FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006077145> ?p ?o ?g. }

• W2006077145 endingPage "28990" @default.
• W2006077145 startingPage "28980" @default.
• W2006077145 abstract "The non-canonical Wnt/cyclic GMP/Ca2+/NF-AT pathway operates via Frizzled-2, a member of the superfamily of G protein-coupled receptors. In scanning for signaling events downstream of the Frizzled-2/Gαt2/PDE6 triad activated in response to Wnt5a, we observed a strong activation of the mitogen-activated protein kinase p38 in mouse F9 teratocarcinoma embryonal cells. The activation of p38 is essential for NF-AT transcriptional activation mediated via Frizzled2. Wnt5a-stimulated p38 activation was rapid, sensitive to pertussis toxin, to siRNA against either Gαt2 or p38α, and to the p38 inhibitor SB203580. Real-time analysis of intracellular cyclic GMP using the Cygnet2 biosensor revealed p38 to act at the level of cyclic GMP, upstream of the mobilization of intracellular Ca2+. Fluorescence resonance energy transfer (FRET) imaging reveals the changes in cyclic GMP in response to Wnt5a predominate about the cell membrane, and likewise sensitive to either siRNA targeting p38 or to treatment with SB203580. Dishevelled is not required for Wnt5a activation of p38; siRNAs targeting Dishevelleds and expression of the Dishevelled antagonist Dapper-1 do not suppress the p38 response to Wnt5a stimulation. These novel results are the first to detail a Dishevelled-independent Wnt response, demonstrating a critical role of the mitogen-activated protein kinase p38 in regulating the Wnt non-canonical pathway. The non-canonical Wnt/cyclic GMP/Ca2+/NF-AT pathway operates via Frizzled-2, a member of the superfamily of G protein-coupled receptors. In scanning for signaling events downstream of the Frizzled-2/Gαt2/PDE6 triad activated in response to Wnt5a, we observed a strong activation of the mitogen-activated protein kinase p38 in mouse F9 teratocarcinoma embryonal cells. The activation of p38 is essential for NF-AT transcriptional activation mediated via Frizzled2. Wnt5a-stimulated p38 activation was rapid, sensitive to pertussis toxin, to siRNA against either Gαt2 or p38α, and to the p38 inhibitor SB203580. Real-time analysis of intracellular cyclic GMP using the Cygnet2 biosensor revealed p38 to act at the level of cyclic GMP, upstream of the mobilization of intracellular Ca2+. Fluorescence resonance energy transfer (FRET) imaging reveals the changes in cyclic GMP in response to Wnt5a predominate about the cell membrane, and likewise sensitive to either siRNA targeting p38 or to treatment with SB203580. Dishevelled is not required for Wnt5a activation of p38; siRNAs targeting Dishevelleds and expression of the Dishevelled antagonist Dapper-1 do not suppress the p38 response to Wnt5a stimulation. These novel results are the first to detail a Dishevelled-independent Wnt response, demonstrating a critical role of the mitogen-activated protein kinase p38 in regulating the Wnt non-canonical pathway. Wnts are secreted, palmitoylated, and glycosylated ligands that play a central role in early development (1Mikels A.J. Nusse R. Oncogene. 2006; 25: 7461-7468Crossref PubMed Scopus (251) Google Scholar, 2Cadigan K.M. Nusse R. Genes Dev. 1997; 11: 3286-3305Crossref PubMed Scopus (2217) Google Scholar). Heptahelical, G protein-coupled Frizzleds are the cellular receptors for Wnt ligands (3Bhanot P. Fish M. Jemison J.A. Nusse R. Nathans J. Cadigan K.M. Development. 1999; 126: 4175-4186PubMed Google Scholar, 4Bhanot P. Brink M. Samos C.H. Hsieh J.C. Wang Y. Macke J.P. Andrew D. Nathans J. Nusse R. Nature. 1996; 382: 225-230Crossref PubMed Scopus (1218) Google Scholar, 5Chen C.M. Struhl G. Development. 1999; 126: 5441-5452PubMed Google Scholar, 6Wang H.Y. Liu T. Malbon C.C. Cell. Signal. 2006; 18: 934-941Crossref PubMed Scopus (130) Google Scholar, 7Malbon C.C. Front. Biosci. 