FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2004607722> ?p ?o ?g. }

• W2004607722 endingPage "19114" @default.
• W2004607722 startingPage "19109" @default.
• W2004607722 abstract "The yihZ gene of Escherichia coli is shown to produce a deacylase activity capable of recycling misaminoacylated d-Tyr-tRNATyr. The reaction is specific and, under optimal in vitroconditions, proceeds at a rate of 6 s−1 with aK m value for the substrate equal to 1 μm. Cell growth is sensitive to interruption of theyihZ gene if d-tyrosine is added to minimal culture medium. Toxicity of exogenous d-tyrosine is exacerbated if, in addition to the disruption of yihZ, the gene of d-amino acid dehydrogenase (dadA) is also inactivated. Orthologs of the yihZ gene occur in many, but not all, bacteria. In support of the idea of a general role of thed-Tyr-tRNATyr deacylase function in the detoxification of cells, similar genes can be recognized inSaccharomyces cerevisiae, Caenorhabditis elegans, Arabidopsis thaliana, mouse, and man. The yihZ gene of Escherichia coli is shown to produce a deacylase activity capable of recycling misaminoacylated d-Tyr-tRNATyr. The reaction is specific and, under optimal in vitroconditions, proceeds at a rate of 6 s−1 with aK m value for the substrate equal to 1 μm. Cell growth is sensitive to interruption of theyihZ gene if d-tyrosine is added to minimal culture medium. Toxicity of exogenous d-tyrosine is exacerbated if, in addition to the disruption of yihZ, the gene of d-amino acid dehydrogenase (dadA) is also inactivated. Orthologs of the yihZ gene occur in many, but not all, bacteria. In support of the idea of a general role of thed-Tyr-tRNATyr deacylase function in the detoxification of cells, similar genes can be recognized inSaccharomyces cerevisiae, Caenorhabditis elegans, Arabidopsis thaliana, mouse, and man. polyacrylamide gel electrophoresis open reading frame polymerase chain reaction base pair d-Amino acids are usually prevented from being incorporated into proteins because aminoacyl-tRNA synthetases are specific of l-amino acids (1Davie E.W. Koningsberger V.V. Lipmann F. Arch. Biochem. Biophys. 1956; 65: 21-38Crossref PubMed Scopus (55) Google Scholar, 2Berg P. J. Biol. Chem. 1958; 233: 601-607Abstract Full Text PDF PubMed Google Scholar, 3Bergmann F.H. Berg P. Dieckmann M. J. Biol. Chem. 1961; 236: 1735-1740Abstract Full Text PDF Google Scholar, 4Norton S.J. Ravel J.M. Lee C. Shive W. J. Biol. Chem. 1963; 238: 269-274Abstract Full Text PDF PubMed Google Scholar). However, it was observed early on that Escherichia coli and Bacillus subtilis tyrosyl-tRNA synthetases can transferd-tyrosine to tRNATyr (5Calendar R. Berg P. Biochemistry. 1966; 5: 1681-1690Crossref PubMed Scopus (160) Google Scholar, 6Calendar R. Berg P. Biochemistry. 1966; 5: 1690-1695Crossref PubMed Scopus (139) Google Scholar). The same extent of tRNATyr aminoacylation could be reached with thel- and the d-enantiomers of the amino acid. Some time later, extracts of E. coli, yeast, rabbit reticulocytes, or rat liver were reported to contain an enzyme activity capable of accelerating the hydrolysis of the ester linkage ofd-Tyr-tRNA in the production of free tRNA andd-tyrosine (7Calendar R. Berg P. J. Mol. Biol. 1967; 26: 39-54Crossref PubMed Scopus (118) Google Scholar). Partially purified E. colideacylase could be shown to be distinct from tyrosyl-tRNA synthetase (7Calendar R. Berg P. J. Mol. Biol. 1967; 26: 39-54Crossref PubMed Scopus (118) Google Scholar) or peptidyl-tRNA hydrolase (8Kössel H. RajBhandary U.L. J. Mol. Biol. 1968; 35: 539-560Crossref PubMed Scopus (83) Google Scholar). It also cleavesd-Phe-tRNAPhe and Gly-tRNAGly, although more slowly than d-Tyr-tRNATyr.l-Aminoacyl-tRNAs (l-Ile-tRNAIle,l-Phe-tRNAPhe, andl-Tyr-tRNATyr) are left intact. These findings suggested that, although tRNATyr might be misaminoacylated with d-tyrosine in vivo, misincorporation of this d-amino acid into proteins was prevented by the detected deacylase. Such a mechanism possibly helps living cells to counterreact against the toxicity of d-amino acids found in diet or produced by endogenous metabolism. It may also be a relic of primitive forms of life when selection between d- andl- amino acid isomers began. In the present report, we describe the isolation and overexpression