FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2005963486> ?p ?o ?g. }

• W2005963486 endingPage "4504" @default.
• W2005963486 startingPage "4492" @default.
• W2005963486 abstract "Werner syndrome is a premature aging and cancer-prone hereditary disorder caused by deficiency of the WRN protein that harbors 3′ → 5′ exonuclease and RecQ-type 3′ → 5′ helicase activities. To assess the possibility that WRN acts on partially melted DNA intermediates, we constructed a substrate containing a 21-nucleotide noncomplementary region asymmetrically positioned within a duplex DNA fragment. Purified WRN shows an extremely efficient exonuclease activity directed at both blunt ends of this substrate, whereas no activity is observed on a fully duplex substrate. High affinity binding of full-length WRN protects an area surrounding the melted region of the substrate from DNase I digestion. ATP binding stimulates but is not required for WRN binding to this region. Thus, binding of WRN to the melted region underlies the efficient exonuclease activity directed at the nearby ends. In contrast, a WRN deletion mutant containing only the functional exonuclease domain does not detectably bind or degrade this substrate. These experiments indicate a bipartite structure and function for WRN, and we propose a model by which its DNA binding, helicase, and exonuclease activities function coordinately in DNA metabolism. These studies also suggest that partially unwound or noncomplementary regions of DNA could be physiological targets for WRN. Werner syndrome is a premature aging and cancer-prone hereditary disorder caused by deficiency of the WRN protein that harbors 3′ → 5′ exonuclease and RecQ-type 3′ → 5′ helicase activities. To assess the possibility that WRN acts on partially melted DNA intermediates, we constructed a substrate containing a 21-nucleotide noncomplementary region asymmetrically positioned within a duplex DNA fragment. Purified WRN shows an extremely efficient exonuclease activity directed at both blunt ends of this substrate, whereas no activity is observed on a fully duplex substrate. High affinity binding of full-length WRN protects an area surrounding the melted region of the substrate from DNase I digestion. ATP binding stimulates but is not required for WRN binding to this region. Thus, binding of WRN to the melted region underlies the efficient exonuclease activity directed at the nearby ends. In contrast, a WRN deletion mutant containing only the functional exonuclease domain does not detectably bind or degrade this substrate. These experiments indicate a bipartite structure and function for WRN, and we propose a model by which its DNA binding, helicase, and exonuclease activities function coordinately in DNA metabolism. These studies also suggest that partially unwound or noncomplementary regions of DNA could be physiological targets for WRN. Werner syndrome adenosine 5′-O-(3-thiotriphosphate) bovine serum albumin bovine pancreatic deoxyribonuclease I electrophoretic mobility shift assay nucleotide(s) The RecQ helicases are a family of proteins that catalyze the ATP-dependent unwinding of double-stranded nucleic acids (reviewed in Refs. 1Chakraverty R.K. Hickson I.D. Bioessays. 1999; 21: 286-294Crossref PubMed Scopus (196) Google Scholar and 2Shen J.-C. Loeb L.A. Trends Genet. 2000; 16: 213-220Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). There are genes coding for at least five RecQ family members (RECQL, BLM, WRN, RECQ4/RTS, and RECQ5) in the human genome that are highly homologous to one another only within seven distinct sequence motifs that comprise a conserved helicase domain. The hereditary diseases known as Bloom, Werner, and Rothmund-Thomson syndromes are the result of the loss of function of BLM, WRN, or RTS, respectively (3Ellis N.A. Groden J. Ye T.-Z. Straughen J. Lennon D.J. Ciocci S. Proytcheva M. German J. Cell. 1995; 83: 655-666Abstract Full Text PDF PubMed Scopus (1200) Google Scholar, 4Yu C.-E. Oshima J. Fu Y.-H. Wijsman E.M. Hisama F. Alisch R. Matthews S. Nakura J. Miki T. Ouais S. Martin G.M. Mulligan J. Schellenberg G.D. Science. 1996; 272: 258-262Crossref PubMed Scopus (1473) Google Scholar, 5Kitao S. Shimamoto A. Goto M. Miller R.W. Smithson W.A. Lindor N.M. Furuichi Y. Nat. Genet. 