• W2004116877 sameAs 2004116877 @default.
• W2004116877 citedByCount "76" @default.
• W2004116877 countsByYear W20041168772012 @default.
• W2004116877 countsByYear W20041168772013 @default.
• W2004116877 countsByYear W20041168772014 @default.
• W2004116877 countsByYear W20041168772015 @default.
• W2004116877 countsByYear W20041168772017 @default.
• W2004116877 countsByYear W20041168772018 @default.
• W2004116877 countsByYear W20041168772019 @default.
• W2004116877 countsByYear W20041168772020 @default.
• W2004116877 countsByYear W20041168772022 @default.
• W2004116877 countsByYear W20041168772023 @default.
• W2004116877 crossrefType "journal-article" @default.
• W2004116877 hasAuthorship W2004116877A5015017040 @default.
• W2004116877 hasAuthorship W2004116877A5026789821 @default.
• W2004116877 hasAuthorship W2004116877A5027256048 @default.
• W2004116877 hasAuthorship W2004116877A5034176785 @default.
• W2004116877 hasAuthorship W2004116877A5048085772 @default.
• W2004116877 hasAuthorship W2004116877A5068367436 @default.
• W2004116877 hasAuthorship W2004116877A5079414919 @default.
• W2004116877 hasAuthorship W2004116877A5083325292 @default.
• W2004116877 hasBestOaLocation W20041168771 @default.
• W2004116877 hasConcept C185592680 @default.
• W2004116877 hasConcept C41008148 @default.
• W2004116877 hasConceptScore W2004116877C185592680 @default.
• W2004116877 hasConceptScore W2004116877C41008148 @default.
• W2004116877 hasIssue "13" @default.
• W2004116877 hasLocation W20041168771 @default.
• W2004116877 hasOpenAccess W2004116877 @default.
• W2004116877 hasPrimaryLocation W20041168771 @default.
• W2004116877 hasRelatedWork W1531601525 @default.
• W2004116877 hasRelatedWork W2319480705 @default.
• W2004116877 hasRelatedWork W2384464875 @default.
• W2004116877 hasRelatedWork W2606230654 @default.
• W2004116877 hasRelatedWork W2607424097 @default.
• W2004116877 hasRelatedWork W2748952813 @default.
• W2004116877 hasRelatedWork W2899084033 @default.
• W2004116877 hasRelatedWork W2948807893 @default.
• W2004116877 hasRelatedWork W4387497383 @default.
• W2004116877 hasRelatedWork W2778153218 @default.
• W2004116877 hasVolume "276" @default.
• W2004116877 isParatext "false" @default.
• W2004116877 isRetracted "false" @default.
• W2004116877 magId "2004116877" @default.
• W2004116877 workType "article" @default.