FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006084593> ?p ?o ?g. }

• W2006084593 endingPage "10982" @default.
• W2006084593 startingPage "10970" @default.
• W2006084593 abstract "TDP-43 is an evolutionarily conserved ubiquitously expressed DNA/RNA-binding protein. Although recent studies have shown its association with a variety of neurodegenerative disorders, the function of TDP-43 remains poorly understood. Here we address TDP-43 function using spermatogenesis as a model system. We previously showed that TDP-43 binds to the testis-specific mouse acrv1 gene promoter in vitro via two GTGTGT-motifs and that mutation of these motifs led to premature transcription in spermatocytes of an otherwise round spermatid-specific promoter. The present study tested the hypothesis that TDP-43 represses acrv1 gene transcription in spermatocytes. Plasmid chromatin immunoprecipitation demonstrated that TDP-43 binds to the acrv1 promoter through GTGTGT motifs in vivo. Reporter gene assays showed that TDP-43 represses acrv1 core promoter-driven transcription via the N-terminal RRM1 domain in a histone deacetylase-independent manner. Consistent with repressor role, ChIP on physiologically isolated germ cells confirmed that TDP-43 occupies the endogenous acrv1 promoter in spermatocytes. Surprisingly, however, TDP-43 remains at the promoter in round spermatids, which express acrv1 mRNA. We show that RNA binding-defective TDP-43, but not splice variant isoforms, relieve repressor function. Transitioning from repressive to active histone marks has little effect on TDP-43 occupancy. Finally, we found that RNA polymerase II is recruited but paused at the acrv1 promoter in spermatocytes. Because mutation of TDP-43 sites caused premature transcription in spermatocytes in vivo, TDP-43 may be involved in pausing RNAPII at the acrv1 promoter in spermatocytes. Overall, our study shows that TDP-43 is a transcriptional repressor and that it regulates spatiotemporal expression of the acrv1 gene during spermatogenesis. TDP-43 is an evolutionarily conserved ubiquitously expressed DNA/RNA-binding protein. Although recent studies have shown its association with a variety of neurodegenerative disorders, the function of TDP-43 remains poorly understood. Here we address TDP-43 function using spermatogenesis as a model system. We previously showed that TDP-43 binds to the testis-specific mouse acrv1 gene promoter in vitro via two GTGTGT-motifs and that mutation of these motifs led to premature transcription in spermatocytes of an otherwise round spermatid-specific promoter. The present study tested the hypothesis that TDP-43 represses acrv1 gene transcription in spermatocytes. Plasmid chromatin immunoprecipitation demonstrated that TDP-43 binds to the acrv1 promoter through GTGTGT motifs in vivo. Reporter gene assays showed that TDP-43 represses acrv1 core promoter-driven transcription via the N-terminal RRM1 domain in a histone deacetylase-independent manner. Consistent with repressor role, ChIP on physiologically isolated germ cells confirmed that TDP-43 occupies the endogenous acrv1 promoter in spermatocytes. Surprisingly, however, TDP-43 remains at the promoter in round spermatids, which express acrv1 mRNA. We show that RNA binding-defective TDP-43, but not splice variant isoforms, relieve repressor function. Transitioning from repressive to active histone marks has little effect on TDP-43 occupancy. Finally, we found that RNA polymerase II is recruited but paused at the acrv1 promoter in spermatocytes. Because mutation of TDP-43 sites caused premature transcription in spermatocytes in vivo, TDP-43 may be involved in pausing RNAPII at the acrv1 promoter in spermatocytes. Overall, our study shows that TDP-43 is a transcriptional repressor and that it regulates spatiotemporal expression of the acrv1 gene during spermatogenesis. TAR DNA-binding protein of 43 kDa (TDP-43) 3The abbreviations used are: TDP-4343-kDa transactivation response (TAR) DNA-binding proteinhTDP-43human TDP-43HDAChistone deacetylaseDBDDNA binding domainqPCRquantitative PCRRRM1RNA recognition motif 1H3K4me3histone H3 lysine 4 trimethylationH3K9Achistone H3 acetylated K9H3K9Me2histone H3 dimethylated K9RNAPIIRNA polymerase IINELFnegative elongation factorANOVAanalysis of variance. is an evolutionarily conserved, ubiquitously expressed DNA/RNA binding nuclear protein. It was originally identified from a HeLa cell cDNA library as a transcription factor binding to the HIV transactivation response region (1Ou S.H. Wu F. Harrich D. García-Martínez L.F. Gaynor R.B. J. Virol. 