2004; 9: 1048-1058Crossref PubMed Scopus (100) Google Scholar, 8Wang H.Y. Malbon C.C. Cell Mol. Life Sci. 2004; 61: 69-75Crossref PubMed Scopus (56) Google Scholar). The Wnt-sensitive “canonical” pathway was the first to be elucidated, is mediated by Frizzled-1, and regulates the cellular stability of β-catenin (i.e. the Wnt/β-catenin pathway) (2Cadigan K.M. Nusse R. Genes Dev. 1997; 11: 3286-3305Crossref PubMed Scopus (2217) Google Scholar). Wnts that regulate the canonical pathway increase the nuclear accumulation of β-catenin and thereby activate the transcription of developmentally essential genes that are sensitive to members of the lymphocyte enhancer factor/T cell factor (Lef/Tcf) transcription factors (2Cadigan K.M. Nusse R. Genes Dev. 1997; 11: 3286-3305Crossref PubMed Scopus (2217) Google Scholar, 9Korinek V. Barker N. Morin P.J. van Wichen D. de Weger R. Kinzler K.W. Vogelstein B. Clevers H. Science. 1997; 275: 1784-1787Crossref PubMed Scopus (2918) Google Scholar, 10Molenaar M. van de Wetering M. Oosterwegel M. Peterson-Maduro J. Godsave S. Korinek V. Roose J. Destree O. Clevers H. Cell. 1996; 86: 391-399Abstract Full Text Full Text PDF PubMed Scopus (1608) Google Scholar). An example of a “non-canonical” Wnt-sensitive pathway is that mediated by Frizzled-2, regulating cyclic GMP accumulation and Ca2+ mobilization (11Slusarski D.C. Corces V.G. Moon R.T. Nature. 1997; 390: 410-413Crossref PubMed Scopus (547) Google Scholar, 12Kuhl M. Sheldahl L.C. Malbon C.C. Moon R.T. J. Biol. Chem. 2000; 275: 12701-12711Abstract Full Text Full Text PDF PubMed Scopus (400) Google Scholar, 13Ahumada A. Slusarski D.C. Liu X. Moon R.T. Malbon C.C. Wang H.Y. Science. 2002; 298: 2006-2010Crossref PubMed Scopus (141) Google Scholar, 14Kuhl M. Sheldahl L.C. Park M. Miller J.R. Moon R.T. Trends Genet. 2000; 16: 279-283Abstract Full Text Full Text PDF PubMed Scopus (739) Google Scholar, 15Wang H.Y. Malbon C.C. Science. 2003; 300: 1529-1530Crossref PubMed Scopus (126) Google Scholar). Activation of Frizzled-2 by Wnt5a leads to activation of the phosphatidylinositol pathway (11Slusarski D.C. Corces V.G. Moon R.T. Nature. 1997; 390: 410-413Crossref PubMed Scopus (547) Google Scholar), activation of the cyclic GMP phosphodiesterase PDE6 (13Ahumada A. Slusarski D.C. Liu X. Moon R.T. Malbon C.C. Wang H.Y. Science. 2002; 298: 2006-2010Crossref PubMed Scopus (141) Google Scholar, 16Wang H. Lee Y. Malbon C.C. Biochem. Soc. Trans. 2004; 32: 792-796Crossref PubMed Scopus (29) Google Scholar), and inhibition of protein kinase G (PKG) 2The abbreviations used are: PKGprotein kinase GFRETfluorescence resonance energy transferMAPKmitogen-activated protein kinaseNF-ATnuclear factor of activated T cellsMEKmitogen-activated protein kinase/extracellular signal-regulated kinase kinaseGSTglutathione S-transferaseDNdominant negative. 2The abbreviations used are: PKGprotein kinase GFRETfluorescence resonance energy transferMAPKmitogen-activated protein kinaseNF-ATnuclear factor of activated T cellsMEKmitogen-activated protein kinase/extracellular signal-regulated kinase kinaseGSTglutathione S-transferaseDNdominant negative. (17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), which leads to Ca2+ mobilization (17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Ca2+ imaging with Fura-2 dye in zebrafish embryos (13Ahumada A. Slusarski D.C. Liu X. Moon R.T. Malbon C.C. Wang H.Y. Science. 2002; 298: 2006-2010Crossref PubMed Scopus (141) Google Scholar, 18Slusarski D.C. Yang-Snyder J. Busa W.B. Moon R.T. Dev. Biol. 1997; 182: 114-120Crossref PubMed Scopus (325) Google Scholar), mouse F9 teratocarcinoma cells (17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), and human embryonic stem cells in culture (17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar) has revealed Wnt5a-stimulated Ca2+ mobilization in this non-canonical pathway to be downstream of PKG. Wnt5a-stimulated mobilization of intracellular Ca2+ stimulates activation of Ca2+-sensitive enzymes, including the protein kinases (e.g. calcium/calmodulin-sensitive protein kinase II, CamKII, protein kinase C) (12Kuhl M. Sheldahl L.C. Malbon C.C. Moon R.T. J. Biol. Chem. 2000; 275: 12701-12711Abstract Full Text Full Text PDF PubMed Scopus (400) Google Scholar, 14Kuhl M. Sheldahl L.C. Park M. Miller J.R. Moon R.T. Trends Genet. 2000; 16: 279-283Abstract Full Text Full Text PDF PubMed Scopus (739) Google Scholar) as well as the phosphoprotein phosphatase calcineurin (19Saneyoshi T. Kume S. Amasaki Y. Mikoshiba K. Nature. 