FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2004443145> ?p ?o ?g. }

• W2004443145 endingPage "7537" @default.
• W2004443145 startingPage "7529" @default.
• W2004443145 abstract "Human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) displays a characteristic poor processivity during DNA polymerization. Structural elements of RT that determine processivity are poorly understood. The three-dimensional structure of HIV-1 RT, which assumes a hand-like structure, shows that the fingers, palm, and thumb subdomains form the template-binding cleft and may be involved in determining the degree of processivity. To assess the influence of fingers subdomain of HIV-1 RT in polymerase processivity, two insertions were engineered in the β3-β4 hairpin of HIV-1NL4-3 RT. The recombinant mutant RTs, named FE20 and FE103, displayed wild type or near wild type levels of RNA-dependent DNA polymerase activity on all templates tested and wild type or near wild type-like sensitivities to dideoxy-NTPs. When polymerase activities were measured under conditions that allow a single cycle of DNA polymerization, both of the mutants displayed 25–30% greater processivity than wild type enzyme. Homology modeling the three-dimensional structures of wild type HIV-1NL4-3 RT and its finger insertion mutants revealed that the extended loop between the β3 and β4 strands protrudes into the cleft, reducing the distance between the fingers and thumb subdomains to ∼12 Å. Analysis of the models for the mutants suggests an extensive interaction between the protein and template-primer, which may reduce the degree of superstructure in the template-primer. Our data suggest that the β3-β4 hairpin of fingers subdomain is an important determinant of processive polymerization by HIV-1 RT. Human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) displays a characteristic poor processivity during DNA polymerization. Structural elements of RT that determine processivity are poorly understood. The three-dimensional structure of HIV-1 RT, which assumes a hand-like structure, shows that the fingers, palm, and thumb subdomains form the template-binding cleft and may be involved in determining the degree of processivity. To assess the influence of fingers subdomain of HIV-1 RT in polymerase processivity, two insertions were engineered in the β3-β4 hairpin of HIV-1NL4-3 RT. The recombinant mutant RTs, named FE20 and FE103, displayed wild type or near wild type levels of RNA-dependent DNA polymerase activity on all templates tested and wild type or near wild type-like sensitivities to dideoxy-NTPs. When polymerase activities were measured under conditions that allow a single cycle of DNA polymerization, both of the mutants displayed 25–30% greater processivity than wild type enzyme. Homology modeling the three-dimensional structures of wild type HIV-1NL4-3 RT and its finger insertion mutants revealed that the extended loop between the β3 and β4 strands protrudes into the cleft, reducing the distance between the fingers and thumb subdomains to ∼12 Å. Analysis of the models for the mutants suggests an extensive interaction between the protein and template-primer, which may reduce the degree of superstructure in the template-primer. Our data suggest that the β3-β4 hairpin of fingers subdomain is an important determinant of processive polymerization by HIV-1 RT. The human immunodeficiency virus type 1 (HIV-1) 1The abbreviations used are: HIV-1, human immunodeficiency virus 1; RT, reverse transcriptase; RDDP, RNA-dependent DNA polymerase; dd, dideoxy. life cycle is dependent on the functions of the virally encoded polymerase, reverse transcriptase (RT). In addition to its being a target for drug development, HIV-1 RT is unusual in its structural features, versatile use of both RNA and DNA templates, high error rates (1Preston B.D. Poiesz B.J. Loeb L.A. Science. 1988; 242: 1168-1171Crossref PubMed Scopus (689) Google Scholar, 2Roberts J.D. Bebenek K. Kunkel T.A. Science. 1988; 242: 1171-1173Crossref PubMed Scopus (735) Google Scholar, 3Bebenek K. Abbotts J. Roberts J.D. Wilson S.H. Kunkel T.A. J. Biol. Chem. 1989; 264: 16948-16956Abstract Full Text PDF PubMed Google Scholar), and poor processivity (4Klarmann G.J. Schauber C.A. Preston B.D. J. Biol. Chem. 1993; 268: 9793-9802Abstract Full Text PDF PubMed Google Scholar). HIV-1 RT is a heterodimer containing 66- and 51-kDa polypeptides, termed p66 and p51 (5Goff S.P. J. Acquired Immune Defic. Syndr. 