1997; 22: 82-84Crossref Scopus (565) Google Scholar). Although genomic instability is common to each of these diseases, the overall phenotype of each disease is different, indicating that the functions of BLM, WRN, and RTS are distinct or at least partially nonoverlapping. Interestingly, WRN is the only human RecQ protein to have an exonuclease domain in addition to the helicase domain (6Mian I.S. Nucleic Acids Res. 1997; 25: 3187-3195Crossref PubMed Scopus (180) Google Scholar). The Werner syndrome (WS)1 phenotype is characterized by early onset of a number of aging characteristics, including graying and loss of hair, increased wrinkling and ulceration of the skin, osteoporosis, atherosclerosis, and an increased frequency of age-related maladies such as cancer, diabetes, and cataracts. WRN-deficient cells from WS patients have elevated levels of genomic instability typified by increased deletions, insertions, and translocations (7Fukuchi K.-I. Martin G.M. Monnat Jr., R.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5893-5897Crossref PubMed Scopus (390) Google Scholar, 8Stefanini M. Scappaticci S. Lagomarsini P. Borroni G. Beranrdesca E. Nuzzo F. Mutat. Res. 1989; 219: 179-185Crossref PubMed Scopus (42) Google Scholar), as well as an accelerated rate of telomere loss (9Schulz V.P. Zakian V.A. Ogburn C.E. McKay J. Jarzebowicz A.A. Edland S.D. Martin G.M. Hum. Genet. 1996; 97: 750-754Crossref PubMed Scopus (208) Google Scholar, 10Tahara H. Tokutake Y. Maeda S. Kataoka H. Watanabe T. Satoh M. Matsumoto T. Sugawara M. Ide T. Goto M. Furuichi Y. Sugimoto M. Oncogene. 1997; 15: 1913-1920Crossref Scopus (123) Google Scholar). Both the WS cellular phenotype and the WRN primary amino acid sequence point to a role in DNA metabolism that, when absent, results in large scale genetic change. A number of laboratories (including ours) have successfully overexpressed and purified a recombinant WRN protein, and its basic catalytic activities have been characterized. Consistent with the presence of ATPase/helicase amino acid sequence motifs in the central region of the protein, WRN is a DNA-dependent ATPase (11Brosh Jr., R.M. Orren D.K. Nehlin J.O. Ravn P.H. Kenny M.K. Machwe A. Bohr V.A. J. Biol. Chem. 1999; 274: 18341-18350Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar). In conjunction with ATP hydrolysis, WRN unwinds DNA-DNA and DNA-RNA duplexes that contain a single-stranded region 3′ to the duplex to be unwound, i.e. 3′ → 5′ directionality (11Brosh Jr., R.M. Orren D.K. Nehlin J.O. Ravn P.H. Kenny M.K. Machwe A. Bohr V.A. J. Biol. Chem. 1999; 274: 18341-18350Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar, 12Gray M.D. Shen J.-C. Kamath-Loeb A.S. Blank A. Sopher B.L. Martin G.M. Oshima J. Loeb L.A. Nat. Genet. 1997; 17: 100-103Crossref PubMed Scopus (515) Google Scholar, 13Shen J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; 26: 2879-2885Crossref PubMed Scopus (181) Google Scholar, 14Suzuki N. Shimamoto A. Imamura O. Kuromitsu J. Kitao S. Goto M. Furuichi Y. Nucleic Acids Res. 1997; 25: 2973-2978Crossref PubMed Scopus (194) Google Scholar). More recently, WRN has also been shown to disrupt DNA triplexes (15Brosh Jr., R.M. Majumdar A. Desai S. Hickson I.D. Bohr V.A. Seidman M.M. J. Biol. Chem. 2001; 276: 3024-3030Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) and certain G-quartet structures (16Fry M. Loeb L.A. J. Biol. Chem. 1999; 274: 12797-12802Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar). WRN helicase can apparently carry out branch migration of Holliday structures as well (17Constantinou A. Tarsounas M. Karow J.K. Brosh R.M. Bohr V.A. Hickson I.D. West S.C. EMBO Rep. 2000; 1: 80-84Crossref PubMed Scopus (335) Google Scholar). In general, studies on WRN, BLM, and Sgs1 (the lone RecQ homolog inSaccharomyces cerevisiae) have shown remarkable similarities in helicase function and DNA substrate specificity (16Fry M. Loeb L.A. J. Biol. Chem. 1999; 274: 12797-12802Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar, 18Karow J.K. Chakraverty R.K. Hickson I.D. J. Biol. Chem. 1997; 272: 30611-30614Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 19Bennett R.J. Sharp J.A. Wang J.C. J. Biol. Chem. 1998; 273: 9644-9650Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar, 20Sun H. Karow J.K. Hickson I.D. Maizels N. J. Biol. Chem. 1998; 273: 27587-27592Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar, 