of yihZ, the gene encoding the E. coli d-Tyr-tRNATyr deacylase. The catalytic constants of the d-Tyr-tRNATyrdeacylase reaction are measured. Disruption of the deacylase gene did not modify the generation time of the bacterium under standard laboratory conditions. Nevertheless, a significant decrease in the growth rate of yihZ null mutants could be obtained if minimal medium was supplemented with d-tyrosine. Orthologs of the E. coli deacylase gene occur in the genetic materials of many cells including those of mammals and higher plants. d-[methylene-3H]Tyrosine (211 GBq/mmol) was custom-prepared by Amersham Pharmacia Biotech;l-[14C]tyrosine was from NEN Life Science Products; and unlabeled d-tyrosine was from Sigma. Sephadex DEAE-A50 and Q-Sepharose were from Amersham Pharmacia Biotech. Hydroxylapatite was from Bio-Rad and Trisacryl GF05 from IBF. E. coli tRNATyr2 was overexpressed in strain JM101TR from a synthetic gene built according to a published procedure (9Meinnel T. Mechulam Y. Fayat G. Nucleic Acids Res. 1988; 16: 8095-8096Crossref PubMed Scopus (86) Google Scholar). The resulting bulk tRNA accepted 320 pmol of l-tyrosine perA 260 unit. d-[3H]Tyr-tRNATyr was directly prepared from the above tRNA extract. The reaction mixture (500 μl) contained 20 mm Tris-HCl (pH 7.8), 7 mmMgCl2, 2 mm ATP, 3.5 μmd-[3H]tyrosine (18.5 GBq/mmol), 0.1 mm EDTA, 7.5 μm tRNATyr, and 1.2 μm purified E. coli tyrosyl-tRNA synthetase. Reactions conditions (10 min, 28 °C) ensured a nearly complete esterification of the d-amino acid to the tRNA. Note that because of the occurrence of contaminating l-tyrosine (2%) inside the d-[3H]tyrosine sample, the reaction was performed with a concentration of tRNATyr in excess over that of d-tyrosine. Under this condition and provided the d-amino acid is fully incorporated in tRNATyr, the proportion ofl-Tyr-tRNATyr (the favored product of tyrosyl-tRNA synthetase) in the preparedd-Tyr-tRNATyr sample cannot exceed 2%. The reaction was quenched by 500 μl of 600 mm sodium acetate (pH 5.0) plus 500 μl of phenol saturated with a 100 mmsodium acetate solution (pH 5.0). The solution was vigorously shaken and centrifuged for 15 min at 15,000 × g. The interphase and the phenol phase were re-extracted with 250 μl of 300 mm sodium acetate (pH 5.0) and centrifuged as above. The two aqueous phases were pooled, precipitated with ethanol, and centrifuged (15 min at 15,000 × g). The pellet was resuspended in 100 μl of 20 mm sodium acetate (pH 5.0) containing 100 mm KCl and 0.1 mm EDTA. Finally, the sample was chromatographed on a Trisacryl GF05 column (0.25 × 16 cm) equilibrated in the same solution. Resultingd-Tyr-tRNATyr (100 pmol of d-amino acid incorporated per A 260 unit of tRNA) was stored frozen at −20 °C. l-[14C]Tyr-tRNATyr (80 pmol perA 260 unit) was prepared by the same procedure, except that esterification was performed with 2 μml-[14C]tyrosine (18.4 GBq/mmol) and 0.5 μm tyrosyl-tRNA synthetase. N-Acetylation ofd-[3H]Tyr-tRNATyr orl-[14C]Tyr-tRNATyr was performed as described earlier for the preparation of diacetyl-lysyl-tRNALys (10Schmitt E. Mechulam Y. Fromant M. Plateau P. Blanquet S. EMBO J. 1997; 16: 4760-4769Crossref PubMed Scopus (81) Google Scholar). d-Tyr-tRNATyr deacylase was purified from E. coli strain K37 (Table I). All buffers contained 0.1 mm EDTA and 10 mm2-mercaptoethanol. Cells were grown at 37 °C in 16 liters of 2× TY medium and harvested by centrifugation for 35 min at 3,000 ×g. The cell pellet was suspended in 20 mmTris-HCl (pH 7.8) at a cell density of 0.1 g of wet weight per ml of buffer. Cells were disrupted by sonication (10 min, 0 °C), and debris removed by centrifugation (35 min at 3,000 ×g). Nucleic acids were precipitated by addition of streptomycin (30 g/liter) to the supernatant, which was then centrifuged for 35 min at 3,000 × g. The resulting supernatant was brought to 50% ammonium sulfate saturation, left to stand 1 h at 4 °C, and centrifuged (35 min, 3,000 ×g). The pellet was discarded, and the supernatant was brought to 80% ammonium sulfate saturation. After centrifugation for 35 min at 3,000 × g, the protein sample was dissolved in 250 ml of 20 mm potassium phosphate (pH 8.0) and dialyzed against 3 liters of the same buffer. The resulting solution was applied on a column of Sephadex DEAE-A50 (4 × 