2002; 417: 295-299Crossref PubMed Scopus (257) Google Scholar). The mobilization of intracellular Ca2+ is essential for Wnt5a activation of NF-AT(nuclear factor of activated T cells)-sensitive gene transcription (17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). protein kinase G fluorescence resonance energy transfer mitogen-activated protein kinase nuclear factor of activated T cells mitogen-activated protein kinase/extracellular signal-regulated kinase kinase glutathione S-transferase dominant negative. protein kinase G fluorescence resonance energy transfer mitogen-activated protein kinase nuclear factor of activated T cells mitogen-activated protein kinase/extracellular signal-regulated kinase kinase glutathione S-transferase dominant negative. We scanned signaling pathways that might intersect with the Wnt/cyclic GMP, Ca2+ pathway that ultimately regulates NF-AT-sensitive gene transcription. Of central interest in the analysis was the mitogen-activated protein kinase (MAPK) cascades and the possible role of p38 in the Wnt-sensitive non-canonical signaling pathway. Our results indicate a central role of p38 MAPK in the Wnt5a/Frizzled-2/Gαt2/PDE6/cyclic GMP and Ca2+ mobilization pathway that regulates NF-AT. Notably, the Wnt5a-stimulated activation of MAPK signaling cascade to the level of p38 is the first Wnt pathway demonstrated to operate independent of Dishevelleds. Cell Culture—Mouse F9 teratocarcinoma cells were obtained from the ATCC collection (Manassas, VA). The cells were propagated and maintained in Dulbecco's modified Eagle's medium supplemented with 15% heat-inactivated fetal bovine serum (Hyclone, South Logan, UT) at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. Clones stably co-transfected with pcDNA3.1 harboring rat Frizzled2 (Fz2) and pNFAT-Luc (Stratagene, La Jolla, CA) were selected in medium containing 0.4 mg/ml neomycin analogue, G418 (Invitrogen, Carlsbad, CA). At least three independent clones were selected for each transfection. Clones were propagated in Dulbecco's modified Eagle's medium supplemented with 15% fetal bovine serum, 100 units/ml penicillin, 0.1 mg/ml streptomycin, and 0.1 mg/ml G418. Immunoblotting—F9 clones stably expressing either rat Frizzled1 (Fz1) or rat Frizzled2 (Fz2) were grown in 6-well plates. Cells were lysed in 250 μl of lysis buffer (20 mm Tris, pH 7.5, 150 mm NaCl, 1 mm EDTA, 1% Triton, 2.5 mm sodium pyrophosphate, 1 mm β-glycerolphosphate, 1 mm Na3VO4, 10 μg/ml leupeptin, 10 μg/ml aprotinin, and 200 μm phenylmethylsulfonyl fluoride) and the mixture was subjected to centrifugation (20,000 × g for 10 min at 4 °C). The supernatant, designated as whole cell lysates, was collected and protein concentration was determined by Lowry's method (20Lowry O.H. Rosebrough H.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). Protein aliquots (40 μg/lane) were subjected to SDS-polyacrylamide gel electrophoresis and the resolved proteins were transferred onto nitrocellulose membranes. The blots were probed with antibodies specifically against p38 MAPK, phosphorylated p38 MAPK, MKK3, phosphorylated MKK3/6, phosphorylated ATF2 (Cell Signaling Technology, Danvers, MA), or against the indicated G protein subunits (anti-Gαt1, and anti-Gαt2 from Santa Cruz Biotechnology, Santa Cruz, CA; anti-Gαo from Chemicon, Temecula, CA) and followed by incubation with a corresponding peroxidase-conjugated secondary antibody (anti-mouse from Santa Cruz Biotechnology; anti-rabbit from Kirkegaard and Perry Laboratories, Gaithersburg, MD). Immune complexes were determined by enhanced chemiluminescence method. p38 MAP Kinase Assay—Confluent F9 clones stably expressing Fz2 were cultured in 6-well plates in media without serum for 16 h, and thereafter cells were pretreated without or with pertussis toxin (100 ng/ml), 8-Br-PET-cyclic GMP (10 μm), or Zaprinast (1 μm) for 30 min to 1 h prior to Wnt5a (50 ng/ml, cat. 645-WN, R&D Systems, Minneapolis, MN) stimulation for the indicated periods. The activity of p38 MAP kinase was measured by using p38 MAP kinase assay kit (Cell Signaling Technology, Danvers, MA) according to the manufacturer's instruction. Briefly, cells were lysed in 250 μl of lysis buffer (20 mm Tris, pH 7.5; 150 mm NaCl, 1 mm EDTA, 1% Triton, 2.5 mm sodium pyrophosphate, 1 mm β-glycerolphosphate, 1 mm Na3VO4, 10 μg/ml leupeptin, 10 μg/ml aprotinin, and 200 μm phenylmethylsulfonyl fluoride) and the lysates were centrifuged at 20,000 × g for 10 min at 4 °C. Aliquots (500 μg of protein) of the