1995; 69: 3584-3596Crossref PubMed Google Scholar). In vitro transcription as well as transient transfection assays showed that TDP-43 repressed HIV transactivation response mediated transcription (1Ou S.H. Wu F. Harrich D. García-Martínez L.F. Gaynor R.B. J. Virol. 1995; 69: 3584-3596Crossref PubMed Google Scholar). Since that initial report, the role of TDP-43 in transcription has not been studied. Subsequent studies have focused on the roles of TDP-43 in mRNA splicing and stability (2Buratti E. Baralle F.E. Front. Biosci. 2008; 13: 867-878Crossref PubMed Scopus (385) Google Scholar). Interest in TDP-43, however, increased exponentially after the discovery in 2006 that aberrantly truncated, phosphorylated, and mislocalized TDP-43 was present in the intracellular ubiquitinated inclusions in the brains of patients with frontotemporal lobar degeneration with ubiquitin-positive inclusions, amyotrophic lateral sclerosis, and Alzheimer disease (3Neumann M. Sampathu D.M. Kwong L.K. Truax A.C. Micsenyi M.C. Chou T.T. Bruce J. Schuck T. Grossman M. Clark C.M. McCluskey L.F. Miller B.L. Masliah E. Mackenzie I.R. Feldman H. Feiden W. Kretzschmar H.A. Trojanowski J.Q. Lee V.M. Science. 2006; 314: 130-133Crossref PubMed Scopus (4595) Google Scholar). Although a large number of reports have since confirmed the link between TDP-43 and human neurodegenerative disorders, it is not yet clear how TDP-43 contributes to disease. This is due to the fact that very little is known about the normal nuclear function of TDP-43 (4Chen-Plotkin A.S. Lee V.M. Trojanowski J.Q. Nat. Rev. Neurol. 2010; 6: 211-220Crossref PubMed Scopus (341) Google Scholar). Understanding TDP-43 nuclear function is important to determine the contribution of loss-of-function to TDP proteinopathies. The evolutionarily conserved TDP-43 must play a fundamental role in biological processes because knock-out of TDP-43 leads to embryonic lethality in mice (5Sephton C.F. Good S.K. Atkin S. Dewey C.M. Mayer 3rd, P. Herz J. Yu G. J. Biol. Chem. 2010; 285: 6826-6834Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar, 6Wu L.S. Cheng W.C. Hou S.C. Yan Y.T. Jiang S.T. Shen C.K. Genesis. 2010; 48: 56-62PubMed Google Scholar, 7Kraemer B.C. Schuck T. Wheeler J.M. Robinson L.C. Trojanowski J.Q. Lee V.M. Schellenberg G.D. Acta Neuropathol. 2010; 119: 409-419Crossref PubMed Scopus (246) Google Scholar). 43-kDa transactivation response (TAR) DNA-binding protein human TDP-43 histone deacetylase DNA binding domain quantitative PCR RNA recognition motif 1 histone H3 lysine 4 trimethylation histone H3 acetylated K9 histone H3 dimethylated K9 RNA polymerase II negative elongation factor analysis of variance. TDP-43 contains two RNA recognition motifs in the N-terminal half with which it recognizes UG/TG repeats in RNA/DNA and a C-terminal glycine-rich domain, considered important for protein-protein interactions (8Buratti E. Brindisi A. Pagani F. Baralle F.E. Am. J. Hum. Genet. 2004; 74: 1322-1325Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar). TDP-43 resembles the heterogeneous nuclear ribonucleoprotein family of RNA-binding proteins in terms of primary structure. Consistent with this, TDP-43 has been shown to bind RNA and regulate mRNA splicing in vitro and in cell culture assays (9Buratti E. Baralle F.E. J. Biol. Chem. 2001; 276: 36337-36343Abstract Full Text Full Text PDF PubMed Scopus (504) Google Scholar). Work from our laboratory on testis-specific gene transcription, however, has shown that TDP-43 plays an additional role as a transcription factor (10Acharya K.K. Govind C.K. Shore A.N. Stoler M.H. Reddi P.P. Dev. Biol. 2006; 295: 781-790Crossref PubMed Scopus (57) Google Scholar, 11Abhyankar M.M. Urekar C. Reddi P.P. J. Biol. Chem. 2007; 282: 36143-36154Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Our studies utilize the mouse acrv1 gene, which codes for the sperm acrosomal protein SP-10, as a model gene to understand the mechanisms of testis-specific gene transcription. The acrv1 mRNA is transcribed exclusively in the post meiotic round spermatids during spermatogenesis (12Reddi P.P. Flickinger C.J. Herr J.C. Biol. Reprod. 