1990; 3: 817-831PubMed Google Scholar, 6Le Grice S.F.J. Skalka A. Goff S.P. Reverse Transcriptase. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1993: 163-191Google Scholar). The p51 is generated by the proteolytic cleavage of the p66 subunit (7Lightfoote M.M. Coligan J.E. Folks T.M. Fauci A.S. Martin M.A. Venkatesan S. J. Virol. 1986; 60: 771-775Crossref PubMed Google Scholar, 8Mizrahi V. Lazarus G.M. Miles L.M. Meyers C.A. Debouck C. Arch. Biochem. Biophys. 1989; 273: 347-358Crossref PubMed Scopus (73) Google Scholar). Because of its likeness to a right hand, the subdomains of HIV-1 RT are named fingers, palm, and thumb which are joined to the RNase H domain via a connection subdomain (9Kohlstaedt L.A. Wang J. Friedman J.M. Rice P.A. Steitz T.A. Science. 1992; 256: 1783-1790Crossref PubMed Scopus (1763) Google Scholar, 10Jacobo-Molina A. Ding J. Nanni R.G. Clark A.D.J. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar). The fingers, palm, thumb, and connection subdomains of p66 constitute the polymerase domain of RT and form a cleft for template-primer binding and for the polymerase active site (9Kohlstaedt L.A. Wang J. Friedman J.M. Rice P.A. Steitz T.A. Science. 1992; 256: 1783-1790Crossref PubMed Scopus (1763) Google Scholar, 10Jacobo-Molina A. Ding J. Nanni R.G. Clark A.D.J. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar, 11Rodgers D.W. Gamblin S.J. Harris B.A. Ray S. Culp J.S. Hellmig B. Woolf D.J. Debouck C. Harrison S.C. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1222-1226Crossref PubMed Scopus (376) Google Scholar, 12Hsiou Y. Ding J. Das K. Clark A.D. Hughes S.H. Arnold E. Structure. 1996; 4: 853-860Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar). The p51 subunit lacks the RNase H domain, and its three-dimensional structure, in contrast to that of p66, is more globular with no cleft (13Wang J. Smerdon S.J. Jager J. Kohlstaedt L.A. Rice P.A. Friedman J.M. Steitz T.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7242-7246Crossref PubMed Scopus (179) Google Scholar). The precise roles played by the various subdomains in the polymerase function of HIV-1 RT are unknown. The palm subdomain contains the catalytic triad of aspartates and therefore plays a key role in catalysis (9Kohlstaedt L.A. Wang J. Friedman J.M. Rice P.A. Steitz T.A. Science. 1992; 256: 1783-1790Crossref PubMed Scopus (1763) Google Scholar, 10Jacobo-Molina A. Ding J. Nanni R.G. Clark A.D.J. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar, 14Tantillo C. Ding J. Jacobo-Molina A. Nanni R.G. Boyer P.L. Hughes S.H. Pauwels R. Andries K. Janssen P.A. Arnold E. J. Mol. Biol. 1994; 243: 369-387Crossref PubMed Scopus (495) Google Scholar). In the three-dimensional x-ray crystal structures of the apo-RT and of RT complexed with template-primer or a non-nucleoside inhibitor, the thumb subdomain has been shown to occupy different positions with respect to the fingers (9Kohlstaedt L.A. Wang J. Friedman J.M. Rice P.A. Steitz T.A. Science. 1992; 256: 1783-1790Crossref PubMed Scopus (1763) Google Scholar, 10Jacobo-Molina A. Ding J. Nanni R.G. Clark A.D.J. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar, 11Rodgers D.W. Gamblin S.J. Harris B.A. Ray S. Culp J.S. Hellmig B. Woolf D.J. Debouck C. Harrison S.C. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1222-1226Crossref PubMed Scopus (376) Google Scholar, 12Hsiou Y. Ding J. Das K. Clark A.D. Hughes S.H. Arnold E. Structure. 1996; 4: 853-860Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar). Based on these observations, and the fact that the thumb domain intimately interacts with the template-primer (10Jacobo-Molina A. Ding J. Nanni R.G. Clark A.D.J. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar), it is proposed that the thumb subdomain mediates the translocation of the enzyme along template (12Hsiou Y. Ding J. Das K. Clark A.D. Hughes S.H. Arnold E. Structure. 