12 cm), equilibrated in 20 mm potassium phosphate (pH 8.0). Elution was carried out with a 3-liter linear gradient of 40–350 mm potassium phosphate (pH 8.0) at a flow rate of 100 ml/h. Fractions containing activity were pooled, dialyzed against a 10 mm potassium phosphate (pH 6.75) buffer, and applied on a hydroxylapatite column (3 × 13 cm) equilibrated in the same buffer. Enzyme activity was recovered by using a 2× 500 ml linear gradient of 10–400 mm potassium phosphate (pH 6.75), at a flow rate of 50 ml/h. Fractions containing activity were pooled, dialyzed against a 10 mm potassium phosphate buffer (pH 7.0), and applied on a Q-Sepharose Hi-Load column (3.2 × 10 cm, from Amersham Pharmacia Biotech) equilibrated in the same buffer. This column was eluted with a 1.5-liter linear gradient from 10 to 500 mm NaCl in the buffer of the column. One fraction from the Q-Sepharose chromatography, accounting for 1/3 of the total recovered activity, was concentrated batchwise on a Sephadex DEAE-A50 column (0.25 × 4 cm). 100 μl of the recovered sample (600 μl) were then loaded on a TSK G3000 SW HPLC column (0.75 × 30 cm, from Tosohaas), which was eluted at a flow rate of 0.5 ml/min with 10 mm potassium phosphate (pH 7.0) containing 150 mm KCl.Table IBacterial strains and plasmidsStrains and plasmidsGenotypeSource (Ref.)StrainsK37galK rpsL35Miller H.I. Friedman D.I. Cell. 1980; 20: 711-719Abstract Full Text PDF PubMed Scopus (111) Google ScholarJM101TRΔ(lac pro) supE thi recA56 srl-300∷Tn10 (F′ traD36 proAB lacIq lacZΔM15)36Hirel P.H. Lévêque F. Mellot P. Dardel F. Panvert M. Mechulam Y. Fayat G. Biochimie (Paris). 1988; 70: 773-782Crossref PubMed Scopus (48) Google ScholarEC989araD139 Δ(argF-lac)169 λ − flb-5301 fruA25 relA1 rpsL150(strR) metB185 deoC1 dadA23716Wild J. Klopotowski T. Mol. Gen. Genet. 1981; 181: 373-378Crossref PubMed Scopus (29) Google ScholarEC989daraD139 Δ(argF-lac)169 λ − flb-5301 fruA25 relA1 rpsL150(strR) metB185 deoC1This workFB8Wild-type E. coli K1237Bruni C.B. Colantuoni V. Sbordone L. Cortese R. Blasi F. J. Bacteriol. 1977; 130: 4-10Crossref PubMed Google ScholarFB8rrelA138Uzan M. Danchin A. Mol. Gen. Genet. 1978; 165: 21-30Crossref PubMed Scopus (58) Google ScholarK37ΔTyrHK37ΔyihZ∷kanThis workEC989ΔTyrHEC989ΔyihZ∷kanThis workEC989dΔTyrHEC989dΔyihZ∷kanThis workFB8ΔTyrHFB8ΔyihZ∷kanThis workFB8rΔTyrHFB8rΔyihZ∷kanThis workK37ΔTyrHΔrecAK37ΔyihZ∷kan ΔrecA938∷catThis workPlasmidspKK223–3Apr39Brosius J. Holy A. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 6929-6933Crossref PubMed Scopus (387) Google ScholarpBluescript(−)KS (pBS)AprStratagenepBR322 EcoTyrTSApr tyrS derivative of pBR32240Barker D.G. Eur. J. Biochem. 1982; 125: 357-360Crossref PubMed Scopus (40) Google ScholarpYtHApr yihZ derivative of pKK223–3This workpMAK705Cmr rep(ts)13Hamilton C.M. Aldea M. Washburn B.K. Babitzke P. Kushner S.R. J. Bacteriol. 1989; 171: 4617-4622Crossref PubMed Google ScholarpKK4Cmr yihZ∷kan derivative of pMAK705This workpBSKSyihZApr yihZderivative of pBSThis work Open table in a new tab Aliquots (200 μl) of each active fraction recovered from the above TSK column were analyzed by SDS-PAGE1 (11Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). After migration, proteins were electrophoretically transferred on a ProBlot membrane (from Applied Biosystems) and stained with Amido Black. About 10 protein bands were visible on the membrane. One of them, the intensity of which was correlated with thed-Tyr-tRNATyr deacylase activity measured in the fractions, was cut and submitted to 10 cycles of Edman degradation on an Applied Biosystems 473A Sequencer. E. colityrosyl-tRNA synthetase was overexpressed in strain JM101TR harboring plasmid pBR322 EcoTyrTS (Table I). Cells were grown overnight in 1 liter of 2× TY medium containing 100 μg of ampicillin per ml. Crude extract preparation and removal of nucleic acids by streptomycin precipitation were performed as described above for the purification of d-Tyr-tRNATyr deacylase. Then the sample was brought to 70% ammonium sulfate saturation, left to stand 1 h at 4 °C, and centrifuged for 20 min at 8,000 ×g. The protein sample was dissolved in 3 ml of 20 mm potassium phosphate (pH 6.75), dialyzed overnight against 3 liters of the same buffer, and applied on an 80-ml Q-Sepharose column (2.8 × 13 cm). The