supernatant were incubated with 20 μl of immobilized phospho-p38 MAPK monoclonal antibody for 4 h at 4 °C. The immune complexes were washed twice with lysis buffer and twice with kinase buffer (25 mm Tris, pH 7.5; 5 mm β-glycerolphosphate, 2 mm dithiothreitol, 0.1 mm Na3VO4, and 10 mm CaCl2). The immobilized phospho-p38 was incubated in 30 μl of kinase buffer containing 1 μg of p38 substrate peptide GST-ATF2-(19-96) and 20 μm ATP at 30 °C for 30 min. The reaction mixtures were subjected to the 10% SDS-PAGE and separated proteins were transferred electrophoretically onto nitrocellulose membrane. The activity of p38 kinase was assessed by detection of GST-ATF2 phosphorylation via an anti-phospho-ATF2 antibody. NF-AT-sensitive Luciferase Gene Reporter Assay—Mouse F9 clones stably co-transfected with NF-AT reporter gene (pNFAT-Luc) and an expression vector harboring Fz2 were cultured on 12-well plates. Confluent cells were serum-starved for 12 h. Thereafter cells were pretreated for 30 min with vehicle (as control), or PD98059 (20 μm; Calbiochem, San Diego, CA) or SB203580 (2 μm; Calbiochem, San Diego, CA), followed by incubation without or with Wnt5a (50 ng/ml) for 6 h. Cells were lysed with 1× luciferase cell culture lysis reagent (Promega, Madison, WI) and supernatants from cell lysates were subjected to luciferase assay according to the manufacturer's instruction (Stratagene, La Jolla, CA). Briefly, 20 μl of supernatant were mixed with 100 μl of luciferase assay buffer (40 mm Tricine, pH 7.8; 0.5 mm ATP, 10 mm MgSO4, 0.5 mm EDTA, 10 mm 1,4-dithiothreitol, 0.5 mm coenzyme A, and 0.5 mm luciferin), and the intensity of luminescence was measured 10 s after by using a luminometer (Lumat LB 9507; Berthold Technologies, Oak Ridge, TN). Samples were assayed in triplicate, and the luciferase activity was normalized based on protein concentrations. Results are presented as ratios of relative light units of treatment groups to those of control groups. Cytoplasmic Calcium Measurements—Cells were plated on collagen-coated, glass-bottomed 35-mm dishes (MatTek Corporation, Ashland, MA) and cultured overnight. The intracellular Ca2+ was measured as described previously (17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Briefly, cells were loaded with 2 μm Fura-2 acetoxymethyl ester (Molecular Probes, Inc., Eugene, OR) in Krebs-Ringer buffer composed of 128 mm NaCl, 5 mm KCl, 77.5 mm NaH2PO4, 1.3 mm MgSO4, and 1.3 mm CaCl2 for 40 min at 37 °C. Cells were then washed twice with Krebs-Ringer buffer and treated with Wnt5a (50 ng/ml). In the experiment that p38 inhibitor SB203580 was used, it was incubated together with Fura-2 for the last 30 min of the total 45 min loading time. Cells were immediately monitored via a Hamamatsu OREA ER-AG digital CCD camera coupled to a Nikon inverted microscope. Measurement of fluorescence intensity was performed and the ratio of absorbance at 340/380 nm (A340/A380) was computed using Dynamic Intensity Analysis (Compix Inc., Cranberry Township, PA). Assay of PKG Activity—PKG activity was determined as described previously (21Wolfe L. Francis S.H. Landiss L.R. Corbin J.D. J. Biol. Chem. 1987; 262: 16906-16913Abstract Full Text PDF PubMed Google Scholar) with modifications. Briefly, supernatants (20 μl) from the whole cell lysates were employed with 200 μg/ml PKG-specific heptapeptide substrate (RKRSRAE; Bachem, San Diego, CA), 50 μm ATP, and 2.5 μCi of [γ-32P]ATP in a buffer (TMG) containing 20 mm Tris-HCl, pH 7.4, 20 mm magnesium acetate, 10 mm glycerophosphate, 100 nm okadaic acid, and a mixture of protease inhibitors (10 μg/ml leupeptin, 10 μg/ml aprotinin, and 200 μm phenylmethylsulfonyl fluoride). The reaction mixture was incubated at 37 °C for 20 min, and the reaction was terminated by addition of 4 μl of 2 n HCl. Preboiled or HCl-treated supernatants were used as blank samples. Twenty microliters of the resultant mixture were spotted onto P-81 phosphocellulose filters. Air-dried P-81 filters were washed with H3PO4 (75 mm) three times. Incorporated 32P in substrates on filters were measured by liquid scintillation spectrometry. The samples were assayed in triplicate. Kinase activity is normalized with protein concentration and presented in percentage of PKG activity of treatment group to that of the control