FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2004166886> ?p ?o ?g. }

• W2004166886 endingPage "17035" @default.
• W2004166886 startingPage "17025" @default.
• W2004166886 abstract "We have purified and biochemically characterized a multiprotein complex designated SWAP. In a DNA transfer assay, SWAP preferentially recombines (“swaps”) sequences derived from Ig heavy chain switch regions. We identified four of the proteins in the SWAP complex: B23 (nucleophosmin), C23 (nucleolin), poly(ADP-ribose) polymerase (PARP), and SWAP-70. The first three are proteins known to be present in most cells. B23 promotes single-strand DNA reannealing and the formation of joint molecules in a D-loop assay between homologous, but also between Sμ and Sγ sequences. SWAP-70 is a novel protein of 70 kDa. Its cDNA was cloned and sequenced, and the protein was overexpressed inEscherichia coli. SWAP-70 protein expression was found only in B lymphocytes that had been induced to switch to various Ig isotypes and in switching B-cell lines. SWAP-70 is a nuclear protein, has a weak affinity for DNA, binds ATP, and forms specific, high affinity complexes with B23, C23, and poly(ADP-ribose) polymerase. These findings are consistent with SWAP being the long elusive “switch recombinase” and with SWAP-70 being the specific recruiting element that assembles the switch recombinase from universal components. We have purified and biochemically characterized a multiprotein complex designated SWAP. In a DNA transfer assay, SWAP preferentially recombines (“swaps”) sequences derived from Ig heavy chain switch regions. We identified four of the proteins in the SWAP complex: B23 (nucleophosmin), C23 (nucleolin), poly(ADP-ribose) polymerase (PARP), and SWAP-70. The first three are proteins known to be present in most cells. B23 promotes single-strand DNA reannealing and the formation of joint molecules in a D-loop assay between homologous, but also between Sμ and Sγ sequences. SWAP-70 is a novel protein of 70 kDa. Its cDNA was cloned and sequenced, and the protein was overexpressed inEscherichia coli. SWAP-70 protein expression was found only in B lymphocytes that had been induced to switch to various Ig isotypes and in switching B-cell lines. SWAP-70 is a nuclear protein, has a weak affinity for DNA, binds ATP, and forms specific, high affinity complexes with B23, C23, and poly(ADP-ribose) polymerase. These findings are consistent with SWAP being the long elusive “switch recombinase” and with SWAP-70 being the specific recruiting element that assembles the switch recombinase from universal components. The constant (C) 1The abbreviations used are: C, constant; H, heavy; bp, base pair(s); DTA, DNA transfer assay; ds, double-stranded; ss, single-stranded; nt, nucleotide(s); EPPS, 4-(2-hydroxyethyl)-1-piperazinepropanesulfonic acid; LPS, lipopolysaccharide; DTT, dithiothreitol; S, switch region; ConA, concanavalin A. region of its heavy (H) chain determines the class of an Ig molecule. Mouse H chains are designated μ, δ, γ3, γ1, γ2b, γ2a, ε, and α. Upon stimulation by antigen, expression of the early IgM class usually changes to that of another class (IgG3, IgG1, IgG2b, IgG2a, IgE, or IgA). At the DNA level, the process is mediated by recombination that generally involves DNA transfer between a switch (S) region within the intron 5′ to Cμ and another S region within the intron 5′ to the particular C-gene segment that is to be expressed (1Shimuzu A. Honjo T. Cell. 1984; 36: 801-803Abstract Full Text PDF PubMed Scopus (147) Google Scholar, 2Harriman W. Völk H. Defranoux N. Wabl M. Annu. Rev. Immunol. 1993; 11: 361-384Crossref PubMed Scopus (101) Google Scholar, 3Lorenz M. Radbruch A. Curr. Top. Microbiol. Immunol. 1996; 217: 151-170PubMed Google Scholar, 4Stavnezer J. Curr. Opin. Immunol. 1996; 8: 199-205Crossref PubMed Scopus (275) Google Scholar, 5Snapper C.M. Marcu K.B. Zelazowski P. Immunity. 1997; 6: 217-223Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). S regions, several kilobase pairs in length, contain short, G-rich repetitive sequence elements, often arranged in tandem arrays. They may adopt secondary structures, such as stem loops, and many break points are located at such structures (6Mussmann R. Courtet M. Schwager J. Du Pasquier L. Eur. J. Immunol. 