column was eluted with a 1200-ml linear gradient of 100–400 mm KCl in the column buffer (flow rate 120 ml/h). Recovered fractions containing activity were immediately applied on a hydroxylapatite column (3.8 × 18 cm) equilibrated in 20 mm potassium phosphate (pH 6.75). Tyrosyl-tRNA synthetase activity was recovered at a flow rate of 100 ml/h by using a 5-liter linear gradient of potassium phosphate (pH 6.75), from 40 to 200 mm. As judged by SDS-PAGE analysis, tyrosyl-tRNA synthetase was at least 90% pure at this stage. The enzyme solution was concentrated 100-fold by a batchwise chromatography on a Sephadex DEAE column (2 × 3.2 cm) and then dialyzed against 20 mmTris-HCl (pH 7.8) containing 60% glycerol and stored at −20 °C. E. colistrain JM101TR transformed by plasmid pYtH (Table I) was grown at 37 °C in 2 liters of 2× TY medium containing 200 μg of ampicillin per ml. When the optical density of the culture reached 0.3 at 650 nm, 1 mm isopropyl-1-thio-β-d-galactopyranoside was added, and growth was continued overnight. Conditions for crude extract preparation, removal of nucleic acids, and ammonium sulfate precipitation were the same as those used for the purification of the deacylase from the strain K37. Further chromatographies on Q-Sepharose and hydroxylapatite columns were similar to those of tyrosyl-tRNA synthetase purification. However, in the case of the deacylase (i) all buffers were supplemented with 0.1 mm EDTA and 10 mm 2-mercaptoethanol, (ii) NaCl rather than KCl was used in the elution buffer of the Q-Sepharose column, and (iii) the potassium phosphate linear gradient for the elution of the hydroxylapatite column was from 10 to 400 mm. Recovered deacylase was concentrated by an ammonium sulfate precipitation (80% saturation). After centrifugation at 10,000 × g for 30 min, the pellet was dialyzed against a 20 mm Tris-HCl buffer (pH 7.8) containing 60% glycerol, 0.1 mm EDTA and 10 mm2-mercaptoethanol, and stored at −20 °C. Unless otherwise stated,d-Tyr-tRNATyr deacylase activity was measured for 5 min at 28 °C in 100-μl assays containing 50 nmd-[3H]Tyr-tRNATyr, 20 mm Tris-HCl (pH 7.8), and 0.1 mm EDTA. The reaction was quenched by the successive addition of 100 μl of 10% trichloroacetic acid and 20 μl of carrier RNA from yeast (4 mg/ml). The sample was centrifuged (5 min, 15,000 × g), and 200 μl of the supernatant were mixed with 6 ml of Picofluor scintillation mixture (from Packard) and counted in a Beckman LS1801 counter. Concentration of d-Tyr-tRNATyrdeacylase was determined using the light-absorption coefficient calculated from the amino acid sequence of the protein (0.571A 280 units·mg−1·ml). K m and k cat values were derived from iterative non-linear fits to the theoretical Michaelis equation to the experimental values, using the Levenberg-Marquardt algorithm. Confidence limits on the fitted values were obtained by 100 Monte Carlo simulations followed by least squares fitting, using the experimental standard deviations on individual measurements (12Dardel F. Comput. Appl. Biosci. 1994; 10: 273-275PubMed Google Scholar). The yihZgene was amplified by PCR using oligonucleotides DTyrFront (CCGAATTCCATGATTGCATTAATTCAACGCGTAAC) and DTyrEnd (CCAGCCAAGCTTTCATACCTGCAACCAGAATGTCACG) and genomic DNA from strain K37. The amplified DNA fragment (460 bp) was purified using the Qiagen Plasmid Mini Kit 100, digested by EcoRI andHindIII, and inserted into the corresponding sites of plasmid pKK223-3, to finally give plasmid pYtH. The sequence of the insert was verified by DNA sequencing. The EcoRI-HindIII fragment of plasmid pYtH containing the yihZ gene was also subcloned between the corresponding sites of plasmid pBluescript(−)KS (pBS). The resulting plasmid, designated pBSKSyihZ, harbored the yihZ gene in the opposite orientation to the lacZ promoter. Disruption of theyihZ gene was achieved by the procedure of Hamilton et al. (13Hamilton C.M. Aldea M. Washburn B.K. Babitzke P. Kushner S.R. J. Bacteriol. 1989; 171: 4617-4622Crossref PubMed Google Scholar) using plasmid pMAK705, which contains a thermosensitive replicon and a chloramphenicol resistance gene. A DNA fragment containing the first 190 bp of the yihZ ORF, the kanamycin resistance cassette from pUC4K (14Vieira J. Messing J. Gene (Amst.). 