FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2005648469> ?p ?o ?g. }

• W2005648469 endingPage "12667" @default.
• W2005648469 startingPage "12659" @default.
• W2005648469 abstract "Internally located, cis-acting RNA replication elements, termed cres, are essential for replication of the genomes of picornaviruses such as human rhinovirus 14 (HRV-14) and poliovirus because they template uridylylation of the protein primer, VPg, by the polymerase 3Dpol. These cres form stem-loop structures sharing a common loop motif, and the HRV-14 cre can substitute functionally for the poliovirus cre in both uridylylation in vitro and RNA replication in vivo. We show, however, that the poliovirus cre is unable to support HRV-14 RNA replication. This lack of complementation maps to the stem of the poliovirus cre and was reversed by single nucleotide substitutions in the stem as well as the base of the loop. Replication-competent, revertant viruses rescued from dicistronic HRV-14 RNAs containing the poliovirus cre, or a chimeric cre containing the poliovirus stem, contained adaptive amino acid substitutions. These mapped to the surface of both the polymerase 3Dpol, at the tip of the “thumb” domain, and the protease 3Cpro, on the side opposing the active site and near the end of an extended strand segment implicated previously in RNA binding. These mutations substantially enhanced replication competence when introduced into HRV-14 RNAs containing the poliovirus cre, and they were additive in their effects. The data support a model in which 3CD or its derivatives 3Cpro and 3Dpol interact directly with the stem of the cre during uridylylation of VPg. Internally located, cis-acting RNA replication elements, termed cres, are essential for replication of the genomes of picornaviruses such as human rhinovirus 14 (HRV-14) and poliovirus because they template uridylylation of the protein primer, VPg, by the polymerase 3Dpol. These cres form stem-loop structures sharing a common loop motif, and the HRV-14 cre can substitute functionally for the poliovirus cre in both uridylylation in vitro and RNA replication in vivo. We show, however, that the poliovirus cre is unable to support HRV-14 RNA replication. This lack of complementation maps to the stem of the poliovirus cre and was reversed by single nucleotide substitutions in the stem as well as the base of the loop. Replication-competent, revertant viruses rescued from dicistronic HRV-14 RNAs containing the poliovirus cre, or a chimeric cre containing the poliovirus stem, contained adaptive amino acid substitutions. These mapped to the surface of both the polymerase 3Dpol, at the tip of the “thumb” domain, and the protease 3Cpro, on the side opposing the active site and near the end of an extended strand segment implicated previously in RNA binding. These mutations substantially enhanced replication competence when introduced into HRV-14 RNAs containing the poliovirus cre, and they were additive in their effects. The data support a model in which 3CD or its derivatives 3Cpro and 3Dpol interact directly with the stem of the cre during uridylylation of VPg. The picornaviruses comprise a large and relatively diverse family of viruses that includes many animal and human pathogens (1Racaniello V.R. Knipe D.M. Howley P.M. Picornaviridae: The Viruses and Their Replication. Lippincott Williams & Wilkins, New York2001: 685-722Google Scholar). These are small, nonenveloped, positive-strand RNA viruses that are currently classified into nine genera, two of which, the enteroviruses and rhinoviruses, are particularly closely related in terms of their genome organization, nucleotide and protein sequences, protein processing pattern, and protein function (2Regenmortel M.H.V. Fauquet C.M. Bishop D.L. Carstens E.B. Estes M.K. Lemon S.M. Maniloff J. Mayo M.A. McGeogh D.J. Pringle R.B. Wickner R.B. Virus Taxonomy: The Classification and Nomenclature of Viruses. Academic Press, San Diego2000: 657-683Google Scholar). Their single-strand RNA genomes contain only one open reading frame, encoding a large polyprotein that undergoes co- and post-translational cleavage into a series of structural proteins that comprise the viral capsid (VP4, VP2, VP3, and VP1) and nonstructural proteins involved in replication of the viral genome (2A, 2B, 2C, 3A, 3B, and 3Cpro and 3Dpol). Of these, 3Cpro is a cysteine protease that mediates most processing events within the polyprotein, whereas 3Dpol is the catalytic core of the viral replicase, the RNA-dependent RNA polymerase. Importantly, some precursor proteins, such as the uncleaved precursor of the viral protease and polymerase, 3CD, have functions in protein processing and replication that are distinct from those of the fully processed, mature proteins (3Harris K.S. Reddigari S.R. Nicklin M.J. Hammerle T. Wimmer E. J. Virol. 