21Sun H. Bennett R.J. Maizels N. Nucleic Acids Res. 1999; 27: 1978-1984Crossref PubMed Scopus (189) Google Scholar, 22Brosh Jr., R.M. Karow J.K. White E.J. Shaw N.D. Hickson I.D. Bohr V.A. Nucleic Acids Res. 2000; 28: 2420-2430Crossref PubMed Scopus (56) Google Scholar, 23Brosh Jr., R.M. Li J.L. Kenny M.K. Karow J.K. Cooper M.C. Kureekattil R.P. Hickson I.D. Bohr V.A. J. Biol. Chem. 2000; 275: 23500-23508Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar, 24Mohaghegh P. Karow J.K. Brosh Jr., R.M. Bohr V.A. Hickson I.D. Nucleic Acids Res. 2001; 29: 2843-2849Crossref PubMed Scopus (476) Google Scholar). WRN has also been shown to be an exonuclease (25Huang S. Li B. Gray M.D. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Crossref PubMed Scopus (372) Google Scholar, 26Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 27Machwe A. Ganunis R. Bohr V.A. Orren D.K. Nucleic Acids Res. 2000; 28: 2762-2770Crossref PubMed Scopus (54) Google Scholar), consistent with the presence of RNase D-type nuclease domains in the N-terminal region of the protein (6Mian I.S. Nucleic Acids Res. 1997; 25: 3187-3195Crossref PubMed Scopus (180) Google Scholar). This activity is directed to the 3′ end of a duplex substrate (3′ → 5′ directionality) preferably containing a 5′ overhang (recessed 3′ end) and has not been observed on single-stranded DNA or double-stranded DNA with blunt ends or 3′ overhangs (25Huang S. Li B. Gray M.D. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Crossref PubMed Scopus (372) Google Scholar, 28Kamath-Loeb A.S. Shen J.-C. Loeb L.A. Fry M. J. Biol. Chem. 1998; 273: 34145-34150Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). On DNA substrates tested thus far, WRN exonuclease activity is dramatically stimulated by ATP hydrolysis (28Kamath-Loeb A.S. Shen J.-C. Loeb L.A. Fry M. J. Biol. Chem. 1998; 273: 34145-34150Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar), suggesting some cooperativity between the ATPase and exonuclease functions of WRN. However, exonuclease activity can be observed in the absence of ATP (28Kamath-Loeb A.S. Shen J.-C. Loeb L.A. Fry M. J. Biol. Chem. 1998; 273: 34145-34150Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar), and mutant WRN proteins lacking either ATPase/helicase activity or the entire helicase domain still retain exonuclease activity (27Machwe A. Ganunis R. Bohr V.A. Orren D.K. Nucleic Acids Res. 2000; 28: 2762-2770Crossref PubMed Scopus (54) Google Scholar), suggesting that the exonuclease and helicase domains are functionally independent and, in all likelihood, physically separate. Importantly, the absence of exonuclease activity in the other human RecQ homologs suggests that the unique WS phenotype may be in part the result of loss of the specific exonuclease function of WRN. In this study, a defined DNA substrate containing an internal region of noncomplementarity was designed to closely approximate the localized melting of DNA duplexes that occurs during many metabolic processes. The DNA binding affinity and catalytic activities of recombinant wild type and mutant WRN proteins were examined on this substrate and compared with other model DNA substrates. We have demonstrated that, when compared with completely complementary substrates, a DNA substrate containing 21 unpaired nucleotides (nt) in both strands has extremely high affinity for the WRN protein. We have further characterized this binding and the effect of nucleotide cofactors by deoxyribonuclease I (DNase I) footprinting. We show that ATP hydrolysis is not required for high affinity binding of WRN to the melted region, and that the exonuclease domain does not bind stably to this substrate. Nevertheless, the WRN exonuclease function is highly active on this bubble substrate, and this activity is both independent of ATP binding or hydrolysis and further unwinding by WRN helicase function. Our results indicate coordination between the DNA binding and exonuclease domains of WRN and suggest that a noncomplementary (heteroduplex) or melted region of DNA could be the physiological substrate of WRN. Such structures may be indicative of DNA replication, recombination, or repair intermediates formed in vivo that require processing by WRN helicase and/or exonuclease activity. Recombinant wild type and mutant WRN proteins were overexpressed and purified essentially as described previously (29Orren D.K. Brosh Jr., R.M. Nehlin J.O. Machwe A. Gray M.D. Bohr V.A. Nucleic Acids Res. 1999; 27: 3557-3566Crossref PubMed Scopus (107) Google Scholar). The WRN-K577M mutant contains a lysine to methionine point mutation at amino acid residue 577 in motif I of the conserved helicase domain; this protein lacks both ATPase and helicase activities (11Brosh Jr., R.M. Orren D.K. Nehlin J.O. Ravn P.H. Kenny M.K. Machwe A. Bohr V.A. J. Biol. Chem. 1999; 274: 18341-18350Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar, 12Gray M.D. Shen J.