group. Measurement of Intracellular Cyclic GMP in Live Cells—The change of intracellular cyclic GMP in response to Wnt5a in the absence or presence of SB203580 was measured by using a cyclic GMP indicator Cygnet-2.1 (a kind gift from Dr. Wolfgang Dostmann, University of Vermont, Burlington, VT). Cygnet-2.1 was designed utilizing catalytically inactive mutant Δ1-77/T516A bovine cGMP-dependent protein kinase Iα (PKG Iα) as the central cGMP sensor flanked by enhanced cyan fluorescence protein (eCFP) and citrine, a pH-insensitive version of yellow fluorescence protein (YFP). This biosensor binds cyclic GMP with a high affinity and undergoes a conformational change, interrupting the native FRET observed in the absence of cyclic GMP (22Honda A. Sawyer C.L. Cawley S.M. Dostmann W.R. Methods Mol. Biol. 2005; 307: 27-43PubMed Google Scholar, 23Honda A. Adams S.R. Sawyer C.L. Lev-Ram V. Tsien R.Y. Dostmann W.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2437-2442Crossref PubMed Scopus (228) Google Scholar). F9 Fz2 expressing clones were transfected with pcDNA3 harboring Cygnet-2.1 on a 35-mm glass-bottomed dish by using Lipofectamine 2000 as per the manufacturer's instruction (Invitrogen, Carlsbad, CA). Twenty-four hours later, cells were bathed in phenol red-free Dulbecco's modified Eagle's medium in the absence or presence of SB203580 (2 μm) and imaged at 37 °C with a thermostatted chamber supplied with 5% CO2 on a Zeiss LSM 510 META confocal microscope with a 100/1.45 Alpha Plan-Fluor objective and an Argon 458 nm laser line. Dual-emission ratio (525/475 nm) imaging of the indicator was controlled by Zeiss LSM Image software. Emission intensities were monitored from 460 to 560 nm at an interval of 10 nm. Intracellular Cyclic GMP Accumulation—The second method for determining intracellular cyclic GMP concentrations was using a commercial cyclic GMP ELISA kit (Cayman, Chemical, Ann Arbor, MI) as previously described (13Ahumada A. Slusarski D.C. Liu X. Moon R.T. Malbon C.C. Wang H.Y. Science. 2002; 298: 2006-2010Crossref PubMed Scopus (141) Google Scholar, 24Chen L. Salafranca M.N. Mehta J.L. Am. J. Physiol. 1997; 273: H1854-H1859PubMed Google Scholar). Briefly, mouse F9 cells stably expressing Fz2 were seeded onto 12-well plates. Control siRNA or siRNA specifically against p38 MAP kinase (Santa Cruz Biotechnology) were introduced into cells by using Lipofectamine 2000 according to the manufacturer's instruction. After siRNA treatment for 48 h and serum starvation for 12 h, cells were stimulated with Wnt5a (50 ng/ml) for 45 min and lysed in 0.2 ml of 0.1 m HCl. Supernatants from lysates were collected by centrifugation and cyclic GMP concentrations were determined. The coefficients of variation within and among assays were 7.5 and 9.8%, respectively. The results were expressed as percentage of cyclic GMP measured in the “control” cells. Treatment of Cells with Antisense Morpholinos—Morpholino phosphorodiamidate antisense oligonucleotides (morpholinos) targeting the translational initiation sites of Gαt2, Gαt1, and Gαo were purchased from Gene Tools (Corvallis, OR). The sequences of morpholinos for Gαt2, Gαt1, and Gαo are as follows: CACTCCCCATTTCTGCTGTCTCCTC is for Gαt2, CTCCCCGGCCTCCTCAGACGACCTT is for Gαt1, and CCTCTGCGCTCAGCGTACATCCCAT is for Gαo. Mouse F9 clones expressing Fz2 were treated with morpholino antisense oligo according to the manufacturer's protocol as described previously (17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Seventy-two hours after morpholino antisense treatment, cells were stimulated without or with Wnt5a (50 ng/ml) for 15 min and p38 kinase activity was assessed. The expression levels of target proteins were evaluated by immunoblotting. Treatment of Cells with siRNA—F9 cells expressing Fz2 were grown to ∼60% confluence. siRNA (final concentration = 100 nm) was introduced into cells by using Lipofectamine 2000 (Invitrogen). Cells were cultured in the presence of siRNA for additional 48 h according to the manufacturer's recommendation. siRNAs targeting either mouse p38α (cat. SC-44217) or human p38α (cat. SC-29433) were purchased from Santa Cruz Biotechnology. PDE Activity Assay—F9 cells stably expressing Fz2 were seeded onto 12-well plates. siRNA treatment was performed 48 h prior to the Wnt5a (50 ng/ml) stimulation, as