1999; 61: 1256-1266Crossref PubMed Scopus (53) Google Scholar). We cloned TDP-43 from a mouse testis cDNA library as a transcription factor binding to the acrv1 promoter (10Acharya K.K. Govind C.K. Shore A.N. Stoler M.H. Reddi P.P. Dev. Biol. 2006; 295: 781-790Crossref PubMed Scopus (57) Google Scholar). The acrv1 promoter contains two GTGTGT motifs, canonical TDP-43 binding sites, at −172 and −160 positions on the antisense strand. EMSAs showed that recombinant TDP-43 binds to this region in a GTGTGT-dependent manner. Furthermore, our previous work using transgenic mice as a reporter system showed that mutation of the GTGTGT motifs in the −186/+28 acrv1 promoter leads to premature expression of a reporter gene in the meiotic spermatocytes, whereas the wild-type −186/+28 acrv1 promoter delivers correct post meiotic round spermatid-specific reporter gene expression (10Acharya K.K. Govind C.K. Shore A.N. Stoler M.H. Reddi P.P. Dev. Biol. 2006; 295: 781-790Crossref PubMed Scopus (57) Google Scholar). TDP-43 is expressed in spermatocytes as well as round spermatids. Based on the above data we hypothesized that TDP-43 represses the acrv1 gene transcription in spermatocytes. The present work addressed the following questions. 1) Does TDP-43 function as a transcriptional repressor, and if so, what are the domains necessary for repression? 2) Does TDP-43 bind to its putative target gene (acrv1) promoter in vivo in a physiological context? 3) How might TDP-43 transcriptional function be modulated? 4) What is the status of histone marks and RNAPII associated with TDP-43 promoter occupancy in vivo? Results presented in this study establish that TDP-43 is a transcriptional repressor and that the mouse acrv1 gene is a bona fide target gene for TDP-43 mediated repression in vivo. Mouse GC-2 spermatogenic cells (ATCC catalogue number CRL-2196) and HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum, 1% l-glutamate, and 1% nonessential amino acids. COS-7 cells were maintained in DMEM with 10% fetal calf serum. Mouse IgG Whole Molecule (Thermo Fisher Scientific; 31202), anti-guinea pig TDP-43 (in house); anti-rabbit TDP-43 (Abcam (Cambridge, MA); #50502), anti-RNAP II (Covance; Clone 8WG16; MPY-127R), anti-RNAPII phosphoserine 2 (Covance; Clone H5; MMS-129R), anti-RNAPII phosphoserine 5 (Covance; Clone H14; MMS-134R), anti-NELF-E monoclonal antibody raised against human full-length NELF-E (a kind gift from Dr. Yuki Yamaguchi, Yokohama, Japan), anti-pan aceylated-H3 (Ac-H3; Upstate Biotechnology; 06-599), anti-histone H3 lysine 4 trimethylation (H3K4me3; Upstate; 07-473), anti-H3 lysine 9 dimethylation (H3K9me2; Upstate; 07-441), anti-H3 lysine acetylation (H3K9ac; Abcam; ab4441), anti-FLAG (Sigma; F3165), anti-Gal4 DNA binding domain (DBD) (sc-510), anti-α-tubulin (Sigma; T9026), Cy3-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratories; 115-165-003), Cy3-conjugated anti-guinea pig IgG (Jackson ImmunoResearch Laboratories; 106-165-003), 4′,6-diamidino-2-phenylindole (DAPI) (Molecular Probes (Eugene, OR); D-1306), and normal goat serum (Jackson ImmunoResearch Laboratories; 005-000-121). Pure populations (> 95% purity) of spermatocytes and round spermatids were isolated by Sta-Put gradient as described (10Acharya K.K. Govind C.K. Shore A.N. Stoler M.H. Reddi P.P. Dev. Biol. 2006; 295: 781-790Crossref PubMed Scopus (57) Google Scholar, 11Abhyankar M.M. Urekar C. Reddi P.P. J. Biol. Chem. 2007; 282: 36143-36154Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The outer membrane of each testis was decapsulated using forceps, and the seminiferous epithelia (tubules) were collected in a 10-cm dish and washed in 10 ml of DMEM. Tubules were dissociated in 10 mg of collagenase and 20 μg of DNase in 8.5 ml of DMEM for 10 min in a 37 °C incubator with gentle disruption. Tubules were washed twice with cold DMEM. The germ cells were released by enzymatic treatment with 7 mg of collagenase, 15 mg of hyaluronidase, 10 mg of trypsin, and 20 μg of DNase in 8.5 mg of DMEM for 10 min in the 37 °C incubator as before. Tubules were cut to 5-mm lengths with scissors to further enhance the digestion during enzymatic treatment. The entire volume was transferred to a 50-ml conical tube, reconstituted in 45 ml of DMEM, and allowed to sediment for 10 min on ice to separate the heavier tubule pieces away from the germ cells. The supernatants containing the germ cells were transferred to a fresh conical tube and centrifuged at 900 × g for 10 min at 4 °C. The cells were washed twice with PBS and loaded onto a 2–4% BSA Sta-Put gradient to separate the larger spermatocytes and smaller spermatids by gravity sedimentation for 3 h at 4 °C. Fractions (300 drops per fraction) of the heavier spermatocytes first followed by lighter round spermatids were collected over a 1-h period. Every fifth fraction of an average total of 70 fractions was observed under a light microscope to identify spermatocyte and round-spermatid fractions based on their morphology. Fractions of spermatocytes and round spermatids were centrifuged at 900 x g for 20 min at 4 °C and pooled separately. On average, the testes of 11 Swiss Webster mice (10–12 weeks old) yielded 22 × 106 spermatocytes and 104 × 106 round spermatids. The spermatocytes and round spermatids obtained were fixed in 1% formaldehyde and divided into 10 × 106 spermatocytes and 40 × 106 round spermatid aliquots for chromatin immunoprecipitations (ChIPs). Spermatocytes and spermatids were separated by Sta Put method and flash-frozen in liquid nitrogen. 3 × 106 cells of each cell type were used to isolate RNA using the RNeasy Mini kit (Qiagen; 74104) adding the optional DNase step (Qiagen; 79254). Cells were disrupted using a homogenizer. cDNA was generated with 2 μg of RNA using the AffinityScript Multi Temperature cDNA Synthesis kit (Stratagene; 200436) at a temperature of 55 °C, with the TDP specific primer, TDP nested Rev1, CAGGTGATGAATCCATTTGACTTGA. This primer sits at bp 3138 of NM_145556. For cloning out potential splice variants, we used the information available on GenBankTM for currently identified splice variants. The splice variants currently in the data base are of three different groups; that is, the annotated full-length protein and some C-terminal deletion (encompassing the Gly domain) variants that end with one of two different novel exons. Using a primer set that starts at the common ATG and ends at the most 3′ exon (the second novel terminal exon) will yield all splice variants currently in the data base (supplemental Fig. S3A). These primers were: TDP-43 forward (ATGTCTGAATATATTCGG) and TDP-43 reverse (v2, TCAAAGACGCAGCCTGT). The latter primer sits at bp 2268 of NM_145556. The products of the above PCR were cloned using the TOPO TA cloning kit (Invitrogen; K461020). The products that deviated in size from the full-length protein were sequenced. Two major species were identified. One was spermatocyte-specific, and the other was spermatid-specific. These two splice variants differed by only 9 base pairs. There were several additional products that contained TDP sequence; however, these either did not code for a protein or had retained introns. Western blotting analysis of specific histone marks was carried out after histone extraction as described by Abcam. In brief, 107 GC-2 cells were harvested and washed in ice-cold PBS supplemented with 5 mm sodium butyrate. Cells were resuspended in Triton extraction buffer (0.5% Triton X-100, 2 mm phenylmethylsulfonyl fluoride (PMSF), 0.02% NaN3 in PBS) for 10 min at 4 °C with gentle end-to-end shaking. Nuclei were pelleted at 6500 × g for 10 min at 4 °C. Nuclei were recovered, washed in Triton extraction buffer, and pelleted again. Acid extraction