1996; 4: 853-860Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar). The palm, thumb, and fingers subdomains are all thought to contact the template-primer, and together they constitute the template-primer cleft of HIV-1 RT. To understand the role of the fingers subdomain of HIV-1 RT on the polymerase processivity, we engineered two gross alterations into the β3-β4 hairpin creating insertions within the flexible loop connecting the β strands. Both mutants were characterized for polymerase activity, sensitivity to nucleotide triphosphate analogs, kinetic constants, and finally processivity. The results indicate that the fingers subdomain plays an essential role in determining the processivity of polymerization by HIV-1 RT. Modeling the three-dimensional structure of RT with the extended fingers provided insight into the possible role of the β3-β4 hairpin in increasing the processivity of RT. The Escherichia colistrain DH5αF′IQ (Life Technologies, Inc.) was used for expression of HIV-1 RT. The sequences of the RT employed in this study were derived from the molecular clone NL4-3 (15Adachi A. Gendelman H.E. Koenig S. Folks T. Willey R. Rabson A. Martin M.A. J. Virol. 1986; 59: 284-291Crossref PubMed Google Scholar). The expression vector used is pRT6H-NB/PROT containing an RTHXB2 p66 cassette and a separate HIV-1 PR expression cassette and is a version of pRT6H-PROT (16Le Grice S.F.J. Gruninger-Leitch F. Eur. J. Biochem. 1990; 187: 307-314Crossref PubMed Scopus (300) Google Scholar) containing NotI at the 5′-end. pL6H-PROT is a version of pRT6H-NB/PROT in which the RT sequences are replaced by a polylinker sequence. First, the RTHXB2sequences of pRT6H-NB/PROT were replaced with corresponding sequences from NL4-3 via polymerase chain reaction followed by digestion of the products by NotI and BglII and ligation of the fragment into the corresponding sites in pL6H-PROT. The deletion and insertion mutants were created by cassette mutagenesis as described previously (17Boyer P.L. Ferris A.L. Hughes S.H. J. Virol. 1992; 66: 1031-1039Crossref PubMed Google Scholar, 18Yang G. Song Q. Charles M. Drosopoulos W.C. Arnold E. Prasad V.R. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 1996; 11: 326-333Crossref PubMed Scopus (20) Google Scholar). Briefly, a gap was created in RT fingers region lacking the codons 60–79 to facilitate both insertions and deletions into the region. This intermediate clone was digested withBspMI to release the central fragment, and double-stranded adaptors were ligated to the BspMI sites to generate the deletion and insertion mutants (Fig. 1). The mutant RTs were analyzed by sequencing before subcloning the RT NotI/BglII insert into the expression construct, pL6H-PROT, which places a hexahistidine tag at the carboxyl terminus of p66. Bacteria carrying the appropriate expression vector were induced for expression by the addition of 1 mmisopropyl-1-thio-β-d-galactopyranoside (Sigma) as described previously (19Kew Y. Song Q. Prasad V.R. J. Biol. Chem. 1994; 269: 15331-15336Abstract Full Text PDF PubMed Google Scholar). The pellets of induced bacteria were lysed with lysozyme (1 mg/ml, for 20 min on ice), sonicated, and lysates cleared by centrifugation at 15,000 rpm (Sorvall SS-34 rotor). The purification of the finger extension mutants was essentially similar to the procedure we used previously (19Kew Y. Song Q. Prasad V.R. J. Biol. Chem. 1994; 269: 15331-15336Abstract Full Text PDF PubMed Google Scholar), except that all binding, washing, and elutions were done by the batch method. The specific activities of the wild type, FE20, and FE103 RTs were 3030, 1515, and 3333 units/mg, respectively (1 unit is defined as the activity equivalent to incorporation of 1 nmol of dTMP in 10 min at 37 °C using poly(rA)·oligo(dT)). The RNA-dependent DNA polymerase (RDDP) assays on heteropolymeric templates were performed in a 16-μl reaction mix containing 53 pm 16 S rRNA template-22-mer primer (5′TAACCTTGCGGCCGTACTCCCC3′), 50 mm Tris·Cl (pH 8.0), 80 mm KCl, 6 mm MgCl2, 1 mm dithiothreitol, 0.05% Nonidet P-40, 10 μm[α-32P]dGTP (2.7 Ci/mmol; NEN Life Science Products), and 50 μm each of dCTP, dATP, and dTTP and incubated at 37 °C for 15 min. Duplicate reactions were stopped by spotting onto DE81 filter squares and washed with 2× SSC (30 mm sodium citrate, 300 mm sodium chloride (pH 7.0)) for 10–15 min four times to remove unincorporated dNTPs. The filters were dried and the counts/min determined via a scintillation counter (1218 Rack Beta, LKB-Wallac, Sweden), and the picomoles of