-C. Kamath-Loeb A.S. Blank A. Sopher B.L. Martin G.M. Oshima J. Loeb L.A. Nat. Genet. 1997; 17: 100-103Crossref PubMed Scopus (515) Google Scholar). The WRN-E84A mutant contains a glutamate to alanine change at residue 84 in the conserved exonuclease domain that abolishes exonuclease activity (25Huang S. Li B. Gray M.D. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Crossref PubMed Scopus (372) Google Scholar). The WRNΔ369–1432 contains only the N-terminal 368 amino acids of the full-length protein; however, this truncated protein possesses the entire conserved exonuclease domains and retains exonuclease activity (27Machwe A. Ganunis R. Bohr V.A. Orren D.K. Nucleic Acids Res. 2000; 28: 2762-2770Crossref PubMed Scopus (54) Google Scholar). The activities of wild type and mutant WRN proteins used in this study are summarized in Table I. All constructs contained an N-terminal hexahistidine tag to facilitate purification by metal (Ni2+) affinity chromatography. Briefly, Spodoptera frugiperda insect cells (Sf9 strain) were infected with baculovirus containing WRN cDNA sequences at an multiplicity of infection of 10 and harvested 72–96 h after infection and stored at −80 °C. The wild type, WRN-K577M, and WRN-E84A proteins were purified by sequential liquid chromatographic steps using DEAE-Sepharose, Q-Sepharose, and nickel-nitrilotriacetic acid-agarose resins (29Orren D.K. Brosh Jr., R.M. Nehlin J.O. Machwe A. Gray M.D. Bohr V.A. Nucleic Acids Res. 1999; 27: 3557-3566Crossref PubMed Scopus (107) Google Scholar). The purification of WRNΔ369–1432 was modified slightly. After cell lysis, WRNΔ369–1432 protein was bound to DEAE-Sepharose in 150 mm Tris-HCl, pH 8.0, 10 mm NaCl, 0.5% Nonidet P-40, 10% glycerol, 5 mm β-mercaptoethanol, 1 mm phenylmethanesulfonyl fluoride, and 2 μg/ml each of pepstatin A, leupeptin, chymostatin, and aprotinin, washed extensively with the same buffer minus Nonidet P-40, and eluted with the same buffer (minus Nonidet P-40) containing 60 mm NaCl. The DEAE eluate was then loaded directly onto and subsequently recovered from nickel-nitrilotriacetic acid resin, using washing and elution conditions identical to those described for full-length WRN proteins. Mock-infected insect cell lysates were purified in parallel to control for potential contaminating activities. All protein preparations were stored with 100 μg/ml bovine serum albumin (BSA) at −80 °C until use.Table ICatalytic properties of wild type and mutant WRN proteinsProteinATP bindingATP hydrolysis3′ → 5′ helicase1-aWRN helicase and exonuclease activities are detectable from 25 to 37 °C, but not at 4 °C.3′ → 5′ exonuclease1-aWRN helicase and exonuclease activities are detectable from 25 to 37 °C, but not at 4 °C.WRN (wild type)++++WRN-K477M−1-bBased on comparison of WRN-K477M DNA binding and exonuclease assays carried out in the presence and absence of ATP, although actual ATP binding studies for this protein have not been done.−−+WRN-E84A+++−WRNΔ369–1432−1-cThis protein lacks the consensus nucleotide binding/hydrolysis domains present in RecQ homologs and presumably cannot bind or hydrolyze ATP.−1-cThis protein lacks the consensus nucleotide binding/hydrolysis domains present in RecQ homologs and presumably cannot bind or hydrolyze ATP.