1992; 66: 7481-7489Crossref PubMed Google Scholar).cis-Acting RNA signals and their interacting protein partners are essential for replication of picornaviruses. A cloverleaf structure at the 5′-terminus of the 5′-nontranslated RNA (5′-NTR) 1The abbreviations used are: NTR, nontranslated region; cre, cis-acting RNA replication element; HRV, human rhinovirus; IRES, internal ribosomal entry site sequence; Luc, luciferase; PV, poliovirus. 1The abbreviations used are: NTR, nontranslated region; cre, cis-acting RNA replication element; HRV, human rhinovirus; IRES, internal ribosomal entry site sequence; Luc, luciferase; PV, poliovirus. segment acts in cis to promote the synthesis of viral RNA. 3CD and a cellular protein, poly(rC)-binding protein, form a ternary ribonucleoprotein complex with the cloverleaf RNA (4Xiang W. Harris K.S. Alexander L. Wimmer E. J. Virol. 1995; 69: 3658-3667Crossref PubMed Google Scholar, 5Leong L.E. Walker P.A. Porter A.G. J. Biol. Chem. 1993; 268: 25735-25739Abstract Full Text PDF PubMed Google Scholar, 6Harris K.S. Xiang W. Alexander L. Lane W.S. Paul A.V. Wimmer E. J. Biol. Chem. 1994; 269: 27004-27014Abstract Full Text PDF PubMed Google Scholar, 7Gamarnik A.V. Andino R. J. Virol. 2000; 74: 2219-2226Crossref PubMed Scopus (184) Google Scholar, 8Andino R. Rieckhof G.E. Trono D. Baltimore D. J. Virol. 1990; 64: 607-612Crossref PubMed Google Scholar, 9Andino R. Rieckhof G.E. Baltimore D. Cell. 1990; 63: 369-380Abstract Full Text PDF PubMed Scopus (378) Google Scholar, 10Andino R. Rieckhof G.E. Achacoso P.L. Baltimore D. EMBO J. 1993; 12: 3587-3598Crossref PubMed Scopus (407) Google Scholar). This ribonucleoprotein complex plays a critical role in viral RNA replication. It appears to interact with a second cellular protein, poly(A)-binding protein, which binds to the poly(A) sequence at the 3′-end of the genome, forming a protein bridge leading to circularization of the genome and mediating the initiation of negative-strand RNA synthesis (11Herold J. Andino R. Mol. Cell. 2001; 7: 581-591Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar).Conserved RNA structures within the 3′-NTR of enteroviruses and rhinoviruses are also important for efficient negative-strand RNA synthesis (12Melchers W.J. Hoenderop J.G. Bruins Slot H.J. Pleij C.W. Pilipenko E.V. Agol V.I. Galama J.M. J. Virol. 1997; 71: 686-696Crossref PubMed Google Scholar, 13Mirmomeni M.H. Hughes P.J. Stanway G. J. Virol. 1997; 71: 2363-2370Crossref PubMed Google Scholar, 14Pilipenko E.V. Poperechny K.V. Maslova S.V. Melchers W.J. Slot H.J. Agol V.I. EMBO J. 1996; 15: 5428-5436Crossref PubMed Scopus (109) Google Scholar, 15Rohll J.B. Moon D.H. Evans D.J. Almond J.W. J. Virol. 1995; 69: 7835-7844Crossref PubMed Google Scholar). In common with the 5′-cloverleaf, the 3′-NTR interacts with both cellular and viral proteins, forming a ribonucleoprotein complex that facilitates RNA synthesis (13Mirmomeni M.H. Hughes P.J. Stanway G. J. Virol. 1997; 71: 2363-2370Crossref PubMed Google Scholar, 16Mellits K.H. Meredith J.M. Rohll J.B. Evans D.J. Almond J.W. J. Gen. Virol. 1998; 79: 1715-1723Crossref PubMed Scopus (31) Google Scholar, 17Meredith J.M. Rohll J.B. Almond J.W. Evans D.J. J. Virol. 1999; 73: 9952-9958Crossref PubMed Google Scholar, 18Todd S. Nguyen J.H. Semler B.L. J. Virol. 1995; 69: 3605-3614Crossref PubMed Google Scholar). However, because deletion of the 3′-NTR does not completely abolish viral RNA replication, the structured 3′-NTR segment of the genome is not absolutely essential for viral replication (19Todd S. Towner J.S. Brown D.M. Semler B.L. J. Virol. 