described previously. After incubation with Wnt5a for 15 min, cells were collected and homogenized in the buffer containing 20 mm Tris-HCl, pH 8.0; 2 mm MgCl, 1 mm EDTA, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 100 μm phenylmethylsulfonyl fluoride. Twelve milligrams of cytosol fraction of cell lysates (∼1 ml) were applied to a Resource Q chromatography (Amersham Biosciences). The starting buffer was 10 mm Tris-HCl, pH 8.0 with 50 mm NaCl; the washing buffer was 10 mm Tris-HCl, pH 8.0 with 300 mm NaCl. Samples were eluted with a linear gradient of NaCl (50-300 mm) at a flow rate of 1 ml/min. PDE6 in the eluted fractions was identified by immunoblotting. PDE6 activity was measured from the three fractions containing immunostained PDE6. Briefly, 50 μl of samples were employed in a total volume of a 100-μl reaction mixture containing 20 mm Tris-HCl (pH 8.0), 100 mm NaCl, 8 mm MgSO4, 100 μm cGMP, and 0.02 μCi of purified [3H]cGMP. The reaction mixture was incubated at 30 °C for 20 min. Reactions were stopped by heat denaturation, 2 min at 100 °C. To convert GMP to guanosine, 0.1 unit/reaction of alkaline phosphatase (P-5931, Sigma) were added to each sample, and the reaction was conducted for 20 min at 25 °C. The labeled guanosine was separated by AG 1-X8 resin (Bio-Rad) and quantified by scintillation counting. PDE6 activity is expressed as the mean value (cpm) of three separate samplings. Expression of Constitutively Active G Protein α-Subunits—Gln to Leu substitution mutants of G protein α-subunits: Gαt2 (Q204L), GαoA (G205L), and Gαq (Q209L) were purchased from UMR cDNA Resource Center (University of Missouri-Rolla, Rolla, MO). F9 cells stably expressing Fz2 were plated onto 12-well plates and transiently transfected with an expression vector harboring either Gαt2 (Q204L), GαoA (G205L), or Gαq (Q209L) by using Lipofectamine 2000 according to the manufacturer's protocol. Twenty-four hours later, cells were treated with Wnt5a for 15 min, and cell lysates were used for immunoblotting. Statistical Analysis—The experiments were conducted at least in triplicate. All of the data are expressed as the means ± S.E. from at least three separate experiments. Comparisons of data among groups were performed with one-way analysis of variance followed by the Newman-Keuls test. Statistical significance (p value of less than 0.05) is denoted with asterisks or pound symbols. Wnt5a Activates p38 Mitogen-activated Protein Kinase—Mouse F9 clones expressing rat Frizzled-2 (Fz2) were treated with purified Wnt5a for up to 2 h and the activity of p38 MAPK assayed. In response to stimulation with Wnt5a, p38 activity increases, as measured by the phosphorylation of the substrate ATF2 (Fig. 1A). ATF2 is a transcription factor that is a member of the leucine zipper family of DNA-binding proteins. Phosphorylated ATF2 (p-ATF2) was detected within 5 min of stimulation of the cells with Wnt5a. The amount of p-ATF2 increases progressively to 30 min, declining to basal levels from 60-120-min post-stimulation with Wnt5a. The amount of p38, established by immunoblotting, was unchanged by the treatment with Wnt5a. Clones expressing Fz1, rather than Fz2, display no significant accumulation of p-ATF2. To further test the hypothesis that Wnt5a treatment activates p38, we assayed the phosphorylation state of p38 MAPK itself, by immunoblotting (Fig. 1B). Wnt5a stimulates accumulation of the phosphorylated/activated form of p38 (p-p38), first detected at 5 min and peaking at 15 min following stimulation by Wnt5a (Fig. 1B). Analysis of known upstream regulators of p38 MAPK reveals that the phosphorylated/activated form of MAPK kinases (MKK) MKK3/6 (p-MKK3/6) is detected within 5 min of treatment with Wnt5a (Fig. 1C). The accumulation of p-MKK3/6 in response to stimulation with Wnt5a peaks at 30 min (Fig. 1C). These data clearly demonstrate that Wnt5a stimulates the p38 MAPK signaling pathway, culminating in the activation/phosphorylation of ATF2. Activation of p38 MAPK by Wnt5a Is G Protein (Gαt2)-mediated—Because Gαo and Gαt2 mediate Wnt5a signaling to PDE6 and Ca2+ mobilization in F9 cells (13Ahumada A. Slusarski D.C. Liu X. Moon R.T. Malbon C.C. Wang H.Y. Science. 