−+1-a WRN helicase and exonuclease activities are detectable from 25 to 37 °C, but not at 4 °C.1-b Based on comparison of WRN-K477M DNA binding and exonuclease assays carried out in the presence and absence of ATP, although actual ATP binding studies for this protein have not been done.1-c This protein lacks the consensus nucleotide binding/hydrolysis domains present in RecQ homologs and presumably cannot bind or hydrolyze ATP. Open table in a new tab Oligomers were purchased from Integrated DNA Technologies (Coralville, IA) and Operon (Alameda, CA). In 5′ to 3′ orientation, sequences of the oligomers used in this study are G80 (AGCTCCTAGGGTTACAAGCTTCACTAGGGTTGTCCTTAGGGTTAGGGTTAGGGTTACCTACACATGTAGGGTTGATCAGC), G80bubble21 (AGCTCCTAGGGTTACAAGCTTCACTAGGGTTGTCCAGTCACAGTCAGAGTCACAGTCCTACACATGTAGGGTTGATCAGC), C80 (GCTGATCAACCCTACATGTGTAGGTAACCCTAACCCTAACCCTAAGGACAACCCTAGTGAAGCTTGTAACCCTAGGAGCT), 51-mer (GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAA), and 57-mer (CAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACC). Phosphorothioate linkages between the 5′ end and 5′ penultimate nucleotides of the G80, G80bubble21, and C80 oligomers were included to inhibit the activity (5′ → 3′ nuclease) of a minor contaminant present in WRNΔ369–1432 preparations. The 5′ ends of these oligomers were labeled using [γ-32P]ATP (60 μCi, 3000 Ci/mmol, PerkinElmer Life Sciences) and T4 polynucleotide kinase (New England Biolabs, 10 units) using standard methods. After removal of nonincorporated radionucleotide, the labeled oligomers were annealed with a 2-fold excess of their fully or partially complementary partners by heating to 90 °C for 5 min and slow cooling to room temperature (25 °C); C80 was annealed to either G80 or G80bubble21 to yield fully duplex or 21-nt bubble-containing substrate, respectively (Fig. 1). 5′ end-labeled 51-mer was annealed to unlabeled 57-mer to create a standard 5′ overhang substrate for WRN exonuclease activity. Partially and fully duplex substrates were separated from nonannealed and excess single-stranded DNAs by nondenaturing polyacrylamide gel electrophoresis (12%), eluted from gel slices using a gel extraction kit (Qiagen, Valencia, CA), and kept in 10 mm Tris-HCl, pH 8.0, at 4 °C. The single-stranded character of the noncomplementary region of the bubble substrate was confirmed by localized incision of that region by S1 nuclease and by its ability to anneal with a fully complementary 21-nt oligomer (data not shown). DNA substrates (21-nt bubble or fully duplex, 32P-labeled on the C80 oligomer, 0.5 fmol each) were incubated for 15 min at 37 °C with WRN-E84A (30–240 fmol) in WRN reaction buffer containing 40 mm Tris-HCl (pH 8.0), 4 mm MgCl2, 0.1 mg/ml BSA, and 5 mmdithiothreitol. ATP (1 mm) was added unless otherwise indicated. The reactions were terminated by addition of one-sixth volume of helicase stop dye (30% glycerol, 50 mm EDTA, 0.9% SDS, 0.25% bromphenol blue, 0.25% xylene cyanol). Samples were loaded onto a nondenaturing acrylamide (8%) gel that was run in 1× TBE (90 mm Tris borate, pH 8.0, 2 mm EDTA) at 120 V at 25 °C. After drying of the gels, visualization and quantitation were accomplished using a Storm 860 phosphorimaging system and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). The band intensities (minus background) for the double-stranded and single-stranded DNA species were determined for WRN-treated and untreated reactions. Percentage of unwinding is calculated as the ratio (×100) of single-stranded species to the total amount of substrate in WRN-treated reactions, including subtraction of the low percentage of single-stranded species in untreated controls. In WRN reaction buffer either without ATP or including ATP or ATPγS (1 mm) where indicated,32P-labeled DNA substrates (∼0.5 fmol each) were incubated for 1 h at 37 °C with wild type or mutant WRN protein (2–600 fmol). The reactions were stopped by addition of an equal volume of formamide loading buffer (95% formamide, 20 mmEDTA, 0.1% bromphenol blue, and 0.1% xylene cyanol), and the DNA products were denatured at 90 °C for 5 min and separated by denaturing polyacrylamide (14%) gel electrophoresis in 1× TBE (1.5 h at 40 watts). Size markers were obtained by individual restriction enzyme (AluI, AvrII, BclI,BfaI, HindIII, or NspI) digestion of the appropriately radiolabeled bubble substrate (for restriction sites, see Fig. 1A) at 37 °C for 1 (partial) or 3 h. Individual digests were mixed in various combinations, heated to denature DNA products as above, and analyzed in parallel with exonuclease reactions. The gels were dried and subjected to phosphorimaging analysis as above. Exonuclease activity was assessed by comparing the band intensity of the undigested substrate remaining in treated samples with that of the untreated control. Fully duplex or bubble-containing