1997; 71: 8868-8874Crossref PubMed Google Scholar).Internally located, picornaviral cis-acting replication elements (cres) were first discovered within human rhinovirus 14 (HRV-14) RNA (20McKnight K.L. Lemon S.M. J. Virol. 1996; 70: 1941-1952Crossref PubMed Google Scholar, 21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar). The minimal active HRV-14 cre consists of a simple 33-nucleotide stem-loop structure located within the P1 segment of the genomic RNA (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar). Although this RNA signal is located within the polyprotein (VP1) coding sequence, its role in RNA replication is independent of its protein coding function (20McKnight K.L. Lemon S.M. J. Virol. 1996; 70: 1941-1952Crossref PubMed Google Scholar, 21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar). Similar replication elements have since been found in the protein coding sequences of other picornaviruses, including Theiler's murine encephalitis virus, a member of the cardiovirus genus (within the VP2 coding sequence) (23Lobert P.E. Escriou N. Ruelle J. Michiels T. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11560-11565Crossref PubMed Scopus (97) Google Scholar), poliovirus (2C sequence) (24Goodfellow I. Chaudhry Y. Richardson A. Meredith J. Almond J.W. Barclay W. Evans D.J. J. Virol. 2000; 74: 4590-4600Crossref PubMed Scopus (199) Google Scholar), and HRV-2 (2A sequence) (25Gerber K. Wimmer E. Paul A.V. J. Virol. 2001; 75: 10979-10990Crossref PubMed Scopus (81) Google Scholar). More recently, a functionally related cre was identified in the 5′-NTR of foot-and-mouth disease virus (26Mason P.W. Bezborodova S.V. Henry T.M. J. Virol. 2002; 76: 9686-9694Crossref PubMed Scopus (120) Google Scholar). This observation and earlier studies with the poliovirus (PV) and HRV-14 cres (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar, 27Goodfellow I.G. Kerrigan D. Evans D.J. RNA (N. Y.). 2003; 9: 124-137Crossref PubMed Scopus (57) Google Scholar, 28Yin J. Paul A.V. Wimmer E. Rieder E. J. Virol. 2003; 77: 5152-5166Crossref PubMed Scopus (71) Google Scholar) indicate that the function of these elements is relatively if not entirely independent of their position within the genome.Early observations with the HRV-14 cre indicated that the element could not be trans-complemented in infected cells and suggested an essential role for the cre in the initiation of negative-strand RNA synthesis (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar, 23Lobert P.E. Escriou N. Ruelle J. Michiels T. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11560-11565Crossref PubMed Scopus (97) Google Scholar). However, more recent studies using cell-free translation-replication systems suggest that the cre is not required for negative-strand RNA synthesis and implicate a primary role for the cre in positive-strand synthesis (30Morasco B.J. Sharma N. Parilla J. Flanegan J.B. J. Virol. 2003; 77: 5136-5144Crossref PubMed Scopus (79) Google Scholar, 31Murray K.E. Barton D.J. J. Virol. 2003; 77: 4739-4750Crossref PubMed Scopus (108) Google Scholar). Further work will be required to reconcile these differences.Picornaviral RNA synthesis is primer-dependent, with the primer for both negative- and positive-strand RNA synthesis likely to be a uridylylated form of a small viral protein, VPg (3B), which is normally found covalently linked to the 5′-terminal nucleotide of the genomic RNA (32Lee Y.F. Nomoto A. Detjen B.M. Wimmer E. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 59-63Crossref PubMed Scopus (272) Google Scholar, 33Flanegan J.B. Petterson R.F. Ambros V. Hewlett N.J. Baltimore D. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 961-965Crossref PubMed Scopus (202) Google Scholar). Studies by Paul and colleagues (34Paul A.V. van Boom J.H. Filippov D. Wimmer E. Nature. 1998; 393: 280-284Crossref PubMed Scopus (297) Google Scholar, 35Paul A.V. Rieder E. Kim D.W. van Boom J.H. Wimmer E. J. Virol. 