1997; 27: 2610-2619Crossref PubMed Scopus (81) Google Scholar). In marked contrast to those observed in V(D)J rearrangement (7Gellert M. Annu. Rev. Genet. 1992; 22: 425-446Crossref Scopus (101) Google Scholar, 8Lieber M.R. FASEB-J. 1992; 5: 2934-2944Crossref Scopus (138) Google Scholar, 9Schatz D.G. Oettinger M.A. Schlissel M.A. Annu. Rev. Immunol. 1992; 10: 359-383Crossref PubMed Scopus (393) Google Scholar, 10van Gent D.C. McBlane F.J. Ramsden D.A. Sadofsky M.J. Hesse J.E. Gellert M. Curr. Top. Microbiol. Immunol. 1996; 217: 1-10PubMed Google Scholar, 11Bockheim-Steen S. Zhu C. Roth D. Curr. Top. Microbiol. Immunol. 1996; 217: 61-78PubMed Google Scholar), the switch recombination break-and-rejoining points are imprecise. They lie scattered all over the S regions or, less often, even outside the S regions. Thus, class switch recombination is region-specific rather than site-specific. Rearrangements combining three S regions are occasionally detected (12Siebenkotten G. Esser C. Wabl M. Radbruch A. Eur. J. Immunol. 1992; 22: 1827-1834Crossref PubMed Scopus (89) Google Scholar), and, although switch recombination is usually intrachromosomal (13Wabl M. Meyer J. Beck-Engeser G. Tenkhoff M. Burrows P.D. Nature. 1985; 313: 687-689Crossref PubMed Scopus (17) Google Scholar), intermolecular rearrangements have also been observed (14Gerstein R.M. Frankel W.N. Hsieh C-L. Durdik J.M. Rath S. Coffin J.M. Nisonoff A. Selsing E. Cell. 1990; 63: 537-548Abstract Full Text PDF PubMed Scopus (76) Google Scholar). Following transcriptional activation (3Lorenz M. Radbruch A. Curr. Top. Microbiol. Immunol. 1996; 217: 151-170PubMed Google Scholar, 15Daniels G.A. Lieber M.R. Curr. Top. Microbiol. Immunol. 1996; 217: 171-189PubMed Google Scholar), switch rearrangements generally result in deletion of the DNA sequences between the two breakpoints. The mechanism for most class switching events can be described by a loop-excision model (16Jäck H.M. McDowell M. Steinberg C.M. Wabl M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 1581-1585Crossref PubMed Scopus (49) Google Scholar). The exact structure of the loop intermediate is unknown; it may resemble a crossed (α) or a stem loop (Ω) conformation. In that model, after loop formation, four DNA ends are generated by endonucleolytic cleavage of the two S regions to be recombined; these ends are possibly protected or even fixed by proteins. Either (i) the four ends can be rejoined in their original configuration, (ii) the four ends can be inverted, or (iii) the intervening sequence can be circularized and removed while the remaining chromosomal DNA ends are joined together to yield the switched gene. Both inversions (16Jäck H.M. McDowell M. Steinberg C.M. Wabl M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 1581-1585Crossref PubMed Scopus (49) Google Scholar) and excised circular DNAs, the so-called switch circles of various sizes (17von Schwedler U. Jäck H.M. Wabl M. Nature. 1990; 345: 452-456Crossref PubMed Scopus (177) Google Scholar, 18Iwasato T. Shimuzu A. Honjo T. Yamagishi H. Cell. 1990; 62: 143-149Abstract Full Text PDF PubMed Scopus (213) Google Scholar), were observedin vivo, but mechanistic details of the reaction remain unknown. To date, no isolation and biochemical characterization of an S-region-specific recombination activity has been reported (19Jessberger R. Wabl M. Borggrefe T. Curr. Top. Microbiol. Immunol. 1996; 217: 191-202PubMed Google Scholar), although several S-region-binding proteins have been described, primarily in gel migration shift experiments (20Waters S.H. Saikh K.U. Stavnezer J. Mol. Cell. Biol. 1989; 9: 5594-5601Crossref PubMed Scopus (56) Google Scholar, 21Williams M. Maizels N. Genes Dev. 1991; 5: 2353-2361Crossref PubMed Scopus (59) Google Scholar, 22Wuerffel R.A. Nathan A.T. Kenter A.L. Mol. Cell. Biol. 1990; 10: 1714-1718Crossref PubMed Scopus (45) Google Scholar, 23Schultz C.L. Elenich L.A. Dunnick W.A. Int. Immunol. 