dNMP incorporated were calculated. The RDDP assays on homopolymeric template-primers were similar to the above conditions, except that we used 1 μmpoly(rA)·oligo(dT) along with 10 μm[α-32P]dTTP (2.3 Ci/mmol) or 1 μmpoly(rC)·oligo(dG) along with 10 μm[α-32P]dGTP (2.3 Ci/mmol). The sensitivity to each of the four ddNTPs was separately measured in the heteropolymeric RNA template assay described above. The concentration of three dNTPs (Pharmacia Biotech Inc.) was each at 25 μm. The fourth dNTP, for which a competing ddNTP is also present in the reaction, was at 5 μm and was α-32P-labeled (2.3 Ci/mmol). The ddNTP concentration in each case (Boehringer Mannheim) ranged from 0.25 to 1 mm. The reactions, run for 15 min, were stopped as described above, and dNMP incorporation was quantitated as before. The kinetic constants, Km and Vmax, were determined for RDDP activity on poly(rA)·oligo(dT). The reactions utilized 0.5 ng/μl RDDP reaction and were carried out as described above. The kinetic constants were determined as described previously (19Kew Y. Song Q. Prasad V.R. J. Biol. Chem. 1994; 269: 15331-15336Abstract Full Text PDF PubMed Google Scholar). The processivity assays were carried out using the heparin trap method. The two RNA templates used, from HIV-1 or influenza genomes, were derived by in vitro transcription from plasmids pKSNL/RN and pBS-M1, respectively. pKSNL/RN was constructed by ligating anEcoRV-NsiI fragment of pNL4-3 into pBluescript-KS (Stratagene) vector digested with EcoRV and PstI. pKSNL/RN was linearized with BamHI and pBS-M1 (20Bui M. Whittaker G. Helenius A. J. Virol. 1996; 70: 8391-8401Crossref PubMed Google Scholar) kindly provided by Matthew Bui (Yale University) with AflIII prior to in vitro run-off transcription using the T3 and T7 RNA polymerase, respectively (Ambion Corp.). The sequences of the oligonucleotide primers used in combination with HIV-1 and M1 RNA template are 5′CGCTTTCAAGTCCCTGTTCGGGCGCCA3′ and 5′AGTGGATTGGTTGTTGTCACCAT3′, respectively. A 10-μl reaction mix containing 50 mm Tris·Cl (pH 8.0), 80 mm KCl, 6 mm MgCl, 1 mmdithiothreitol, 1.5 units of RT enzymes, and 10 nmtemplate-primer (HIV-1 or influenza virus M1 RNA) were preincubated at 37 °C for 5 min. Subsequently, 25 μm dNTPs and 40 μg of heparin were added together and incubated at 37 °C for another 5 min. The reactions were stopped with 10 μl of stop solution (90% formamide, 10 mm EDTA (pH 8.0), 0.1% xylene cyanol, 0.1% bromphenol blue). Six microliters of the final mixture were separated on denaturing gels. A titration of the trapping activity of heparin was performed against each of the three enzymes. No differences were revealed suggesting that the ability of heparin to quench the three enzymes was very similar (data not shown). A model of the FE20 and FE103 finger-extension mutants was generated from coordinates of RT bound with the non-nucleoside RT inhibitor, α-APA R95845 (1HNI) (21Ding J. Das K. Tantillo C. Zhang W. Clark A.D.J. Jessen S. Lu X. Hsiou Y. Jacobo-Molina A. Andries K. Pauwels R. Moereels H. Koymans L. Janssen P.A.J. Smith R.H.J. Kroeger Koepke M. Michejda C.J. Hughes S.H. Arnold E. Structure. 1995; 3: 365-379Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar). Single residue substitutions were incorporated into the model to change the HXB2 sequence used for the x-ray structure determination to the wild type NL4-3 sequence used here. Residues that were modeled as alanines in the crystal structure because of weak electron density were also changed to conform the actual wild type NL4-3 RT sequence. The loop extensions of FE20 and FE103 RTs were introduced to the model of wild type NL4-3 RT using the loop-building function in the Homology package. The models of the three proteins, which included all atoms of their respective residues (including the inserted residues), were minimized using steepest descents with a CVFF forcefield in two steps using the Discover package (Biosym). In the first minimization, all residues present in the original crystallographic coordinates were constrained, and in the second, all non-hydrogen atoms were fixed. Next, a model of A-type DNA was made using the Builder package (Biosym). This model includes the 5 base pairs of A-form DNA that were positioned based on the phosphorous positions available from the RT-DNA co-crystal coordinates (1HMI) (10Jacobo-Molina A. Ding J. Nanni R.G. Clark A.D.J. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar). In addition, a 10-base overhang in the template strand was modeled assuming that the single-stranded extension maintained an A-type conformation. Although the phosphate backbone of the single-stranded region is flexible, it is plausible that this DNA is in the A-form and such an assumption has been made by others (22Boyer P.L. Tantillo C. Jacobo-Molina A. Nanni R.G. Ding J. Arnold E. Hughes S.H. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4882-4886Crossref PubMed Scopus (149) Google Scholar) attempting to model template extensions. The sequence of the template strand is thus 5′-AAAAAAAAAAATGGC-3′. The overhang modeled is not in the original coordinates. The double-stranded region positioned based on experimental coordinates and 5 residues of which were fixed throughout the minimization and dynamics calculations served as an anchor for the single-stranded region. Each protein-DNA model was minimized in sequential rounds, in which residues 105–112 and 178–191 (which together include the catalytic triad of aspartates) were fixed along with residues 12–15 of the template DNA and all 5 residues of the primer strand. The protein residues were fixed to prevent unreasonable distortions from occurring in the polymerase active site, particularly at or near Met-184 which is part of a turn containing unusual φ and ψ angles. The remaining portions of the model were restrained during minimization. Restraints were gradually lowered as minimization proceeded. Minimizations used a steepest descents algorithm initially and then switched to conjugate gradients when a maximum derivative limit of 2.5 kcal/mol Å had been reached, continuing to a final maximum derivative of 0.001 kcal/mol Å. Next, the structures were submitted to a dynamics calculation. Again, amino acid residues 105–112, 178–191, template residues 12–15, and all primer residues were fixed. Additionally, residues 388–560 and all 440 residues of p51 subunit were fixed. This simplification reduced computational times. Residues 388–560 are too far away to interact with the model DNA or residues binding the DNA. The dynamics calculation was carried out for 5 ps in 1-fs intervals at 298 K using a canonical ensemble. Following the dynamics calculation, coordinates were minimized using cff91 forcefield with the pH set to 7.5. These structures were again minimized, with residues 105–112, 178–191, and 388–560 of p66, all residues of p51, and template residues 12–15 and primer residues 1–5 fixed as before. Minimization was implemented to a derivative cut-off of 0.001 kcal/mol Å, before being resubmitted to further 11 ps of dynamics. The resulting coordinates were then minimized in an Amber forcefield to allow simulation of the effects of bulk solvent. A distance-dependent dielectric was employed with an r = 4 dependence for the dielectric constant, and 25-ps dynamics simulations were calculated. The root mean square deviations for the wild type HIV-1RTNL4-3, FE20, and FE103 models with respect to 1HNI starting coordinants were 1.6, 1.7, and 1.7 Å, respectively, when the palm residues were superpositioned. Superpositioning the fingers region yields root mean square deviations of 2.7, 3.0, and 3.6 Å, and root mean square deviations of 2.4, 2.1, and 2.8 Å result from superimposing the thumb residues of the wild type, FE20, and FE103 models on 1HNI coordinants. The only collisions seen between model residues and template is that between tyrosine 183 (wild type numbering) and template residue 12 (−2 position with respect to the template base that base pairs with incoming dNTP). The distance between Tyr-183 Cα and N-2 of the template residue 12 is 2.5 Å. This is a result of the constraints against movement imposed on these atoms to keep the active site aspartates or the template anchor residues from moving. No collisions are observed between finger residues and the extended template. Mutations were introduced into the fingers subdomain of recombinant pRTNL4-36H-PROT expression construct which contains separate expression cassettes for HIV-1NL4-3 RT p66 and HIV-1 protease (PR). Insertions in the β3-β4 hairpin were based on the structure reported by