2000; 74: 10359-10370Crossref PubMed Scopus (236) Google Scholar) suggest that the PV cre acts as a template for the uridylylation of VPg to VPg-pUpU by the 3Dpol polymerase, thereby providing the primer for viral RNA synthesis. The capacity of HRV-14 cre mutants to support RNA replication in vivo correlates strongly with their ability to function as template for VPg uridylylation in vitro (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar), suggesting that the role of the cre in VPg uridylylation is likely to be central to its function in viral RNA replication. The addition of 3Cpro or its precursor 3CD to such in vitro reactions significantly enhances the uridylylation of VPg (28Yin J. Paul A.V. Wimmer E. Rieder E. J. Virol. 2003; 77: 5152-5166Crossref PubMed Scopus (71) Google Scholar, 35Paul A.V. Rieder E. Kim D.W. van Boom J.H. Wimmer E. J. Virol. 2000; 74: 10359-10370Crossref PubMed Scopus (236) Google Scholar, 36Pathak H.B. Ghosh S.K. Roberts A.W. Sharma S.D. Yoder J.D. Arnold J.J. Gohara D.W. Barton D.J. Paul A.V. Cameron C.E. J. Biol. Chem. 2002; 277: 31551-31562Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar), suggesting that the 3CD precursor may also interact functionally with the cre RNA.Interestingly, despite considerable differences in nucleotide sequence and predicted secondary structure, the HRV-14 cre can functionally replace the PV cre in cell-free uridylylation reactions mediated by the PV 3Dpol and 3CD proteins (25Gerber K. Wimmer E. Paul A.V. J. Virol. 2001; 75: 10979-10990Crossref PubMed Scopus (81) Google Scholar, 35Paul A.V. Rieder E. Kim D.W. van Boom J.H. Wimmer E. J. Virol. 2000; 74: 10359-10370Crossref PubMed Scopus (236) Google Scholar). This is consistent with the existence of a common motif within the apical loop segment of the rhinovirus and enterovirus cres and its proposed role in VPg uridylyation (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar). Here we describe experiments that investigate further the functional exchangeability of these two cres. Surprisingly, when we replaced the HRV-14 cre with the PV cre, it failed to support the replication of either a subgenomic HRV-14 replicon or a recombinant dicistronic virus. We mapped this lack of complementation to the stem of the PV cre and present evidence indicating that the structure of the stem plays a critical role in cre function. We also describe point mutations within the HRV-14 3Cpro protease and 3Dpol polymerase proteins which partially rescue the ability of the PV cre to support HRV-14 RNA replication. These results suggest that the cre RNA interacts directly with the 3Cpro protease and 3Dpol polymerase, or the 3CD precursor protein, and indicate that this interaction is vital for viral RNA replication.EXPERIMENTAL PROCEDURESConstruction of Plasmids—The plasmids pΔP1Luc-PVcre, ΔP1Luc-PVstm and ΔP1Luc-PVlp were constructed by ligating oligonucleotides representing the PV cre or HRV-14/PV chimeric cre sequences into pΔP1Luc-Δcre (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar) after it had been digested with XhoI and NheI restriction endonucleases (Fig. 1). Recombinant dicistronic HRV-14 viral genomes were generated by modification of WREP23, a dicistronic HRV-14 genome in which the encephalomyocarditis virus internal ribosomal entry site sequence (IRES) is inserted at the P1-P2 junction (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar). The native cre sequence located within the VP1 coding region was mutated by QuikChange site-directed mutagenesis (Stratagene) using the following oligonucleotides: (+), GCACTCACTGAAGGTTTGGGAGACGAGTTGGAGGAGGTTATTGTCGAAAAGACTAAGCAAACCGTTGCGTCCATATCCTCAGGTCCAAAACACACAC; and (-), GTGTGTGTTTTGGACCTGAGGATATGGACGCAACGGTTTGCTTAGTCTTTTCGACAATAACCTCCTCCAACTCGTCTCCCAAACCTTCAGTGAGTGC. XhoI and NheI restriction enzyme sites were engineered immediately downstream of the stop codon following the first cistron in the dicistronic construct using site-directed mutagenesis (QuikChange). The HRV-14 cre, PV cre, and HRV-14/PV chimeric cre sequences were inserted between these sites, resulting in pWR-HRV14cre, pWR-PVcre, and pWR-PVstm, respectively (Fig. 1). All regions subjected to PCR mutagenesis were sequenced to ensure that no additional mutations were introduced.Cells—HeLa cells were obtained from the American Type Culture Collection and maintained as described previously (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar).Computer-based Prediction of RNA Secondary Structure—RNA secondary structure was predicted using the MFOLD program with the