1991; 3: 109-116Crossref PubMed Scopus (18) Google Scholar). To our knowledge, no recombination-specific function or recombination-related enzyme activity has yet been described for these proteins. We have screened extracts from switching B-cells for activities that preferentially recombine S-regions. Our assay measures stable DNA transfer, a central step of DNA recombination, from a plasmid containing Sμ to a plasmid containing another S region. A similar DNA transfer assay was instrumental in isolating a mammalian protein complex that repairs DNA gaps and deletions through recombination of homologous DNA substrates (24Jessberger R. Berg P. Mol. Cell. Biol. 1991; 11: 445-457Crossref PubMed Scopus (60) Google Scholar, 25Jessberger R. Podust V. Hübscher U. Berg P. J. Biol. Chem. 1993; 268: 15070-15079Abstract Full Text PDF PubMed Google Scholar, 26Jessberger R. Riwar B. Baechtold H. Akhmedov A.T. EMBO J. 1996; 15: 4061-4068Crossref PubMed Scopus (113) Google Scholar). Here we report the isolation of a protein complex—we call it SWAP—with a recombination activity that is specific for switching B-cells and prefers S-region substrates. We also report the identity of four of the proteins in the SWAP complex: B23 (nucleophosmin), C23 (nucleolin), poly(ADP-ribose) polymerase (PARP), and SWAP-70. B23 promotes single-strand DNA reannealing and the formation of joint molecules in a D-loop assay between homologous sequences but also between Sμ and Sγ sequences. SWAP-70 is a novel protein of 70 kDa. Its cDNA was cloned and sequenced, and the protein was overexpressed in Escherichia coli. SWAP-70 protein expression was found only in B lymphocytes that had been induced to switch and in switching B-cell lines. SWAP-70 is a nuclear protein, has a weak affinity for DNA, binds ATP, and forms specific, high affinity complexes with B23, C23, and PARP. The DTA was done as described (24Jessberger R. Berg P. Mol. Cell. Biol. 1991; 11: 445-457Crossref PubMed Scopus (60) Google Scholar,25Jessberger R. Podust V. Hübscher U. Berg P. J. Biol. Chem. 1993; 268: 15070-15079Abstract Full Text PDF PubMed Google Scholar). Input 3H radioactivity was between 150,000 and 350,000 cpm and the same for each experimental series. The Sμsubstrate consisted of an M13 double-stranded (ds) DNA carrying a 1.3-kilobase pair HindIII Sμ fragment (27DePinho R. Kruger R. Andrews N. Lutzker S. Baltimore D. Alt F.W. Mol. Cell. Biol. 1984; 4: 2905-2912Crossref PubMed Scopus (24) Google Scholar), and was labeled with digoxigenin (24Jessberger R. Berg P. Mol. Cell. Biol. 1991; 11: 445-457Crossref PubMed Scopus (60) Google Scholar). The Sγ plasmid consisted of pSP72 containing a 3.7-kilobaseEcoRI-HindIII Sγ2b fragment (28Takahashi N. Kataoka T. Honjo T. Gene. 1980; 11: 117-127Crossref PubMed Scopus (33) Google Scholar) and was internally labeled with [3H]thymidine. For the standard DNA transfer assay, 0.18 μg of the 3H-labeled DNA substrate (e.g. pSP-Sγ) was incubated together with 0.02 μg of the digoxigenin-labeled substrate (e.g. M13-Sμ) and varying amounts of protein in 50 μl containing 3 mm MgCl2, 30 mm EPPS, pH 7.4, 1 mm DTT, less than 50 mm ammonium sulfate, and 1 mm ATP. After 6 min, the reaction was terminated by the addition of SDS to 0.05% and EDTA to 50 mm. Further processing was as described (24Jessberger R. Berg P. Mol. Cell. Biol. 1991; 11: 445-457Crossref PubMed Scopus (60) Google Scholar) and included a phenol-chloroform extraction step of the DNA prior to binding the products to anti-digoxigenin beads. The activity is expressed as a percentage of input 3H cpm, stably transferred to the recipient and bound to the beads. The protein purification procedures were carried out at 4 °C, and are summarized in Table I. Nuclear extracts were prepared as described (25Jessberger R. Podust V. Hübscher U. Berg P. J. Biol. Chem. 1993; 268: 15070-15079Abstract Full Text PDF PubMed Google Scholar) from 1 × 108 to 8 × 108 lipopolysaccharide (LPS) (50 μg/ml) blasts (0.7 mg of nuclear protein/108 cells). Fraction I (2 mg of protein) was loaded onto a Superdex 200 FPLC gel filtration column (Amersham Pharmacia Biotech) and fractionated at a flow rate of 1 ml/min in Buffer E (5 mm KCl, 5 mm MgCl2, 2 mm DTT, 0.2 mm EDTA, 15 mm Tris-HCl, pH 7.5 at 4 °C, and 1 mm PMSF, 10 mmNa2S2O5, 1 μg/ml aprotinin, 0.5 μg/ml TLCK, 0.7 μg/ml pepstatin A) containing 80 mmammonium sulfate. 