substrate (32P-labeled, 0.5 fmol) was incubated with wild type WRN (12–72 fmol) or mock protein preparation (volume normalized) for 30 min at 4 °C in binding buffer (10 μl final volume) containing 20 mm HEPES-KOH (pH 8.0), 1 mm MgCl2, 0.1 mm EDTA, 100 μg/ml BSA, 0.5 mm dithiothreitol, 0.1% Nonidet P-40, 5% glycerol, 4% Ficoll, and 1 mm ATPγS or ATP. After addition of one-sixth volume of native dye (30% glycerol, 0.25% bromphenol blue, and 0.25% xylene cyanol), samples were separated by nondenaturing polyacrylamide (4%) gel electrophoresis carried out in 0.5× TBE at 140 V at 4 °C. Gels were vacuum-dried, and radioactivity associated with DNA and DNA-protein complexes was visualized and quantitated by phosphorimaging analysis. 32P-Labeled DNA substrates (21-nt bubble or completely complementary, 0.5 fmol each) were incubated with or without WRN wild type or mutant protein (WRNp, WRN-E84A, WRN-K577M, or WRNΔ369–1432) for 5–30 min at 4 °C or 37 °C in WRN reaction buffer (10-μl final volume). Where indicated, reactions also included 1 mm ATP or ATPγS. DNase I (1-μl volume, 0.015 units/reaction at 4 °C or 0.00015 units/reaction at 37 °C) was then added to the binding reactions followed by incubation at 0 °C or 37 °C for 10 min. The reactions were terminated by addition of an equal volume of formamide loading buffer. The digestion products of these reactions were resolved by denaturing polyacrylamide (14%) gel electrophoresis in 1× TBE at 40 watts for 2 h and, as above, visualized using a phosphorimager after drying of gels. Size markers were generated as described above (see “Exonuclease Assay”). Most metabolic processes involving DNA (notably including replication, transcription, and nucleotide excision repair) take advantage of the ability of duplex DNA to be locally melted or unwound to allow access of additional DNA metabolizing enzymes. Although WRN alone does not appear to be capable of initiating the melting of fully duplex DNA, we felt it reasonable that a partially unwound region in the midst of fully duplex DNA might be a physiological substrate for WRN. For example, WRN helicase might assist in unwinding at a site that is already partially unwound and/or use an unwound region as an anchor to initiate degradation using its exonuclease function. Consistent with this rationale, various experimental findings have pointed to a role for WRN in DNA replication, recombination, repair, or transcription pathways (17Constantinou A. Tarsounas M. Karow J.K. Brosh R.M. Bohr V.A. Hickson I.D. West S.C. EMBO Rep. 2000; 1: 80-84Crossref PubMed Scopus (335) Google Scholar, 30Yan H. Chen C.-Y. Kobayashi R. Newport J. Nat. Genet. 1998; 19: 375-378Crossref PubMed Scopus (129) Google Scholar, 31Fujiwara Y. Higashikawa T. Tatsumi M. J. Cell. Physiol. 1977; 92: 365-374Crossref PubMed Scopus (130) Google Scholar, 32Takeuchi F. Hanaoka F. Goto M. Akaoka I. Hori T.-A. Yamada M.-A. Miyamoto T. Hum. Genet. 1982; 60: 365-368Crossref PubMed Scopus (69) Google Scholar, 33Poot M. Hoehn H. Runger T.M. Martin G.M. Exp. Cell Res. 1992; 202: 267-273Crossref PubMed Scopus (186) Google Scholar, 34Balajee A.S. Machwe A. May A. Gray M.D. Oshima J. Martin G.M. Nehlin J.O. Brosh R. Orren D.K. Bohr V.A. Mol. Biol. Cell. 1999; 10: 2655-2668Crossref PubMed Scopus (116) Google Scholar) that involve localized melting of duplex DNA. To examine this possibility, we designed a duplex DNA substrate with an internal noncomplementary (bubble) region of 21 unpaired nucleotides on each strand that would somewhat mimic a melted DNA intermediate (Fig.1A). The noncomplementary region is asymmetrically positioned between duplex arms of 35 and 24 base pairs (bp). For the sake of reference in certain experiments, the individual strands will be identified as the G-rich and C-rich strands (Fig. 1A). This substrate was then subjected to unwinding, exonuclease, and DNA binding studies with wild type and mutant WRN proteins, using a fully duplex substrate (Fig. 1B) for comparison where appropriate. Because of the existence of both unwinding and exonuclease activities in wild type WRN, mutant proteins were used and/or conditions were manipulated such that the individual catalytic activities could be examined in isolation. For convenience, a comparison of the catalytic properties of the individual WRN proteins used in this study is presented