Zuker energy minimization algorithm (www.bioinfo.rpi.edu/applications/mfold).In Vitro RNA Transcription—To produce replicon or dicistronic viral RNA transcripts, plasmids were linearized at the unique MluI restriction site downstream of the 3′-viral poly(A) sequence. RNA transcripts were synthesized by T7 polymerase-mediated transcription (T7 ME-GAscript, Ambion). The integrity and yield of the transcribed RNAs were determined by agarose gel electrophoresis.Rescue and Analysis of Revertant Viruses—HeLa cells were transfected with 5 μg of dicistronic RNA transcript using a GenePulser II electroporation apparatus (Bio-Rad) as described previously (20McKnight K.L. Lemon S.M. J. Virol. 1996; 70: 1941-1952Crossref PubMed Google Scholar). Viruses were recovered from transfected cells by picking well separated plaques followed by disruption of cells by repeated freeze-thaw cycles. Plaque harvests were passaged in HeLa cell cultures in 35-mm dishes. Viruses (cells and supernatant) were harvested before the cytopathic effect was complete and used as stocks for analysis of genotype and phenotype. For genotyping, viral RNA was isolated from cell lysates using TriZol® reagent (Invitrogen). First-strand cDNA synthesis was carried out with the ThermoScript™ reverse transcription-PCR system (Invitrogen), and cDNA was amplified with Platinum® Pfx DNA polymerase (Invitrogen) utilizing HRV-14-specific oligonucleotide primers. Purified amplimers were sequenced directly on an ABI 373L sequencer.Replicon RNA Amplification Assays—HeLa cells were transfected with replicon RNA transcripts as described previously (36Pathak H.B. Ghosh S.K. Roberts A.W. Sharma S.D. Yoder J.D. Arnold J.J. Gohara D.W. Barton D.J. Paul A.V. Cameron C.E. J. Biol. Chem. 2002; 277: 31551-31562Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar), seeded into 6-well plates, and cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum at 34 °C. Cell lysates were harvested by the addition of 125 ml of passive lysis buffer (Promega) to each well and stored at -70 °C until assayed for enzymatic activity. Luciferase activity was quantified using the Luciferase Assay System (Promega) as described by the supplier, with results determined using a TD-20/20 luminometer (Turner Designs).Molecular Display and Modeling—Protein structures were displayed and modeled using Swiss-PDB Viewer (37Guex N. Peitsch M.C. Electrophoresis. 1997; 18: 2714-2723Crossref PubMed Scopus (9472) Google Scholar).RESULTSThe PV cre Does Not Support Replication of an HRV-14 Subgenomic Replicon—Although apparently sharing similar functions in replication, the cres identified in rhinoviruses and enteroviruses differ in their genomic location, primary sequence, and predicted secondary structure. Nonetheless, a detailed mutational analysis, coupled with the comparison of known and suspected cre sequences, has suggested the existence of a conserved sequence motif within the apical loop segment of the rhinovirus and enterovirus cres: RNNNAARNNNNNNR (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar). The conserved purines within this motif cannot be changed without loss of replication competence in the context of a subgenomic HRV-14 replicon (Fig. 1A), and each is present within the cre elements of HRV-14 and PV (Fig. 1B). Single nucleotide substitutions at the intervening positions have little or no effect on replication of HRV-14 RNA (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar). The shared cre loop motif may be sufficient for functional equivalence of these cres because the HRV-14 cre is able to substitute for the PV cre as a template for in vitro VPg uridylylation catalyzed by PV enzymes (35Paul A.V. Rieder E. Kim D.W. van Boom J.H. Wimmer E. J. Virol. 2000; 74: 10359-10370Crossref PubMed Scopus (236) Google Scholar). In further support of this hypothesis, insertion of the HRV-14 cre rescued the replication competence of both PV and a PV subgenomic replicon containing a lethal mutation within the native PV cre (28Yin J. Paul A.V. Wimmer E. Rieder E. J. Virol. 