2002; 298: 2006-2010Crossref PubMed Scopus (141) Google Scholar, 17Ma L. Wang H.Y. J. Biol. Chem. 2006; 281: 30990-31001Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), we examined their possible involvement in the Wnt5a activation of p38 MAPK. Treating these cells with pertussis toxin (50 ng/ml, for 2 h), which inactivates both Gαo and Gαt2, abolishes the ability of Wnt5a to activate p38, as measured by accumulation of p-ATF2 (Fig. 2A). We made use of antisense morpholinos to suppress Gαt2, Gαo, or Gαt1 (as a control, Fig. 2B). The morpholinos effectively target their cognate G protein α-subunits (13Ahumada A. Slusarski D.C. Liu X. Moon R.T. Malbon C.C. Wang H.Y. Science. 2002; 298: 2006-2010Crossref PubMed Scopus (141) Google Scholar) and effectively suppressed the expression of their targets by >75% (Fig. 2B, Table 1). Fz2 expressing F9 clones treated with antisense morpholinos targeting G protein subunits were assayed for the ability of Wnt5a to stimulate p38 MAPK phosphorylation as well as the phosphorylation of ATF2 (Fig. 2C). Suppression of Gαt2 effectively abolishes the ability of Wnt5a to stimulate p38 phosphorylation and activation (Fig. 2C). Suppression of either Gαo or Gαt1, in contrast, has no effect on the Wnt5a-stimulated signaling to p38 MAPK.TABLE 1Efficiency of knockdown of G protein subunits targeted by antisense morpholinosProtein antisenseControlGαt2GαoGαt1Gαt21.00 ± 0.040.23 ± 0.04ap<0.001 for the difference from the value observed for cells that were not treated with antisense morpholinos.1.06 ± 0.040.99 ± 0.03Gαo1.00 ± 0.040.95 ± 0.080.19 ± 0.04ap<0.001 for the difference from the value observed for cells that were not treated with antisense morpholinos.0.96 ± 0.08Gαt11.00 ± 0.090.99 ± 0.111.01 ± 0.040.23 ± 0.02ap<0.001 for the difference from the value observed for cells that were not treated with antisense morpholinos.a p<0.001 for the difference from the value observed for cells that were not treated with antisense morpholinos. Open table in a new tab If Gαt2 mediates Wnt5a-stimulated activation of p38 MAPK, one would predict that expression of a constitutively activated (CA-) mutant form of this G protein α-subunit might mimic the effects of Wnt5a, in the absence of the ligand. F9 clones were transiently transfected with an empty expression vector (EV) or an expression vector harboring a CA mutant form of various G protein α-subunits. Expression of Q204LGαt2 mimics the ability of Wnt5a to stimulate activation of p38 MAPK, as measured by immunoblotting with phosphospecific antibodies for active p38 (Fig. 2D). Treating the clones expressing Q204LGαt2 with Wnt5a does not further increase the activation of p38 MAPK observed by expression of the Q204LGαt2 alone. Expression of either Q205LGαo or Q209LGαq, in contrast, does not activate p38 MAPK signaling (Fig. 2D). Thus, on the basis of knock-down studies (Fig. 2C) and expression of CA mutant forms of Gα-subunits, Gαt2 appears to be obligate for Wnt5a to stimulate p38 MAPK. The best-known effector of Gαt2 is the cyclic GMP phosphodiesterase PDE6, which has been shown to be the effector for the Gαt2-mediated, Wnt5a-stimulated decline in intracellular cyclic GMP (13Ahumada A. Slusarski D.C. Liu X. Moon R.T. Malbon C.C. Wang H.Y. Science. 2002; 298: 2006-2010Crossref PubMed Scopus (141) Google Scholar, 25Malbon C.C. Nat. Rev. Mol. Cell. Biol. 2005; 6: 689-701Crossref PubMed Scopus (131) Google Scholar). Based upon this knowledge, we explored if a cyclic GMP analogue (i.e. β-phenyl-1,N2-etheno-8-bromo-cGMP or 8-Br-PET-cGMP), a PDE6-selective inhibitor (zaprinast), or a protein kinase G inhibitor (i.e. 8-(4-chlorophenylthio) guanosine-3′,5′-cyclic monophosphate Rp-isomer or Rp-8-pCPT-cyclic GMP) would impact the ability of Wnt5a to stimulate the activity of p38" @default.
• W2006077145 created "2016-06-24" @default.
• W2006077145 creator A5083903809 @default.
• W2006077145 creator A5086879777 @default.
• W2006077145 date "2007-09-01" @default.
• W2006077145 modified "2023-10-16" @default.
• W2006077145 title "Mitogen-activated Protein Kinase p38 Regulates the Wnt/Cyclic GMP/Ca2+ Non-canonical Pathway" @default.
• W2006077145 cites W1494249446 @default.
• W2006077145 cites W1549691444 @default.
• W2006077145 cites W1580526178 @default.
• W2006077145 cites W1775749144 @default.
• W2006077145 cites W1975853332 @default.
• W2006077145 cites W1978047924 @default.