1.4-ml fractions were collected, active fractions were pooled (5.6 ml, 0.6 mg of protein, Fraction II), diluted 1:4 with Buffer E, and loaded at 1 ml/min onto a 1-ml Macro S cation exchange FPLC column (Bio-Rad). After washing the column with 20 column volumes of Buffer E-20 (E plus 20 mm ammonium sulfate), the proteins were eluted at a 1 ml/min flow rate with a gradient from 20 to 600 mm ammonium sulfate in Buffer E in 1.2-ml fractions. The switch-specific activity (2.4 ml, 0.011 mg of protein, Fraction III) eluted in two fractions at around 280 mm ammonium sulfate. For further purification, Fraction III was diluted 1:2 with Buffer E and loaded at 0.3 ml/min onto a 1 ml blue Sepharose (HiTrap, Amersham Pharmacia Biotech) FPLC column (pre-equilibrated in E-140). Elution was with a linear gradient from 0 to 1000 mmammonium sulfate in Buffer E, and the activity eluted between 740 and 810 mm (0.6 ml, 6 ng of protein, Fraction IV). On ice or at −70 °C, the active fractions were stable for a short period only; frozen in liquid nitrogen, samples remained active for at least several weeks.Table IPurification of SWAPProtein fractionTotal proteinActivityProtein per reactionSpecific activityTotal unitsa1 unit = 0.1% cpm substrate DNA radioactivity transfered.μg% cpmngunits/mgI20002.730000.918000bContains large amounts of several different transfer activities.II6001.14002.81680III111.21580880IV0.60.960.91067640a 1 unit = 0.1% cpm substrate DNA radioactivity transfered.b Contains large amounts of several different transfer activities. Open table in a new tab The gene encoding SWAP-70 was cloned using a polymerase chain reaction strategy based on degenerate oligonucleotides derived from the N-terminal 26 amino acid residues and subsequent screening of a λ-ZAP mouse spleen cDNA library (Stratagene Inc.) with a nondegenerate oligonucleotide. The cDNA contained in the plasmid vector pBluescriptSK was excised from the phages, and the sequence of the SWAP-70 cDNA was determined. The cDNA was subcloned into the pQE-30 vector (Qiagen, Inc.) for expression as a His-tagged protein inE. coli. Purification of the protein was according to standard methods, including lysozyme-lysis of the cells, chromatography of the clear cell extract on a nickel-Sepharose column and elution at 80 mm imidazole, followed by gel filtration on a Superdex75 FPLC column (Amersham Pharmacia Biotech). Gel retardation were performed in 10-μl reaction mixtures containing 0.2–1 ng (3000–6000 cpm) of32P-end-labeled DNA (230-bp EcoRI-KasI M13mp18 DNA fragment, or 49-nt ss oligonucleotide) in 20 mm HEPES (pH 7.5), 1 mm DTT, 100 μg/ml bovine serum albumin, and protein as indicated. After 20 min of incubation at room temperature, DNA-protein complexes were resolved by electrophoresis at 4 °C in nondenaturing polyacrylamide gels in 20 mm HEPES (pH 7.5), 0.1 mm EDTA. All gels were fixed (60 min in 10% acetic acid, 10% ethanol), dried, and exposed for autoradiography. For azido-ATP labeling (29Knight K.L. McEntee K. J. Biol. Chem. 1985; 260: 867-872Abstract Full Text PDF PubMed Google Scholar), reactions were carried out in 200 μl of 20 mm Tris-HCl, pH 7.5, 10 mmMgCl2, 0.1 mm DTT, 5 μm8-N 3-[α-32P]ATP (9–20 Ci/mmol; ICN), and proteins (200 ng). Reaction mixtures were incubated on ice for 60 min and then irradiated for 50 s at a distance of 10 cm from a XL-1500 UV cross-linker (Spectronics Co.). After irradiation, proteins were precipitated with trichloroacetic acid and analyzed by SDS-polyacrylamide gel electrophoresis and autoradiography. The DNA single-strand reannealing assay (3′ 32P-labeled, 422-nt DNA substrates) was performed as described (26Jessberger R. Riwar B. Baechtold H. Akhmedov A.T. EMBO J. 1996; 15: 4061-4068Crossref PubMed Scopus (113) Google Scholar). For the standard D-loop assay, 100 ng (24 fmol) of predominantly supercoiled plasmid pUC-Sγ DNA or, for controls, DNA linearized outside the region of homology (Asp700 restriction enzyme digest) and 0.8 ng (100 fmol) of 5′-32P-labeled, 49-nt ss Sγ consensus sequence oligonucleotide (5′-GGGACCAGTCCTAGCAGCTGTGGGGGAGCTGGGGAAGGTGGGAGTGTGA; G/C content, 65%) (21Williams M. Maizels N. Genes Dev. 1991; 5: 2353-2361Crossref PubMed Scopus (59) Google Scholar) were incubated together with protein for 30 min at 37 °C in the standard DNA transfer reaction buffer (20 mm EPPS, pH 7.4, 5 mm MgCl2, 1 mm DTT). Reactions were stopped by addition of SDS to 0.1% and 4 μg of proteinase K and further incubation at 37 °C for 45 min. Routinely, products were analyzed in 0.7% agarose gels containing 3 mm magnesium acetate in the TAE buffer system. Gels were run at 2 V/cm for 16–24 h, stained with ethidium bromide, photographed to determine positions of the duplex DNA bands, dried, and exposed for autoradiography for 2–24 h. In