2003; 77: 5152-5166Crossref PubMed Scopus (71) Google Scholar).To determine whether the converse is also true and whether the PV cre is able to substitute for the HRV-14 cre in rhinovirus RNA replication, we replaced the HRV-14 cre present in the subgenomic replicon, ΔP1Luc-HRV14cre (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar) (previously designated ΔP1LucCRE), with the PV cre. ΔP1Luc-HRV14cre is a subgenomic replicon in which most of the HRV-14 P1 segment has been replaced by the firefly luciferase coding sequence, with the HRV-14 cre inserted between the luciferase and P2 coding regions (Fig. 1A) (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar). The replication of this RNA can be monitored accurately by measuring luciferase activity after transfection of HeLa cells. An increase in luciferase activity between 3 and 24 h after transfection is indicative of viral RNA replication and is not observed in the presence of guanidine, a potent inhibitor of HRV-14 RNA replication (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar).To test for replication competence, replicon transcripts containing the PV cre in lieu of the HRV 14 cre, designated ΔP1Luc-PVcre (Fig. 1, A and B), were transfected into HeLa cells. Control cells were transfected with the parental replicon, ΔP1Luc-HRVcre, or a cre-deficient replicon, ΔP1Luc-Δcre (previously designated ΔP1LucXN) (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar). Surprisingly, transfection of the ΔP1Luc-PVcre transcripts gave rise to only minimal luciferase activity, with no significant increase between 3 and 24 h post-transfection (Fig. 2). Luciferase expression was not increased above that observed after transfection of ΔP1Luc-Δcre RNA (which contains no cre sequence) and thus represented only translation of the input RNA. In contrast, the amount of luciferase expressed by the replicon containing the wild-type HRV-14 cre, ΔP1Luc-HRV14cre, increased ∼100-fold between 3 and 24 h post-transfection (Fig. 2). These results indicate that the PV cre is incompatible with the HRV-14 genome and that either its sequence or structure does not allow an efficient interaction with other components of the HRV-14 RNA replication complex.Fig. 2Luciferase expression as a measure of HRV-14 replicon RNA replication in transfected HeLa cells. Bars represent the -fold increase in expressed luciferase activity between 3 and 24 h post-transfection in triplicate cultures of cells transfected with ΔP1Luc-HRV14cre, -Δcre, -PVcre, -PVlp, and -PVstm RNAs. ΔP1Luc-Δcre contains no cre sequence and was used as a negative control in all assays.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To determine which domain of the PV cre, the loop or the stem, might be responsible for this incompatibility, we constructed two additional replicons containing chimeric cres, one with the loop sequence of the PVcre fused to the HRV-14 stem (designated PVlp, Fig. 1B), and the other containing the HRV-14 loop fused to the PV stem (PVstm, Fig. 1B). HRV-14 replicons containing these chimeric cres were designated ΔP1Luc-PVlp and ΔP1Luc-PVstm, respectively. Transfection of ΔP1Luc-PVlp RNA into HeLa cells led to a significant increase in luciferase activity between 3 and 24 h after transfection (Fig. 2). This result demonstrates the replication competence of ΔP1Luc-PVlp RNA, although the expressed luciferase activity (and thus the efficiency of RNA replication) was significantly reduced compared with ΔP1Luc-HRV14cre. In contrast, transfection of ΔP1Luc-PVstm transcripts into HeLa cells resulted in no increase in luciferase activity (Fig. 2), indicating a lack of RNA replication competence. These results demonstrate that the PV cre loop is partially, but not completely, functionally exchangeable with the HRV-14 cre loop and that the stem of the PV cre is the major determinant of the incompatibility that exists between the PV and HRV-14 cre. Although these results support the validity of the RNNNAARNNNNNNR loop motif proposed previously (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar), they also show that the sequence and/or structure of the cre stem is important determinant(s) for replication.Rescue of Revertant Dicistronic HRV-14 Viruses Containing Replication-defective cres—To characterize further the nature of the restriction underlying the lack of detectable replicon amplification when the HRV-14 cre was replaced by the PV cre, we