Jacobo-Molina et al. (10Jacobo-Molina A. Ding J. Nanni R.G. Clark A.D.J. Lu X. Tantillo C. Williams R.L. Kamer G. Ferris A.L. Clark P. Hizi A. Hughes S. Arnold E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6320-6324Crossref PubMed Scopus (1122) Google Scholar). In the original design of the finger extension, we wished to simply increase the bulk of the flexible loop. In the absence of suitable foreknowledge, we did not want to introduce electrostatic interactions which might adversely affect translocation and/or processivity as a result of altered enzyme-template-primer interactions, leading to an inactive state. Since serine residues avidly form hydrogen bonds and glycine residues have a high degree of main chain flexibility, we inserted a sequence that is rich in these residues to extend the size of the flexible loop (FE103, Fig. 1). During the process of mutagenesis to generate this insertion mutant, a fortuitous base deletion-insertion event within the inserted sequence led to the formation of an unintended mutant with an altered sequence in the insert (FE20, see Fig. 1). To assess the impact of alterations in the β3-β4 region on the polymerization function, lysates of bacteria induced for RT expression were initially tested for RNA-dependent DNA polymerase (RDDP) activity on both heteropolymeric and homopolymeric RNA templates. RDDP assays on heteropolymeric RNA template revealed that the activities of two insertion mutants were very similar to that of wild type RT (Table I). When homopolymeric templates were used, the finger insertion mutants were more active on poly(rA) compared with poly(rC), a characteristic feature of wild type HIV-1 RT (Table I).Table IRNA-dependent DNA polymerase (RDDP) activities of finger insertion mutantsEnzymeRNA-dependent DNA polymerase activityPoly(rA)Poly(rC)16 S rRNApmolratiopmolratiopmolratioWT411.03.01.01.51.0FE20280.682.40.80.90.6FE103390.952.70.91.61.1 Open table in a new tab Since the β3-β4 hairpin is a hot spot for nucleoside analog resistance mutations (14Tantillo C. Ding J. Jacobo-Molina A. Nanni R.G. Boyer P.L. Hughes S.H. Pauwels R. Andries K. Janssen P.A. Arnold E. J. Mol. Biol. 1994; 243: 369-387Crossref PubMed Scopus (495) Google Scholar), it is of interest to assess how gross alterations in β3-β4 affect the sensitivity of HIV-1 RT to such drugs. Therefore, the sensitivities of the finger insertion mutants to inhibition by each of four standard 2′,3′-dideoxynucleoside triphosphates (ddNTP; ddATP, ddCTP, ddGTP, and ddTTP) were determined in an RDDP assay utilizing 16 S rRNA as template. As shown in Table II, the insertion mutants demonstrated wild type levels of sensitivity to all ddNTPs.Table IISensitivities of the finger insertion mutants to ddNTPsRTddATPddCTPddGTPddTTPIC50RatioIC50RatioIC50RatioIC50Ratioμm-foldμm-foldμm-foldμm-foldWT3.510.510.810.51FE203.00.860.51.00.91.10.71.4FE1033.20.910.751.52.53.11.53 Open table in a new tab Both of the results described above indicate that the insertions into the finger β3-β4 hairpin did not affect the gross properties of the polymerase function of HIV-1 RT. Since the insertion mutations minimally affect the polymerase activity of RT, they were suitable to test the effect of finger alterations on the processivity of polymerization. To facilitate an in-depth analysis, the insertion mutants (FE20 and FE103) and the wild type HIV-1NL4-3 RT were purified to near-homogeneity (Fig. 2). The protein preparations were tested for contaminating RNase and DNase activities and were found to be free of both (data not shown). The kinetic constantsKm, dTTP and Vmax were determined for these RTs in RDDP assays on poly(rA)·oligo(dT) template-primer (summarized in Table III). Both the Km and Vmax for the mutants were similar to those of wild type RT. The Vmax/Kmratios for the mutant RTs, although reduced from wild type levels, suggest that the catalytic efficiencies were not significantly compromised by the large insertions in the β3-β4 hairpin.Table IIIThe kinetic constants for insertion mutants of HIV-1NL4-3HIV-1 RT(NL4-3)Km, dTTPVmaxVmax/Kmμmpmol/minWT8.8 ± 0.42.7 ± 0.050.31FE2012.1 ± 0.32.1 ± 0.030.17FE10310.6 ± 0.62.3 ± 0.050.22 Open table in a new tab To test the hypothesis that the overall size of the β3 and β4 strands (including the connecting loop) correlates