1982; 19: 259-268Crossref PubMed Scopus (3785) Google Scholar), and the last 187 bp of theyihZ ORF was inserted in pMAK705. E. coli strain K37 was transformed by the resulting plasmid (pKK4). The integration of pKK4 into the chromosome was selected by plating transformants at 42 °C on LB agar medium containing chloramphenicol. After growth at 30 °C in liquid medium for ∼30 generations, cells no longer carrying the plasmid in their chromosome were identified as chloramphenicol-sensitive colonies at 42 °C. Approximately 60% of selected cells were also kanamycin-resistant at 42 °C, thus suggesting that (i) the ΔyihZ::kanmutation carried by pKK4 was now located on the chromosome and (ii) theyihZ gene was not essential to the growth of E. coli. After subsequent growth at 42 °C, the loss of the thermosensitive plasmid was verified by ensuring that the cells had become chloramphenicol-sensitive at 30 °C. One of the resulting clones was named K37ΔTyrH and was used in further studies. Disruption of the yihZ gene in this clone was confirmed by PCR amplification of chromosomal DNA using the above oligonucleotides DTyrFront and DTyrEnd. The ΔyihZ::kanmutation could be transferred from strain K37ΔTyrH into strains EC989, FB8, and FB8r (Table I) by P1 transduction. Resulting strains were named EC989ΔTyrH, FB8ΔTyrH, and FB8rΔTyrH, respectively. Strain K37ΔTyrHΔrecA was further obtained by P1 transduction of the ΔrecA938::cat mutation from the strain GW5552 (15Marsh L. Walker G.C. J. Bacteriol. 1987; 169: 1818-1823Crossref PubMed Google Scholar). Strains EC989d and EC989dΔTyrH were constructed by P1 transduction of the dadA + allele, from strain K37 into strain EC989 or EC989ΔTyrH, respectively. In the latter case, selection of transductants was performed on M9 minimal plates containing 20 mml-alanine as carbon source (16Wild J. Klopotowski T. Mol. Gen. Genet. 1981; 181: 373-378Crossref PubMed Scopus (29) Google Scholar, 17McFall E. Newman E.B. Neidhardt F.C. Escherichia coli and Salmonella. Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 358-379Google Scholar). The presence ofd-Tyr-tRNATyr hydrolytic activity in E. coli strain K37 was verified by adding cellular extract tod- or l-Tyr-tRNATyr (Tris 20 mm (pH 7.8), 28 °C, final concentration of total protein in the assay: 20–200 μg/ml). The rate of deacylation ofd-Tyr-tRNATyr was at least 100-fold faster than that of l-Tyr-tRNATyr. The activity of the enzyme responsible for the specificd-Tyr-tRNATyr hydrolysis was then followed through chromatographies on Sephadex DEAE-A50, hydroxylapatite, Q-Sepharose, and TSK 3000. At each step, a single peak of activity was always recovered. According to the TSK gel filtration, the molecular mass associated to the native d-Tyr-tRNATyrdeacylase activity could be estimated equal to 35 ± 3 kDa. In this experiment, marker proteins of known M rincluded lysyl-tRNA synthetase (18Lévêque F. Plateau P. Dessen P. Blanquet S. Nucleic Acids Res. 1990; 18: 305-312Crossref PubMed Scopus (86) Google Scholar), truncated methionyl-tRNA synthetase (19Mellot P. Mechulam Y. LeCorre D. Blanquet S. Fayat G. J. Mol. Biol. 1989; 208: 429-443Crossref PubMed Scopus (91) Google Scholar), ovalbumin, carbonic anhydrase, peptidyl-tRNA hydrolase (20Dutka S. Meinnel T. Lazennec C. Mechulam Y. Blanquet S. Nucleic Acids Res. 1993; 21: 4025-4030Crossref PubMed Scopus (51) Google Scholar), and egg white lysozyme. At the last step of the purification, the recovered enzyme was less than 10% pure, according to SDS-PAGE analysis. However, along the fractions recovered from the TSK column, the activity varied proportionally to the intensity on the gel of one protein band having an apparent mass of 16 ± 2 kDa. After transfer from the gel to a polyvinylidene difluoride membrane, this protein material was submitted to 10 cycles of Edman degradation. Its N-terminal sequence, MIALIQRVTR, designated an open reading frame (ORF), yihZ, at 87.81 min on the E. coli genetic map. The predictedM r of the yihZ product (15Marsh L. Walker G.C. J. Bacteriol. 