placed the PV cre (and the chimeric PVstm and PVlp cres described above) within the sequence of a recombinant dicistronic HRV-14 virus (see below) in which the native HRV-14 cre was functionally knocked out by multiple silent nucleotide substitutions. We transfected these RNAs into HeLa cells and then sought evidence for replication-competent revertant viruses that might have accumulated mutations that reversed or compensated for the restriction posed by the PV cre. Our hypothesis was that the location and nature of these compensatory mutations would shed light on why the PV cre is unable to function efficiently within the HRV-14 background.Because the HRV-14 cre is located within the P1 coding region, simply replacing its sequence with the ∼60-nucleotide PV cre sequence would alter the HRV-14 capsid protein sequence and most likely prevent virion formation. To overcome this problem, we utilized a previously described dicistronic virus, WREP23 (21McKnight K.L. Lemon S.M. RNA (N. Y.). 1998; 4: 1569-1584Crossref PubMed Scopus (135) Google Scholar), which contains the encephalomyocarditis virus IRES inserted into the open reading frame of HRV-14 at the P1-P2 junction (Fig. 3A). The translation of the first cistron, encoding the HRV-14 capsid proteins, is thus under the control of the HRV-14 IRES, whereas translation of the second cistron, encoding the nonstructural proteins 2A-3D, is initiated by the encephalomyocarditis virus IRES. This allows for the placement of a foreign cre sequence near the center of the HRV-14 genome, between the HRV-14 P1 segment and encephalomyocarditis virus IRES sequence, in a context in which it will not alter the sequence of any expressed HRV-14 protein (Fig. 3A). To knock out the native P1 cre in WREP23, nucleotide substitutions were introduced at the third position of each of 23 amino acid codons encompassing the HRV-14 cre sequence (see “Experimental Procedures”). These 23 substitutions, spanning 69 nucleotides, include an A to G substitution at one of the critical purine positions, 2368A→G in the HRV-14 cre loop motif (22Yang Y. Rijnbrand R. McKnight K.L. Wimmer E. Paul A. Martin A. Lemon S.M. J. Virol. 2002; 76: 7485-7494Crossref PubMed Scopus (66) Google Scholar), but they do not alter the encoded amino acid sequence of VP1. An MFOLD-assisted RNA structure prediction showed complete disruption of the HRV-14 P1 cre structure in this mutant (data not shown).Fig. 3A, schematic of recombinant, dicistronic HRV-14 genomes. The native HRV-14 cre located within the VP1 coding sequence was knocked out by 23 silent nucleotide substitutions. Following a stop codon at the 3′-end of the first cistron, the HRV-14cre, PVcre, PVstm, and PVlp chimeric cres were inserted between two engineered enzyme sites, XhoI and NheI, resulting in the recombinant dicistronic viral genomes WR-HRV14cre, WR-PVcre, WR-PVstm, and WR-PVlp, respectively. WR-Δcre contained no cre sequence and was utilized as a negative control. B,5 μg of each RNA transcript was transfected into HeLa cells by electroporation. Transfected cells were diluted 100- and 1,000-fold and plated on HeLa cell monolayers. Plaques were visualized at 72 h by staining with crystal violet. The transfected recombinant dicistronic viral RNAs are indicated by the cre they c" @default.
• W2005648469 created "2016-06-24" @default.
• W2005648469 creator A5017815970 @default.
• W2005648469 creator A5026233059 @default.
• W2005648469 creator A5040263014 @default.
• W2005648469 creator A5081774736 @default.
• W2005648469 date "2004-03-01" @default.
• W2005648469 modified "2023-10-10" @default.
• W2005648469 title "Genetic Evidence for an Interaction between a Picornaviral cis-Acting RNA Replication Element and 3CD Protein" @default.
• W2005648469 cites W1488612195 @default.
• W2005648469 cites W1507189859 @default.
• W2005648469 cites W1537407560 @default.
• W2005648469 cites W1551993542 @default.
• W2005648469 cites W1567952953 @default.
• W2005648469 cites W1571622263 @default.
• W2005648469 cites W1589319697 @default.
• W2005648469 cites W1708364023 @default.
• W2005648469 cites W1840105038 @default.
• W2005648469 cites W1953000208 @default.
• W2005648469 cites W1963620791 @default.
• W2005648469 cites W1971733087 @default.