with processivity of polymerization, RDDP assays were performed in the presence of a polymerase trap (heparin). A heteropolymeric RNA template consisting of u3, r, and u5 regions of the long terminal repeat and the primer binding site was prepared by in vitro transcription. A 5′-end-labeled oligodeoxyribonucleotide (PBS-G) complementary to the primer binding site was used as primer. RT was first allowed to bind to preannealed template-primer, and polymerization was initiated by simultaneous addition of dNTP substrates and an excess of heparin. The presence of the heparin trap ensures a single cycle of polymerase binding, DNA synthesis, and dissociation during the reaction. Analysis of the products generated during the processive synthesis indicates that both FE20 and FE103 were able to generate longer DNA products than the wild type RT (Fig. 3,A and B). Interestingly, FE103 produced more of the larger products than did FE20. The effectiveness of the trap was confirmed by mixing the template-primer with excess heparin before adding RT and initiating the reaction with dNTP substrates. This reaction produced no polymerization products (data not shown). When heparin was omitted from the reaction, allowing detection of products synthesized during multiple rounds of DNA synthesis, no differences were observed in the intensities of full-length product and the intermediate products produced by the wild type and mutant RTs (Fig. 3 A). Furthermore, we used the influenza virus M1 RNA as template to assess whether the enhanced processivity of the mutants is a unique property of the template sequences. The mutant RTs were again able to produce larger products than wild type (Fig. 3, C and D) showing that the increased processivity is not limited to HIV-1 genomic RNA template. The FE103 RT still produced more of the larger products in comparison with the wild type and the FE20 RTs. The processivity of FE20 and FE103 mutants appears to be increased by 25–30% as indicated by the size of the products generated on either HIV-1 or M1 RNA template. Plots of individual band intensities as a percentage of total band intensities (Fig. 3, B and D) illustrate the positions at which the RT molecules dissociated from the template. These represent the pause sites on the template due to secondary structures (4Klarmann G.J. Schauber C.A. Preston B.D. J. Biol. Chem. 1993; 268: 9793-9802Abstract Full Text PDF PubMed Google Scholar) or runs of the same nucleotide on the template (23Williams K.J. Loeb L.A. Fry M. J. Biol. Chem. 1990; 265: 18682-18689Abstract Full Text PDF PubMed Google Scholar). In processive synthesis with the wild type RT on HIV-1 RNA, two strong pause sites (at 59 and 97 bases from the primer terminus) and several weaker ones (between positions 100 and 150) are observed (Fig. 3 B). Most of the weak pause sites are absent or reduced in intensity for the two mutant RTs. In addition, FE20 RT shows significantly reduced pausing at position 97, whereas FE103 RT displays significant reduction at both positions 59 and 97 (Fig. 3 B). On M1 template, the three major pause sites corresponding to positions 86, 106, and 130 were observed with wild type and FE20 RT; however, with FE103 RT, stalling at these sites was significantly reduced (Fig. 3 D). Al" @default.
• W2004443145 created "2016-06-24" @default.
• W2004443145 creator A5008600029 @default.
• W2004443145 creator A5031539588 @default.
• W2004443145 creator A5054480635 @default.
• W2004443145 creator A5055295056 @default.
• W2004443145 date "1998-03-01" @default.
• W2004443145 modified "2023-10-14" @default.
• W2004443145 title "Insertions into the β3-β4 Hairpin Loop of HIV-1 Reverse Transcriptase Reveal a Role for Fingers Subdomain in Processive Polymerization" @default.
• W2004443145 cites W1487143054 @default.
• W2004443145 cites W1503369209 @default.
• W2004443145 cites W1504602313 @default.
• W2004443145 cites W1547738547 @default.
• W2004443145 cites W1576999979 @default.
• W2004443145 cites W1579646504 @default.
• W2004443145 cites W1587208028 @default.
• W2004443145 cites W1659719610 @default.
• W2004443145 cites W1693107265 @default.
• W2004443145 cites W1970893465 @default.
• W2004443145 cites W1990825789 @default.
• W2004443145 cites W2005610074 @default.
• W2004443145 cites W2008954911 @default.