in TableI. Enzymatic studies have demonstrated that WRN helicase requires a 3′ single-stranded region to the duplex region to be unwound and cannot act on fully duplex, blunt-ended substrates (13Shen J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; 26: 2879-2885Crossref PubMed Scopus (181) Google Scholar, 24Mohaghegh P. Karow J.K. Brosh Jr., R.M. Bohr V.A. Hickson I.D. Nucleic Acids Res. 2001; 29: 2843-2849Crossref PubMed Scopus (476) Google Scholar). We reasoned that providing WRN with an internal noncomplementary (bubble) region in the middle of a DNA substrate might satisfy the single-stranded DNA requirement of WRN helicase and might permit unwinding of an otherwise blunt-ended substrate to occur. We tested the ability of WRN to unwind our substrate containing an internal 21-nt bubble in comparison to fully complementary, blunt-ended double-stranded DNA. Because of the exonuclease activity of wild type WRN protein on these substrates (see below), helicase assays were carried out with WRN-E84A mutant protein, which completely lacks exonuclease activity but retains unwinding capability. The WRN-E84A mutant was able to unwind the 80-mer substrate containing a 21-nt bubble at WRN concentrations of 60 fmol and above (Fig.2A). Upon overexposure of gels, small amounts of slowly migrating forked structures were detected, corresponding to unwinding of a single duplex arm of the bubble substrate (data not shown). In contrast, WRN-E84A could not detectably unwind a completely complementary DNA substrate with blunt ends (Fig. 2C), in agreement with earlier reports (13Shen J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; 26: 2879-2885Crossref PubMed Scopus (181) Google Scholar, 24Mohaghegh P. Karow J.K. Brosh Jr., R.M. Bohr V.A. Hickson I.D. Nucleic Acids Res. 2001; 29: 2843-2849Crossref PubMed Scopus (476) Google Scholar). The amount of helicase activity on the bubble substrate increased in a roughly proportional manner with increasing WRN concentration, whereas the fully duplex substrate was not unwound over the range of WRN concentration tested (Fig. 2D). The unwinding activity on the bubble-containing substrate was inherent in the recombinant WRN-E84A, as mock-purified protein did not detectably unwind this substrate (Fig. 2B). As expected, WRN-catalyzed unwinding of the bubble substrate requires ATP hydrolysis, as single-stranded products were not detectable in reactions lacking ATP (Fig.2B) or containing ATPγS, a nonhydrolyzable ATP analog (data not shown). Furthermore, no unwinding activity was observed when reactions were incubated at 4 °C. Thus, WRN could unwind our bubble-containing substrate to some degree, but, by manipulating reaction conditions, unwinding could also be prevented in order that binding and exonuclease activities on the intact substrate can be examined unambiguously. In addition to its nucleic acid unwinding activity, WRN has also been demonstrated to possess an intrinsic 3′ → 5′ exonuclease activity (25Huang S. Li B. Gray M.D. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Crossref PubMed Scopus (372) Google Scholar, 26Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 27Machwe A. Ganunis R. Bohr V.A. Orren D.K. Nucleic Acids Res. 2000; 28: 2762-2770Crossref PubMed Scopus (54) Google Scholar). This activity is associated with the N-terminal region of the protein, and, in fact, deletion mutants containing only the N-terminal 368 amino acids retain exonuclease activity (26Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A" @default.
• W2005963486 created "2016-06-24" @default.
• W2005963486 creator A5013276481 @default.
• W2005963486 creator A5023246308 @default.
• W2005963486 creator A5032099671 @default.
• W2005963486 creator A5089475983 @default.
• W2005963486 date "2002-02-01" @default.
• W2005963486 modified "2023-09-29" @default.
• W2005963486 title "DNase I Footprinting and Enhanced Exonuclease Function of the Bipartite Werner Syndrome Protein (WRN) Bound to Partially Melted Duplex DNA" @default.
• W2005963486 cites W1501269279 @default.
• W2005963486 cites W1538603370 @default.
• W2005963486 cites W1542472052 @default.
• W2005963486 cites W1935801587 @default.
• W2005963486 cites W1963563101 @default.
• W2005963486 cites W1966347623 @default.
• W2005963486 cites W1970898019 @default.
• W2005963486 cites W1975817860 @default.