of histones were carried out in 0.2 n HCl overnight at 4 °C. Samples were centrifuged as before, and supernatants containing histone proteins were recovered. GC-2 cells (0.2 × 106/well) were grown on glass coverslips in 6-well chambers. Cells were transfected with Gal4-TDP-43 (wild-type) and all of the Gal4-TDP43 mutant constructs used in this study (1 μg/well) using Mirus TransIT®-LT1 to determine subcellular localization of the fusion proteins. Transfection of Gal4 DBD alone served as a control. All cells were fixed 48 h post-transfection in 4% buffered paraformaldehyde (Alfa Aaser; 43368) in PBS for 10 min at room temperature. Cells were permeabilized and blocked in 0.2% Triton X-100 and 10% normal goat serum in PBS for 10 min. Primary antibody incubations were carried out with either anti-GAL4 DBD (1:200) or anti-TDP-43 (in-house; 1:400) antibodies at room temperature for 35 min in 10% normal goat serum in PBS-Tween. Secondary antibody incubations were carried out at room temperature for 20 min. Anti-mouse (1:200) CY3-conjugated secondary antibodies diluted in 10% normal goat serum in PBS-Tween was used for visualization of anti-Gal4 DBD. Nuclei were stained with DAPI. Cells were visualized using an Olympus BX50 microscope. Nuclear localization was observed for all of the Gal4 TDP-43 fusion constructs used in this study (supplemental Figs. S1, A and B, and S4). Full-length mouse TDP-43 (mTDP-43; amino acids 1–414) was cloned in pFLAG-CMV and pFA-CMV vectors (Stratagene). The pFA-CMV clone was used as a template to generate two N-terminal truncation constructs (104–414, 191–414), two C-terminal truncations (1–200, 1–262), and 4 domain constructs as follows: RNA recognition motif 1 (RRM1) (104–200), RRM2 (191–262), RRM1 + 2 (104–262), Gly (274–414). Human TDP-43 (hTDP-43), ΔRRM1 (hTDP-43 ΔRRM1), and amino acid 147/149 mutant (hTDP-43 F147L/F149L) in pFLAG-CMV-2 vectors were kind gifts from Dr. Emanuele Buratti (13Ayala Y.M. Zago P. D'Ambrogio A. Xu Y.F. Petrucelli L. Buratti E. Baralle F.E. J. Cell Sci. 2008; 121: 3778-3785Crossref PubMed Scopus (413) Google Scholar). These 3 hTDP-43 clones were cloned into pFA-CMV vectors (Stratagene). DBD-p53 activation domain was a kind gift from Dr. Rong Li (UT Health Science Center, Dept. of Molecular Medicine, San Antonio, TX). The −91/+28 ACRV1 reporter containing 5 Gal binding sites has been previously described (11Abhyankar M.M. Urekar C. Reddi P.P. J. Biol. Chem. 2007; 282: 36143-36154Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Briefly, 5X Gal element was PCR-amplified from the pFR-Luc plasmid (Stratagene) and ligated into the BGIII site of pGL3 −91/+28 Luc. The c-fos reporter containing four Gal binding sites was a kind gift from Dr. Rong Li and has been described elsewhere (14Miyake T. Hu Y.F. Yu D.S. Li R. J. Biol. Chem. 2000; 275: 40169-40173Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 15Salghetti S.E. Kim S.Y. Tansey W.P. EMBO J. 1999; 18: 717-726Crossref PubMed Scopus (383) Google Scholar). Transient transfections were performed in GC-2 and HeLa cells and COS-7 cells using Mirus TransIT®-LT1 (Mirus Corp.). 2 × 105 cells were plated overnight in 6-well tissue culture plates (BD Biosciences; 353046). Cells were 40–50% confluent at the time of transfections. 0.5 μg of reporter and 1 μg of effector (DBD-TDP-43 or empty vector DBD alone) were transfected per well GC-2 cell transfections. 0.2 μg of reporter was used per well of HeLa cell transfections. Renilla Luciferase was co-transfected at a 1:10 ratio. Cells were harvested 48 h post-transfection. Luciferase activities were measured by the Dual Luciferase reporter assay system (Promega) according to the instructions provided with the kit. For experiments using HDAC inhibitors, cells were treated 24 h post-transfection, and drug treatments lasted 24 h. The reporter luciferase values were first divided by the Renilla luciferase values to normalize for transfection efficiency. These ratios were then expressed as a -fold change of control DBD vector-alone set as 1. Therefore, transcriptional repression with DBD-TDP-43 was defined