• W2004443145 cites W2009581957 @default.
• W2004443145 cites W2013083986 @default.
• W2004443145 cites W2018809187 @default.
• W2004443145 cites W2020748808 @default.
• W2004443145 cites W2028824527 @default.
• W2004443145 cites W2029161127 @default.
• W2004443145 cites W2049521571 @default.
• W2004443145 cites W2065040389 @default.
• W2004443145 cites W2065740427 @default.
• W2004443145 cites W2069815958 @default.
• W2004443145 cites W2073873696 @default.
• W2004443145 cites W2087946368 @default.
• W2004443145 cites W2090126383 @default.
• W2004443145 cites W2092786021 @default.
• W2004443145 cites W2093174110 @default.
• W2004443145 cites W2103173557 @default.
• W2004443145 cites W2106315897 @default.
• W2004443145 cites W2108194119 @default.
• W2004443145 cites W2118095174 @default.
• W2004443145 cites W2119997930 @default.
• W2004443145 cites W2128508248 @default.
• W2004443145 cites W2153193209 @default.
• W2004443145 cites W2173733293 @default.
• W2004443145 cites W2321672965 @default.
• W2004443145 cites W4298363274 @default.
• W2004443145 doi "https://doi.org/10.1074/jbc.273.13.7529" @default.
• W2004443145 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9516454" @default.
• W2004443145 hasPublicationYear "1998" @default.
• W2004443145 type Work @default.
• W2004443145 sameAs 2004443145 @default.
• W2004443145 citedByCount "40" @default.
• W2004443145 countsByYear W20044431452012 @default.
• W2004443145 countsByYear W20044431452014 @default.
• W2004443145 countsByYear W20044431452016 @default.
• W2004443145 countsByYear W20044431452017 @default.
• W2004443145 crossrefType "journal-article" @default.
• W2004443145 hasAuthorship W2004443145A5008600029 @default.
• W2004443145 hasAuthorship W2004443145A5031539588 @default.
• W2004443145 hasAuthorship W2004443145A5054480635 @default.
• W2004443145 hasAuthorship W2004443145A5055295056 @default.
• W2004443145 hasBestOaLocation W20044431451 @default.
• W2004443145 hasConcept C104317684 @default.
• W2004443145 hasConcept C114614502 @default.
• W2004443145 hasConcept C12554922 @default.
• W2004443145 hasConcept C156719811 @default.
• W2004443145 hasConcept C159047783 @default.
• W2004443145 hasConcept C184670325 @default.
• W2004443145 hasConcept C185592680 @default.
• W2004443145 hasConcept C3013748606 @default.
• W2004443145 hasConcept C33923547 @default.
• W2004443145 hasConcept C55493867 @default.
• W2004443145 hasConcept C67705224 @default.
• W2004443145 hasConcept C86803240 @default.
• W2004443145 hasConceptScore W2004443145C104317684 @default.
• W2004443145 hasConceptScore W2004443145C114614502 @default.
• W2004443145 hasConceptScore W2004443145C12554922 @default.
• W2004443145 hasConceptScore W2004443145C156719811 @default.
• W2004443145 hasConceptScore W2004443145C159047783 @default.
• W2004443145 hasConceptScore W2004443145C184670325 @default.
• W2004443145 hasConceptScore W2004443145C185592680 @default.
• W2004443145 hasConceptScore W2004443145C3013748606 @default.
• W2004443145 hasConceptScore W2004443145C33923547 @default.
• W2004443145 hasConceptScore W2004443145C55493867 @default.
• W2004443145 hasConceptScore W2004443145C67705224 @default.
• W2004443145 hasConceptScore W2004443145C86803240 @default.
• W2004443145 hasIssue "13" @default.
• W2004443145 hasLocation W20044431451 @default.
• W2004443145 hasOpenAccess W2004443145 @default.
• W2004443145 hasPrimaryLocation W20044431451 @default.
• W2004443145 hasRelatedWork W1945359667 @default.
• W2004443145 hasRelatedWork W1966013139 @default.
• W2004443145 hasRelatedWork W2055975019 @default.
• W2004443145 hasRelatedWork W2119522412 @default.
• W2004443145 hasRelatedWork W2188973184 @default.
• W2004443145 hasRelatedWork W2400222536 @default.
• W2004443145 hasRelatedWork W2607725540 @default.

• next