later experiments, the magnesium acetate in the agarose gels was found not to be necessary, and the gels could be run at 4 V/cm without reducing the yield of joint molecules. For quantification of products, the ethidium bromide-stained bands were excised, the agarose was melted, and the 32P radioactivity was directly measured in a scintillation counter. The percentage of input 32P-oligonucleotide paired with the duplex DNA in the joint molecules was calculated. Many variations of the assay were performed and are described under “Results.” Some used an oligonucleotide, CS-3, containing the first 25 nt of the 49-nt Sγ sequence (G/C content, 68%) or the 22-nt T7 oligonucleotide (5′-GTAATACGACTCACTATAGGGC) (G/C content, 45%), which is fully homologous to the plasmid pBluescriptSK. The pH variations were based on compounds of the polysulfonate buffer family. To assay for a DNA transfer activity that prefers S-region substrates, we labeled a plasmid (pSP72) containing Sγ2b sequences with [3H]thymidine and ds M13 containing Sμsequences with a small number of digoxigenin ligands. Recombinant DNA molecules were quantified by counting 3H in plasmid DNA that had been immunoprecipitated by an anti-digoxigenin antibody (Fig. 1 A); in this way, a direct and quantitative measurement of the catalytic activity leading to DNA transfer was obtained (19Jessberger R. Wabl M. Borggrefe T. Curr. Top. Microbiol. Immunol. 1996; 217: 191-202PubMed Google Scholar, 24Jessberger R. Berg P. Mol. Cell. Biol. 1991; 11: 445-457Crossref PubMed Scopus (60) Google Scholar). To an equimolar mixture of these two constructs, we added nuclear extracts from untreated spleen cells or from spleen cells cultivated for 2–3 days in the presence or absence of LPS (Fig. 1 B). Because these cultures contain non-B lymphocytes and other nonswitching cells, we separated the (switching) blasts from the nondividing (nonswitching) cells according to size by cell elutriation (30Sanderson R.J. Bird K.E. Palmer N.F. Brenman J. Anal. Biochem. 1976; 71: 615-622Crossref PubMed Scopus (55) Google Scholar) and tested the nuclear extracts prepared from both cell pools for DNA transfer activity on S substratesversus non-S substrates (Fig. 1 B). Despite the expected presence of general DNA transfer activities in such an extract (24Jessberger R. Berg P. Mol. Cell. Biol. 1991; 11: 445-457Crossref PubMed Scopus (60) Google Scholar, 25Jessberger R. Podust V. Hübscher U. Berg P. J. Biol. Chem. 1993; 268: 15070-15079Abstract Full Text PDF PubMed Google Scholar), the crude nuclear extracts from LPS blasts recombined S region substrates 2–3-fold better than non-S region substrates (Fig. 2 A);i.e. a newly induced, specific activity is added on top of the general DNA swapping. This activity, called SWAP, is not present in extracts from nonswitching cells (Fig. 2 A) or in extracts from thymus cells (not shown). We purified SWAP by eluting it from a sizing column at a position corresponding to a molecular mass of globular proteins of 200–300 kDa (Fraction II). This fraction showed a 4-fold preference for S region substrates and was inactive when isolated from nonswitching cells (Fig. 2 A); no other previously observed DNA transfer assay activity, e.g. from HeLa cells or calf thymus (24Jessberger R. Berg P. Mol. Cell. Biol. 1991; 11: 445-457Crossref PubMed Scopus (60) Google Scholar, 25Jessberger R. Podust V. Hübscher U. Berg P. J. Biol. Chem. 1993; 268: 15070-15079Abstract Full Text PDF PubMed Google Scholar), eluted at that position. The SWAP was further purified by cation exchange and blue Sepharose chromatography yielding Fraction IV with a preference for S region substrates of 10-fold (Figs. 2 B and3). With these purification steps, the specific activity increased more than 1000-fold (TableI). When an unrelated DNA,e.g. from M13, SV40, or ΦX174, was paired with an S region, SWAP activity was reduced, on the average, by 6-fold (Fig. 2 B). Fully homologous DNA substrates (5.7 kilobase pairs) recombined with less than half the efficiency of two S region substrates (not shown). Because the DNA is treated with SDS/EDTA and phenol extraction after the DNA transfer reaction, the linkage of the two substrates is considered stable and independent of the continuous presence of protein or Mg2+. More than 80% of the transfer products are heat-stable (20 min at 85 °C); the rest probably represents noncovalent reaction intermediates. Maximum product formation by Fraction IV (1 ng) occurred after 6 min of incubation at 37 °C and 3 mm MgCl2. Omission of the four dNTPs did not affect the reaction significantly, but lack of ATP rendered the reaction 88% less efficient. Polymerase chain reaction analysis and subcloning of the bead-bound recombination products confirmed the presence of covalent Sγ-Sμ junctions among the DNA transfer products (not shown). Purified SWAP fractions had no detectable DNA polymerase, DNA helicase, general endonuclease, or general exonuclease activity (not shown). On silver-stained SDS-polyacrylamide gels there were about 12 and 7 polypeptides left in Fractions III and IV, respectively (Fig. 4). When heavily stained, species were seen in Fraction IV with molecular masses of approximately 38, 50, 70, 75, 100, 115, and 160 kDa, of which the 70-kDa species is clearly the most prominent. We gel-eluted and partially sequenced the 38-, 70-, and 115-kDa proteins. The 38-kDa protein yielded tryptic peptides TVSLGAG and FINYVK, which are identical to residues 46–52 and 266–271 of mouse B23 (nucleophosmin) (31Chan P.K. Chan W.Y. Yung B.Y.M. Cook R.G. Aldrich M.B. Ku D. Goldknopf I.L. Busch H. J. Biol. Chem. 1986; 261: 14335-14341Abstract Full Text PDF PubMed Google Scholar). The 115-kDa protein yielded tryptic peptides TLGDFLAEYAK and TTNFAGILSQG, which are identical to residues 108–118 and 864–874, respectively, of mouse PARP (32Cherney B.W. McBride O.W. Chen D. Alkhatib H. Bhatia K. Hensley P. Smulson M. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 8370-8374Crossref PubMed Scopus (166) Google Scholar). These protein identifications were confirmed by Western blotting experiments (not shown). The N terminus of the 70-kDa protein was MRGLKDELLKAIWHAFTALDLDRS, which was not present in the molecular biology data bases. The cDNA of SWAP-70, the novel 70-kDa protein, was cloned and sequenced (Fig. 5). SWAP-70 does not belong to a known protein family, and its 586-amino acid sequence contains nuclear localization signals at positions 222–225, 281–284, and 361–376. There is a possible coiled-coil region between amino acids 320 and 450, as well as a potential O-glycosylation site at amino acids 314–315, a continuous hydrophilic region near its C terminus, and several potential phosphorylation sites for several protein kinases. A fourth SWAP component is described in the next section. The 200–300-kDa gel filtration elution position of SWAP suggests a protein complex, and we looked for high affinity interactions between B23, PARP, and SWAP-70. His-tagged SWAP-70 was overexpressed from E. coli and purified to near homogeneity as described under “Experimental Procedures” (Fig. 6 A). Purified SWAP-70 protein (Fraction II) was bound to Sepharose beads as an affinity tag for proteins contained in a nuclear extract from LPS-induced, switching B-cells. About 1 mg of extract was loaded at 25 mm ammonium sulfate. The bound material was stepwise eluted with 80, 120, 300, 600, and 1200 mm ammonium sulfate, and the fractions were analyzed by SDS-polyacrylamide gel electrophoresis and Western blotting. The 300 and 600 mm fractions contained about 10 polypeptides, as judged from silver-stained gels (not shown). On immunoblots, PARP peaked in the 300 mm fraction (Fig. 6 B), and B23 peaked in the 300 and 600 mmfractions (Fig. 6 C), corresponding to 600 and 1200 mm ionic strength, respectively, of a monovalent salt; this result suggests high affinity binding. Preincubation of the SWAP-70 affinity column with polyclonal anti-SWAP-70 antibodies completely abolished its ability to retain any of the other components of the complex (not shown). Using the affinity column to look for additional proteins forming a complex with SWAP-70, we identified the 100-kDa polypeptide observed in Fractions III and IV of the SWAP complex (Fig. 4). Because it associates with B23 (33Li Y-P. Busch R.K. Valdez B.C. Busch H. Eur. J. Biochem. 