• W2005648469 cites W1988384977 @default.
• W2005648469 cites W2003326050 @default.
• W2005648469 cites W2006528079 @default.
• W2005648469 cites W2015642465 @default.
• W2005648469 cites W2023355401 @default.
• W2005648469 cites W2060806079 @default.
• W2005648469 cites W2071340590 @default.
• W2005648469 cites W2071460423 @default.
• W2005648469 cites W2093191777 @default.
• W2005648469 cites W2106608879 @default.
• W2005648469 cites W2118410725 @default.
• W2005648469 cites W2118848130 @default.
• W2005648469 cites W2120348672 @default.
• W2005648469 cites W2124220387 @default.
• W2005648469 cites W2125391206 @default.
• W2005648469 cites W2128705009 @default.
• W2005648469 cites W2131522965 @default.
• W2005648469 cites W2132418769 @default.
• W2005648469 cites W2143874472 @default.
• W2005648469 cites W2144538210 @default.
• W2005648469 cites W2145365999 @default.
• W2005648469 cites W2153293128 @default.
• W2005648469 cites W2154914525 @default.
• W2005648469 cites W2159160157 @default.
• W2005648469 cites W2159971283 @default.
• W2005648469 cites W2160743943 @default.
• W2005648469 cites W2182724516 @default.
• W2005648469 doi "https://doi.org/10.1074/jbc.m312992200" @default.
• W2005648469 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14711816" @default.
• W2005648469 hasPublicationYear "2004" @default.
• W2005648469 type Work @default.
• W2005648469 sameAs 2005648469 @default.
• W2005648469 citedByCount "47" @default.
• W2005648469 countsByYear W20056484692014 @default.
• W2005648469 countsByYear W20056484692015 @default.
• W2005648469 countsByYear W20056484692016 @default.
• W2005648469 countsByYear W20056484692017 @default.
• W2005648469 countsByYear W20056484692020 @default.
• W2005648469 countsByYear W20056484692021 @default.
• W2005648469 countsByYear W20056484692023 @default.
• W2005648469 crossrefType "journal-article" @default.
• W2005648469 hasAuthorship W2005648469A5017815970 @default.
• W2005648469 hasAuthorship W2005648469A5026233059 @default.
• W2005648469 hasAuthorship W2005648469A5040263014 @default.
• W2005648469 hasAuthorship W2005648469A5081774736 @default.
• W2005648469 hasBestOaLocation W20056484691 @default.
• W2005648469 hasConcept C104317684 @default.
• W2005648469 hasConcept C12590798 @default.
• W2005648469 hasConcept C159047783 @default.
• W2005648469 hasConcept C54355233 @default.
• W2005648469 hasConcept C67705224 @default.
• W2005648469 hasConcept C86803240 @default.
• W2005648469 hasConceptScore W2005648469C104317684 @default.
• W2005648469 hasConceptScore W2005648469C12590798 @default.
• W2005648469 hasConceptScore W2005648469C159047783 @default.
• W2005648469 hasConceptScore W2005648469C54355233 @default.
• W2005648469 hasConceptScore W2005648469C67705224 @default.
• W2005648469 hasConceptScore W2005648469C86803240 @default.
• W2005648469 hasIssue "13" @default.
• W2005648469 hasLocation W20056484691 @default.
• W2005648469 hasOpenAccess W2005648469 @default.
• W2005648469 hasPrimaryLocation W20056484691 @default.
• W2005648469 hasRelatedWork W1641042124 @default.
• W2005648469 hasRelatedWork W1990804418 @default.
• W2005648469 hasRelatedWork W1993764875 @default.
• W2005648469 hasRelatedWork W2013243191 @default.
• W2005648469 hasRelatedWork W2051339581 @default.
• W2005648469 hasRelatedWork W2082860237 @default.
• W2005648469 hasRelatedWork W2117258802 @default.
• W2005648469 hasRelatedWork W2130076355 @default.
• W2005648469 hasRelatedWork W2151865869 @default.
• W2005648469 hasRelatedWork W4234157524 @default.
• W2005648469 hasVolume "279" @default.
• W2005648469 isParatext "false" @default.
• W2005648469 isRetracted "false" @default.
• W2005648469 magId "2005648469" @default.
• W2005648469 workType "article" @default.