1987; 169: 1818-1823Crossref PubMed Google Scholar, 950) was in agreement with the M r of the selected protein. To assess whether the yihZ gene actually encoded thed-Tyr-tRNATyr deacylase activity in the crude extract, a DNA fragment encompassing this gene was amplified by PCR and inserted into the expression vector pKK223-3. Upon transformation by the resulting plasmid (pYtH), E. coli strain JM101TR overexpressed one protein with the expected mass of ∼16 kDa. In addition, d-Tyr-tRNATyr deacylase activity in crude extract was increased 1500-fold as compared with cells transformed by the control plasmid pKK223–3 (TableII). We therefore concluded that theyihZ gene encodes the E. coli d-Tyr-tRNATyr deacylase and that, upon TSK chromatography in non-denaturing conditions, this deacylase shows the mass of a dimer.Table IId-Tyr-tRNA Tyr deacylase activity in various E. coli strainsStraind-Tyr-tRNATyr activityaThe initial rate of hydrolysis ofd-[3H]Tyr-tRNATyr in the presence of 20 mm Tris-HCl (pH 7.8), 50 nmd-[3H]Tyr-tRNATyr, 5 mmMgCl2, 10 mm 2-mercaptoethanol, and 0.1 mm EDTA was measured as described under “Materials and Methods.” One unit corresponds to the enzyme activity capable of hydrolyzing 1 pmol of d-[3H]Tyr-tRNATyrper min under standard assay conditions.units/mgJM101TR (pKK223–3)120JM101TR (pYtH)180,000K37120K37ΔTyrH11EC989110EC989ΔTyrH10EC989d105EC989dΔTyrH10Cells were grown overnight in LB medium. With the JM101TR derivatives, the medium was supplemented with 200 μg of ampicillin/ml, and 1 mm isopropyl-1-thio-β-d-galactopyranoside was added when the optical density of the culture reached 0.3 at 650 nm. Specific deacylase activities were measured in crude extracts obtained by sonication of cells resuspended at an optical density of 100 at 650 nm. Final protein concentration in the extracts was 5–10 mg/ml.a The initial rate of hydrolysis ofd-[3H]Tyr-tRNATyr in the presence of 20 mm Tris-HCl (pH 7.8), 50 nmd-[3H]Tyr-tRNATyr, 5 mmMgCl2, 10 mm 2-mercaptoethanol, and 0.1 mm EDTA was measured as described under “Materials and Methods.” One unit corresponds to the enzyme activity capable of hydrolyzing 1 pmol of d-[3H]Tyr-tRNATyrper min under standard assay conditions. Open table in a new tab Cells were grown overnight in LB medium. With the JM101TR derivatives, the medium was supplemented with 200 μg of ampicillin/ml, and 1 mm isopropyl-1-thio-β-d-galactopyranoside was added when the optical density of the culture reached 0.3 at 650 nm. Specific deacylase activities were measured in crude extracts obtained by sonication of cells resuspended at an optical density of 100 at 650 nm. Final protein concentration in the extracts was 5–10 mg/ml. The yihZ gene is the third ORF of a four-gene operon also including yihX, rbn (or yihY), andyiiD (21Plunkett III, G. Burland V. Daniels D.L. Blattner F.R. Nucleic Acids Res. 1993; 21: 3391-3398Crossref PubMed Scopus (143) Google Scholar) (Fig. 1). A putative promoter sequence can be recognized 30–63 bp upstream of theyihX initiator codon. rbn codes for RNase BN, an enzyme involved in the maturation of the 3′-end of tRNAs (22Callahan C. Deutscher M.P. J. Bacteriol. 1996; 178: 7329-7332Crossref PubMed Google Scholar). According to sequence comparison using BLAST program (23Altschul S.F. Madden T.L. Schäffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (60233) Google Scholar), theyihX protein resembles various dehalogenases or epoxide hydrolases. The yiiD product has no significant homology with any other protein stored in the data bases. d-Tyr-tRNATyr deacylase was purified from strain JM101TR transformed by plasmid pYtH. After successive chromatographies on Q-Sepharose and hydroxylapatite columns, the enzyme was recovered homogeneous, as judged by SDS-PAGE analysis. The initial rate of d-Tyr-tRNATyr hydrolysis, in a 20 mm Tris-HCl buffer (pH 7.8) containing 0.1 mm EDTA, was increased 3–4-fold upon the addition of either 50 mm KCl or 10 mm MgCl2(Table III). Higher concentrations of these salts inhibited the enzyme, and the simultaneous addition of both MgCl2 and KCl showed no effect. These results suggest that ionic strength improves the rate of the reaction through the folding of the tRNA structure. Accordingly, addition of 1 mmspermidine also stimulated 3-fold the hydrolysis ofd-Tyr-tRNATyr (Table III). However, specific features in the tRNA nucleotide sequence may also be involved in substrate recognition, as indicated by the capacity of the deacylase to hydrolyze d-tyrosyl oligonucleotides (7Calendar R. Berg P. J. Mol. Biol. 1967; 26: 39-54Crossref PubMed Scopus (118) Google Scholar).Table IIIActivity of d-Tyr-tRNA