• W2006077145 cites W1980087807 @default.
• W2006077145 cites W1989336494 @default.
• W2006077145 cites W2000352591 @default.
• W2006077145 cites W2015060440 @default.
• W2006077145 cites W2015890115 @default.
• W2006077145 cites W2017531120 @default.
• W2006077145 cites W2017668082 @default.
• W2006077145 cites W2033984390 @default.
• W2006077145 cites W2045822703 @default.
• W2006077145 cites W2050933562 @default.
• W2006077145 cites W2053488609 @default.
• W2006077145 cites W2055557491 @default.
• W2006077145 cites W2062644495 @default.
• W2006077145 cites W2068118215 @default.
• W2006077145 cites W2090636859 @default.
• W2006077145 cites W2100721730 @default.
• W2006077145 cites W2141108067 @default.
• W2006077145 cites W2146167376 @default.
• W2006077145 cites W2148371810 @default.
• W2006077145 cites W2151582261 @default.
• W2006077145 cites W2156715387 @default.
• W2006077145 cites W2166979814 @default.
• W2006077145 cites W2168714984 @default.
• W2006077145 cites W74239210 @default.
• W2006077145 doi "https://doi.org/10.1074/jbc.m702840200" @default.
• W2006077145 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17684012" @default.
• W2006077145 hasPublicationYear "2007" @default.
• W2006077145 type Work @default.
• W2006077145 sameAs 2006077145 @default.
• W2006077145 citedByCount "84" @default.
• W2006077145 countsByYear W20060771452012 @default.
• W2006077145 countsByYear W20060771452013 @default.
• W2006077145 countsByYear W20060771452014 @default.
• W2006077145 countsByYear W20060771452015 @default.
• W2006077145 countsByYear W20060771452016 @default.
• W2006077145 countsByYear W20060771452017 @default.
• W2006077145 countsByYear W20060771452018 @default.
• W2006077145 countsByYear W20060771452019 @default.
• W2006077145 countsByYear W20060771452020 @default.
• W2006077145 countsByYear W20060771452021 @default.
• W2006077145 countsByYear W20060771452022 @default.
• W2006077145 countsByYear W20060771452023 @default.
• W2006077145 crossrefType "journal-article" @default.
• W2006077145 hasAuthorship W2006077145A5083903809 @default.
• W2006077145 hasAuthorship W2006077145A5086879777 @default.
• W2006077145 hasBestOaLocation W20060771451 @default.
• W2006077145 hasConcept C132149769 @default.
• W2006077145 hasConcept C137620995 @default.
• W2006077145 hasConcept C181199279 @default.
• W2006077145 hasConcept C184235292 @default.
• W2006077145 hasConcept C185592680 @default.
• W2006077145 hasConcept C3018844941 @default.
• W2006077145 hasConcept C3020139451 @default.
• W2006077145 hasConcept C51551487 @default.
• W2006077145 hasConcept C55493867 @default.
• W2006077145 hasConcept C62478195 @default.
• W2006077145 hasConcept C86803240 @default.
• W2006077145 hasConcept C95444343 @default.
• W2006077145 hasConcept C97029542 @default.
• W2006077145 hasConceptScore W2006077145C132149769 @default.
• W2006077145 hasConceptScore W2006077145C137620995 @default.
• W2006077145 hasConceptScore W2006077145C181199279 @default.
• W2006077145 hasConceptScore W2006077145C184235292 @default.
• W2006077145 hasConceptScore W2006077145C185592680 @default.
• W2006077145 hasConceptScore W2006077145C3018844941 @default.
• W2006077145 hasConceptScore W2006077145C3020139451 @default.
• W2006077145 hasConceptScore W2006077145C51551487 @default.
• W2006077145 hasConceptScore W2006077145C55493867 @default.
• W2006077145 hasConceptScore W2006077145C62478195 @default.
• W2006077145 hasConceptScore W2006077145C86803240 @default.
• W2006077145 hasConceptScore W2006077145C95444343 @default.
• W2006077145 hasConceptScore W2006077145C97029542 @default.
• W2006077145 hasIssue "39" @default.
• W2006077145 hasLocation W20060771451 @default.
• W2006077145 hasOpenAccess W2006077145 @default.
• W2006077145 hasPrimaryLocation W20060771451 @default.
• W2006077145 hasRelatedWork W1976734851 @default.
• W2006077145 hasRelatedWork W1988519514 @default.
• W2006077145 hasRelatedWork W2004726042 @default.
• W2006077145 hasRelatedWork W2006077145 @default.
• W2006077145 hasRelatedWork W205417214 @default.
• W2006077145 hasRelatedWork W2058202339 @default.
• W2006077145 hasRelatedWork W2070643674 @default.
• W2006077145 hasRelatedWork W2354036423 @default.
• W2006077145 hasRelatedWork W3141260101 @default.

• next