• W2005963486 cites W1983127291 @default.
• W2005963486 cites W1989635566 @default.
• W2005963486 cites W1993489030 @default.
• W2005963486 cites W1995702418 @default.
• W2005963486 cites W1999757141 @default.
• W2005963486 cites W2000438077 @default.
• W2005963486 cites W2003992275 @default.
• W2005963486 cites W2010595848 @default.
• W2005963486 cites W2020143772 @default.
• W2005963486 cites W2023612394 @default.
• W2005963486 cites W2025173608 @default.
• W2005963486 cites W2025997331 @default.
• W2005963486 cites W2031184810 @default.
• W2005963486 cites W2039996950 @default.
• W2005963486 cites W2049160479 @default.
• W2005963486 cites W2059501883 @default.
• W2005963486 cites W2064310741 @default.
• W2005963486 cites W2076926674 @default.
• W2005963486 cites W2082557856 @default.
• W2005963486 cites W2084712319 @default.
• W2005963486 cites W2095762376 @default.
• W2005963486 cites W2106295681 @default.
• W2005963486 cites W2126098312 @default.
• W2005963486 cites W2132070326 @default.
• W2005963486 cites W2138524348 @default.
• W2005963486 cites W2146344533 @default.
• W2005963486 cites W2152472623 @default.
• W2005963486 cites W2153043528 @default.
• W2005963486 cites W2161650693 @default.
• W2005963486 cites W2333225812 @default.
• W2005963486 cites W4248084843 @default.
• W2005963486 doi "https://doi.org/10.1074/jbc.m108880200" @default.
• W2005963486 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11717307" @default.
• W2005963486 hasPublicationYear "2002" @default.
• W2005963486 type Work @default.
• W2005963486 sameAs 2005963486 @default.
• W2005963486 citedByCount "32" @default.
• W2005963486 countsByYear W20059634862014 @default.
• W2005963486 countsByYear W20059634862015 @default.
• W2005963486 crossrefType "journal-article" @default.
• W2005963486 hasAuthorship W2005963486A5013276481 @default.
• W2005963486 hasAuthorship W2005963486A5023246308 @default.
• W2005963486 hasAuthorship W2005963486A5032099671 @default.
• W2005963486 hasAuthorship W2005963486A5089475983 @default.
• W2005963486 hasBestOaLocation W20059634861 @default.
• W2005963486 hasConcept C104317684 @default.
• W2005963486 hasConcept C153911025 @default.
• W2005963486 hasConcept C161223559 @default.
• W2005963486 hasConcept C185592680 @default.
• W2005963486 hasConcept C22427896 @default.
• W2005963486 hasConcept C2777501222 @default.
• W2005963486 hasConcept C2778021871 @default.
• W2005963486 hasConcept C2778090637 @default.
• W2005963486 hasConcept C2779377703 @default.
• W2005963486 hasConcept C2781243718 @default.
• W2005963486 hasConcept C3017666073 @default.
• W2005963486 hasConcept C54355233 @default.
• W2005963486 hasConcept C547475151 @default.
• W2005963486 hasConcept C552990157 @default.
• W2005963486 hasConcept C67705224 @default.
• W2005963486 hasConcept C82381507 @default.
• W2005963486 hasConcept C86339819 @default.
• W2005963486 hasConcept C86803240 @default.
• W2005963486 hasConcept C94966510 @default.
• W2005963486 hasConcept C95444343 @default.
• W2005963486 hasConcept C99611785 @default.
• W2005963486 hasConceptScore W2005963486C104317684 @default.
• W2005963486 hasConceptScore W2005963486C153911025 @default.
• W2005963486 hasConceptScore W2005963486C161223559 @default.
• W2005963486 hasConceptScore W2005963486C185592680 @default.
• W2005963486 hasConceptScore W2005963486C22427896 @default.
• W2005963486 hasConceptScore W2005963486C2777501222 @default.
• W2005963486 hasConceptScore W2005963486C2778021871 @default.
• W2005963486 hasConceptScore W2005963486C2778090637 @default.
• W2005963486 hasConceptScore W2005963486C2779377703 @default.
• W2005963486 hasConceptScore W2005963486C2781243718 @default.
• W2005963486 hasConceptScore W2005963486C3017666073 @default.
• W2005963486 hasConceptScore W2005963486C54355233 @default.
• W2005963486 hasConceptScore W2005963486C547475151 @default.
• W2005963486 hasConceptScore W2005963486C552990157 @default.
• W2005963486 hasConceptScore W2005963486C67705224 @default.

• next