Tyr deacylase under various ionic conditionsComponent addedInitial rateaThe initial rate of hydrolysis ofd-[3H]Tyr-tRNATyr catalyzed byd-Tyr-tRNATyr deacylase was measured in the presence of 20 mm Tris-HCl (pH 7.8), 50 nmd-[3H]Tyr-tRNATyr, 0.1 mmEDTA, and the indicated components, as described under “Materials and Methods.”s −1None0.095 mmMgCl20.2910 mm MgCl20.3620 mm MgCl20.3050 mmKCl0.22200 mm KCl0.14400 mmKCl0.085 mm MgCl2 + 50 mmKCl0.205 mm MgCl2 + 0.1 mmZnCl20.431 mm spermidine0.305 mm spermidine0.3310 mmspermidine0.29a The initial rate of hydrolysis ofd-[3H]Tyr-tRNATyr catalyzed byd-Tyr-tRNATyr deacylase was measured in the presence of 20 mm Tris-HCl (pH 7.8), 50 nmd-[3H]Tyr-tRNATyr, 0.1 mmEDTA, and the indicated components, as described under “Materials and Methods.” Open table in a new tab The activity of the deacylase in the presence of 5 mmMgCl2 was insensitive to the further addition of 0.1 mm various metal ions like CaCl2, CoCl2, MnCl2, or NiCl2. Only ZnCl2 showed a slight stimulatory effect (Table III). The initial rate of hydrolysis by the deacylase was measured at 5 mm MgCl2 as a function ofd-Tyr-tRNATyr concentration. The kinetics were Michaelian, with a K m value of 1.0 ± 0.15 μm and a maximal rate of 6.0 ± 0.5 s−1. Under the same assay conditions, the spontaneous chemical hydrolysis of d-Tyr-tRNATyr occurred at a rate of 2.2 × 10−4 s−1. Addition of uncharged tRNA (K I >20 μm) or of free d-tyrosine (K I >2 mm) had no effect on the enzyme activity. Because several aminoacyl-tRNA synthetases can hydrolyze aminoacyl-tRNAs (24Schreier A.A. Schimmel P.R. Biochemistry. 1972; 11: 1582-1589Crossref PubMed Scopus (140) Google Scholar, 25Bonnet J. Ebel J.P. Eur. J. Biochem. 1972; 31: 335-344Crossref PubMed Scopus (90) Google Scholar, 26Sourgoutchov A. Blanquet S. Fayat G. Waller J.P. Eur. J. Biochem. 1974; 46: 431-438Crossref PubMed Scopus (18) Google Scholar), the AMP-independent deacylation ofd-Tyr-tRNATyr by tyrosyl-tRNA synthetase deserved attention. Nevertheless, this reaction was so slow that, in order to measure initial rates of hydrolysis, synthetase concentrations (0.2–2.5 μm) much higher than thed-Tyr-tRNATyr substrate concentration (50 nm) had to be used in the assay. Michaelis constants of the reaction could be estimated, however, by varying the enzyme concentration in the assay. k cat andK m values of 1.5 × 10−3s−1 and 0.2 μm, respectively, were deduced. Therefore, although d-Tyr-tRNATyr strongly interacts with tyrosyl-tRNA synthetase, its rate of deacylation by this enzyme remains slow, being only 7-fold faster than that of spontaneous chemical hydrolysis. d-Tyr-tRNATyr deacylase and peptidyl-tRNA hydrolase recognize an ester linkage between the 3′-terminal adenosine of tRNA and the carboxyl group of an amino acid. Nevertheless, d-Tyr-tRNATyr deacylase does not hydrolyze l-aminoacyl-tRNAs, on the one hand (7Calendar R. Berg P. J. Mol. Biol. 1967; 26: 39-54Crossref PubMed Scopus (118) Google Scholar), and peptidyl-tRNA hydrolase is specific forN-blocked-l-amino acids, on the other hand (8Kössel H. RajBhandary U.L. J. Mol. Biol. 1968; 35: 539-560Crossref PubMed Scopus (83) Google Scholar). By using d-Tyr-tRNATyr,l-Tyr-tRNATyr,N-acetyl-d-Tyr-tRNATyr, orN-acetyl-l-Tyr-tRNATyr as substrates, these specificities could be confirmed (TableIV). In particular, N-blockedd- or l-aminoacylated tRNAs fully resisted the action of d-Tyr-tRNATyr deacylase (TableIV).Table IVSubstrate specificities of E. coli d-Tyr-tRNA Tyrdeacylase and peptidyl-tRNA hydrolaseSubstrateCatalytic efficiencyaInitial rates of hydrolysis were measured in the presence of 20 mm Tris-HCl (pH 7.8), 50 nmd-[3H]Tyr-tRNATyr, 5 mmMgCl2, 0.1 mm EDTA, 10 mm2-mercaptoethanol, and 50 nm of the substrate under study (see “Materials and Methods”).d-Tyr-tRNATyr deacylasePeptidyl-tRNA hydrolaseμm −1 s −1d-Tyr-tRNATyr60.016l-Tyr-tRNATyr<10−30.006N-Acetyl-d-Tyr-tRNATyr<10−30.003N-Acetyl-l-Tyr-tRNATyr<10−30.47a Initial rates" @default.
• W2004607722 created "2016-06-24" @default.
• W2004607722 creator A5010841814 @default.
• W2004607722 creator A5021002222 @default.
• W2004607722 creator A5036765563 @default.
• W2004607722 creator A5049241669 @default.
• W2004607722 creator A5086640603 @default.
• W2004607722 date "1999-07-01" @default.
• W2004607722 modified "2023-09-27" @default.