1996; 237: 153-158Crossref PubMed Scopus (144) Google Scholar) and has a similar molecular mass, C23 (nucleolin) was a good candidate for this protein. Using anti-C23 antibodies on Western blots, we detected two cross-reacting polypeptides of 95–100 kDa in the 300 mm ammonium sulfate fraction, likely representing two phosphorylation forms of this heavily modified protein. A third band of lower molecular mass may be a degradation product (34Ghisolfi-Nieto L. Gerard J. Puvion-Dutilleul F. Amalric F. Bouvet P. J. Mol. Biol. 1996; 260: 34-53Crossref PubMed Scopus (164) Google Scholar) (Fig. 6 D). Thus, a fourth component of the SWAP complex is C23, which also binds to SWAP-70 with high affinity. C23 has been described as a subunit of LR1, a B-cell-specific heterodimer that specifically binds switch region DNA (21Williams M. Maizels N. Genes Dev. 1991; 5: 2353-2361Crossref PubMed Scopus (59) Google Scholar, 35Hanakahi L.A. Dempsey L.A. Li M-J. Maizels N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3605-3610Crossref PubMed Scopus (116) Google Scholar). Equal amounts of nuclear extracts of various tissues from 4-week-old C57BL/6 mice were analyzed by Western blotting with affinity purified polyclonal anti-SWAP-70 antibodies. Although there may be low level expression in other tissues, SWAP-70 is strongly expressed only in B-cells that have been induced to switch (Fig. 7 A). Low expression in spleen and in lymph nodes presumably results from the few activated B-cells present in any 4-week-old mice. However, only spleen cells stimulated with LPS and concanavalin A (ConA) express SWAP-70 at high levels. Importantly, SWAP-70 is not expressed in thymocytes, nor in activated, proliferating T-cells. ConA stimulates T-cells, and these in turn stimulate B spleen cells, which then express SWAP-70 at high levels (Fig. 7, A and B); about half of the cells in ConA-stimulated spleen cell cultures are activated B-cells (not shown). In mice lacking B-cells (36Kitamura D. Roes J. Kühn R. Rajewsky K. Nature. 1991; 350: 423-426Crossref PubMed Scopus (1544) Google Scholar), ConA did not induce the expression of SWAP-70 (Fig. 7 B). However, LPS-stimulated cells from mice lacking T-cells (34Ghisolfi-Nieto L. Gerard J. Puvion-Dutilleul F. Amalric F. Bouvet P. J. Mol. Biol. 1996; 260: 34-53Crossref PubMed Scopus (164) Google Scholar) contain high levels of SWAP-70 (Fig. 7 B). In a culture of proliferating pre-B-cells (37Malissen M. Gill A. Rocha B. Trucy J. Vivier E. Boyer C. Köntgen F. Brun N. Mazza G. Spanopoulou E. Guy-Grand D. Malissen B. EMBO J. 1993; 12: 4347-4358Crossref PubMed Scopus (217) Google Scholar), SWAP-70 is highly expressed only when the cells are stimulated with anti-CD40 antibodies and IL-4 to induce switching primarily to the IgE isotype (38Rolink A. Melchers F. Andersson J. Immunity. 1996; 5: 319-330Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar) (Fig. 7 C). Similarily, high expression of SWAP-70 was seen 3–5 days after induction of switching to IgA in the cell line I.29-D22 by treatment with LPS and transforming growth factor-β (39Shockett P. Stavnezer J. J. Immunol. 1993; 151: 6962-6976PubMed Google Scholar) (not shown). SWAP-70 is also expressed at high levels expressed in the pre-B-cell line 18–81, which undergoes class switching (40Burrows P.D. Beck G.B. Wabl M.R. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 564-568Crossref PubMed Scopus (44) Google Scholar, 41Burrows P.D. Beck-Engeser G.B. Wabl M.R. Nature. 1993; 306: 243-246Crossref Scopus (60) Google Scholar), but only at low levels in the pre-B-cell line 70Z/3, which does not switch (Fig. 7 D). In these cell lines, an approximately 45-kDa polypeptide cross-reacts with the antibodies and might be a proteolytic degradation product of SWAP-70. To directly study DNA binding properties of SWAP-70, gel shift experiments were performed. As shown in Fig. 8 A, SWAP-70 bound to DNA. This binding does not require Mg2+ and is even somewhat reduced by its presence. Increasing amounts of SWAP-70 (20 and 40 ng) bound more DNA, but only about 5% of the input DNA was bound, even under optimal conditions. The oligonucleotide used for the experiment shown in Fig. 8 A contains the 49-nt Sγ consensus signal (28Takahashi N. Kataoka T. Honjo T. Gene. 1980; 11: 117-127Crossref Pub" @default.
• W2004166886 created "2016-06-24" @default.
• W2004166886 creator A5036409925 @default.
• W2004166886 creator A5073149133 @default.
• W2004166886 creator A5078070753 @default.
• W2004166886 creator A5084604266 @default.
• W2004166886 date "1998-07-01" @default.
• W2004166886 modified "2023-09-29" @default.
• W2004166886 title "A B-cell-specific DNA Recombination Complex" @default.