• W2004607722 title "Functional Characterization of thed-Tyr-tRNATyr Deacylase from Escherichia coli" @default.
• W2004607722 cites W106913089 @default.
• W2004607722 cites W1480359933 @default.
• W2004607722 cites W1510119324 @default.
• W2004607722 cites W1529004731 @default.
• W2004607722 cites W1537929971 @default.
• W2004607722 cites W1567969231 @default.
• W2004607722 cites W1593930326 @default.
• W2004607722 cites W1891018901 @default.
• W2004607722 cites W1910590028 @default.
• W2004607722 cites W1969019274 @default.
• W2004607722 cites W1986491368 @default.
• W2004607722 cites W1988858733 @default.
• W2004607722 cites W2011366418 @default.
• W2004607722 cites W2012058033 @default.
• W2004607722 cites W2013200026 @default.
• W2004607722 cites W2015254205 @default.
• W2004607722 cites W2032509520 @default.
• W2004607722 cites W2038480690 @default.
• W2004607722 cites W2043337626 @default.
• W2004607722 cites W2044453264 @default.
• W2004607722 cites W2049504572 @default.
• W2004607722 cites W2051138854 @default.
• W2004607722 cites W2053058161 @default.
• W2004607722 cites W2072015109 @default.
• W2004607722 cites W2073046685 @default.
• W2004607722 cites W2086235901 @default.
• W2004607722 cites W2088195434 @default.
• W2004607722 cites W2089269422 @default.
• W2004607722 cites W2095234115 @default.
• W2004607722 cites W2100837269 @default.
• W2004607722 cites W2131852149 @default.
• W2004607722 cites W2152474778 @default.
• W2004607722 cites W2153233279 @default.
• W2004607722 cites W2158714788 @default.
• W2004607722 cites W2161524167 @default.
• W2004607722 cites W4240849703 @default.
• W2004607722 cites W66531461 @default.
• W2004607722 cites W956849783 @default.
• W2004607722 doi "https://doi.org/10.1074/jbc.274.27.19109" @default.
• W2004607722 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10383414" @default.
• W2004607722 hasPublicationYear "1999" @default.
• W2004607722 type Work @default.
• W2004607722 sameAs 2004607722 @default.
• W2004607722 citedByCount "61" @default.
• W2004607722 countsByYear W20046077222013 @default.
• W2004607722 countsByYear W20046077222015 @default.
• W2004607722 countsByYear W20046077222016 @default.
• W2004607722 countsByYear W20046077222017 @default.
• W2004607722 countsByYear W20046077222018 @default.
• W2004607722 countsByYear W20046077222019 @default.
• W2004607722 countsByYear W20046077222020 @default.
• W2004607722 countsByYear W20046077222022 @default.
• W2004607722 crossrefType "journal-article" @default.
• W2004607722 hasAuthorship W2004607722A5010841814 @default.
• W2004607722 hasAuthorship W2004607722A5021002222 @default.
• W2004607722 hasAuthorship W2004607722A5036765563 @default.
• W2004607722 hasAuthorship W2004607722A5049241669 @default.
• W2004607722 hasAuthorship W2004607722A5086640603 @default.
• W2004607722 hasBestOaLocation W20046077221 @default.
• W2004607722 hasConcept C104317684 @default.
• W2004607722 hasConcept C171250308 @default.
• W2004607722 hasConcept C185592680 @default.
• W2004607722 hasConcept C192562407 @default.
• W2004607722 hasConcept C2780841128 @default.
• W2004607722 hasConcept C547475151 @default.
• W2004607722 hasConcept C55493867 @default.
• W2004607722 hasConcept C70721500 @default.
• W2004607722 hasConcept C86803240 @default.
• W2004607722 hasConceptScore W2004607722C104317684 @default.
• W2004607722 hasConceptScore W2004607722C171250308 @default.
• W2004607722 hasConceptScore W2004607722C185592680 @default.
• W2004607722 hasConceptScore W2004607722C192562407 @default.
• W2004607722 hasConceptScore W2004607722C2780841128 @default.
• W2004607722 hasConceptScore W2004607722C547475151 @default.
• W2004607722 hasConceptScore W2004607722C55493867 @default.
• W2004607722 hasConceptScore W2004607722C70721500 @default.
• W2004607722 hasConceptScore W2004607722C86803240 @default.
• W2004607722 hasIssue "27" @default.
• W2004607722 hasLocation W20046077221 @default.
• W2004607722 hasOpenAccess W2004607722 @default.
• W2004607722 hasPrimaryLocation W20046077221 @default.
• W2004607722 hasRelatedWork W1797475586 @default.
• W2004607722 hasRelatedWork W2017285598 @default.
• W2004607722 hasRelatedWork W2050917233 @default.
• W2004607722 hasRelatedWork W2080910126 @default.
• W2004607722 hasRelatedWork W2110293199 @default.
• W2004607722 hasRelatedWork W2949911667 @default.
• W2004607722 hasRelatedWork W2951449457 @default.

• next