• W2004166886 cites W109419785 @default.
• W2004166886 cites W124504601 @default.
• W2004166886 cites W1502661253 @default.
• W2004166886 cites W1507370496 @default.
• W2004166886 cites W1548555149 @default.
• W2004166886 cites W1558656596 @default.
• W2004166886 cites W1597599526 @default.
• W2004166886 cites W1819485662 @default.
• W2004166886 cites W1924726281 @default.
• W2004166886 cites W1963548332 @default.
• W2004166886 cites W1968437583 @default.
• W2004166886 cites W1969652296 @default.
• W2004166886 cites W1973669053 @default.
• W2004166886 cites W1979410044 @default.
• W2004166886 cites W1985598285 @default.
• W2004166886 cites W1993557884 @default.
• W2004166886 cites W1993719557 @default.
• W2004166886 cites W1997710978 @default.
• W2004166886 cites W2009854285 @default.
• W2004166886 cites W2017065556 @default.
• W2004166886 cites W2021956465 @default.
• W2004166886 cites W2021959562 @default.
• W2004166886 cites W2024933696 @default.
• W2004166886 cites W2031778684 @default.
• W2004166886 cites W2032348735 @default.
• W2004166886 cites W2035509760 @default.
• W2004166886 cites W2036005259 @default.
• W2004166886 cites W2036277308 @default.
• W2004166886 cites W2042513752 @default.
• W2004166886 cites W2054471909 @default.
• W2004166886 cites W2062376481 @default.
• W2004166886 cites W2073158216 @default.
• W2004166886 cites W2078327340 @default.
• W2004166886 cites W2085676209 @default.
• W2004166886 cites W2091288127 @default.
• W2004166886 cites W2091786034 @default.
• W2004166886 cites W2093454623 @default.
• W2004166886 cites W2103209498 @default.
• W2004166886 cites W2104270916 @default.
• W2004166886 cites W2114671452 @default.
• W2004166886 cites W2117743516 @default.
• W2004166886 cites W2118014807 @default.
• W2004166886 cites W2125656162 @default.
• W2004166886 cites W2134951498 @default.
• W2004166886 cites W2139968053 @default.
• W2004166886 cites W2152251331 @default.
• W2004166886 cites W2153574424 @default.
• W2004166886 cites W2164558029 @default.
• W2004166886 cites W81274061 @default.
• W2004166886 cites W943460054 @default.
• W2004166886 doi "https://doi.org/10.1074/jbc.273.27.17025" @default.
• W2004166886 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9642267" @default.
• W2004166886 hasPublicationYear "1998" @default.
• W2004166886 type Work @default.
• W2004166886 sameAs 2004166886 @default.
• W2004166886 citedByCount "150" @default.
• W2004166886 countsByYear W20041668862012 @default.
• W2004166886 countsByYear W20041668862013 @default.
• W2004166886 countsByYear W20041668862014 @default.
• W2004166886 countsByYear W20041668862015 @default.
• W2004166886 countsByYear W20041668862016 @default.
• W2004166886 countsByYear W20041668862017 @default.
• W2004166886 countsByYear W20041668862018 @default.
• W2004166886 countsByYear W20041668862019 @default.
• W2004166886 countsByYear W20041668862020 @default.
• W2004166886 countsByYear W20041668862021 @default.
• W2004166886 countsByYear W20041668862022 @default.
• W2004166886 countsByYear W20041668862023 @default.
• W2004166886 crossrefType "journal-article" @default.
• W2004166886 hasAuthorship W2004166886A5036409925 @default.
• W2004166886 hasAuthorship W2004166886A5073149133 @default.
• W2004166886 hasAuthorship W2004166886A5078070753 @default.
• W2004166886 hasAuthorship W2004166886A5084604266 @default.
• W2004166886 hasBestOaLocation W20041668861 @default.
• W2004166886 hasConcept C104317684 @default.
• W2004166886 hasConcept C153911025 @default.
• W2004166886 hasConcept C156695909 @default.
• W2004166886 hasConcept C185592680 @default.
• W2004166886 hasConcept C54355233 @default.
• W2004166886 hasConcept C552990157 @default.
• W2004166886 hasConcept C86803240 @default.
• W2004166886 hasConcept C95444343 @default.
• W2004166886 hasConceptScore W2004166886C104317684 @default.
• W2004166886 hasConceptScore W2004166886C153911025 @default.
• W2004166886 hasConceptScore W2004166886C156695909 @default.
• W2004166886 hasConceptScore W2004166886C185592680 @default.
• W2004166886 hasConceptScore W2004166886C54355233 @default.
• W2004166886 hasConceptScore W2004166886C552990157 @default.
• W2004166886 hasConceptScore W2004166886C86803240 @default.

• next