as a value significantly lower than 1 as determined by one-way ANOVA followed by Bonferroni post-hoc test. To verify whether the DBD fusion proteins were expressed correctly, the insoluble cellular material from the reporter assay experiments treated with the passive lysis buffer supplied with the Dual Luciferase assays system (Promega) was used. These samples were solubilized in 1× Laemmli buffer, separated by SDS-PAGE, and blotted with anti-DBD antibody. Western blots indicated that all of the DBD-TDP-43 constructs used in reporter assays in this study expressed fusion proteins of the expected molecular weight (supplemental Figs. S1B and S3C and Fig. 5C). ChIPs were performed as described (16Lalmansingh A.S. Uht R.M. Endocrinology. 2008; 149: 346-357Crossref PubMed Scopus (72) Google Scholar). Cells were fixed with 1% formaldehyde in PBS for 20 min at room temperature, and cross-linking was stopped by adding 0.125 m glycine (Fisher; G45–212) for 5 min. Cells were pelleted at 170 × g for 10 min at 4 °C, washed twice with ice-cold PBS, and resuspended in 1 ml sonication buffer (1% Triton X-100, 0.1% deoxycholate, 50 mm Tris, pH 8.1, 150 mm NaCl, 5 mm EDTA) with protease inhibitors (2 μg of leupeptin (Sigma; L2884), 2 μg of aprotinin (Fisher; BP250310), 0.2 mm PMSF (Sigma; P7626)). Chromatin was sheared using a Sonicator W375 (Heat Systems-Ultrasonics, Inc., Farmingdale, NY). Sheared chromatin was precleared with 60 μl of protein A/G beads (Santa Cruz; sc-2003) and 2 μg of herring sperm DNA (Sigma; D3159) for 1 h at 4 °C. 200 μg of soluble chromatin was used for immunoprecipitation with control IgG antibody or specific target protein antibody (described above). 20 μg of chromatin was used to generate Input DNA for real-time quantitative PCR (qPCR) analysis, used as a reference for quantifying target DNA within immunoprecipitated samples. Chromatin was incubated with antibody overnight at 4 °C with rotation, after which 50 μl of protein A/G beads and 2 μg of herring sperm DNA was added for 2 h. The beads were washed sequentially with 1 ml each of sonication buffer containing high salt (500 mm NaCl), LiCl wash buffer (0.25 m LiCl, 0.5% IGEPAL CA-630, 0.5% deoxycholate, 0.01 m Tris, pH 8.1, 1 mm EDTA), and TE buffer (10 mm Tris, pH 7.5, 1 mm EDTA). Chromatin was eluted twice with 250 μl of elution buffer (1% SDS, 0.1 m NaHCO3, 0.01 mg/ml herring sperm DNA). Input and immunoprecipitated samples were then heated to 65 °C in a water bath for 4 h to reverse the formaldehyde cross-links. DNA fragments were ethanol-precipitated overnight at −20 °C and centrifuged at 16, 060 x g for 20 min at 4 °C to pellet the DNA. Pelleted DNA was washed with 70% ethanol, air-dried for 10 min, resuspended in 100 μl of TE buffer with 11 μl of proteinase K buffer (0.1 m Tris pH 7.5, 0.05 m EDTA, 5% SDS) and 1 μg of proteinase K (Bioline; BIO-37037), and heated to 55 °C in a water bath for 1 h. Samples were then diluted 4 times with TE buffer, extracted once with 500 μl phenol chloroform isoamyl alcohol (25:24:1), and ethanol-precipitated overnight at −20 °C. Precipitated DNA was centrifuged at 16,060 × g for 15 min at 4 °C, washed with 70% ethanol, air-dried for 10 min, and finally resuspended in 100 μl of TE buffer for qPCR. 3-μl aliquots of each sample was used in triplicate for qPCR analysis of the acrv1 promoter (−267 to +27) or a far downstream region (+5652 to +5930). Thermal cycling was performed using an iCycler (Bio-Rad). SYBR Green I dye (Molecular Probes) was added at a 1:75,000 dilution in each 25-μl PCR reaction. qPCR was performed in triplicate so that an average correlation time (Tc) was determined for each Input sample, each control immunoprecipitation sample, and each antibody immunoprecipitation sample. Enrichments relative to Input DNA were calculated by using the 2ΔTc formula where ΔTc represents the cycle difference between each IP sample and input. Finally, all relative enrichments of DNA in antibody immunoprecipitation samples were expressed as -fold of control IgG samples set as 1. Factor binding to the acrv1 gene was determined to be significantly enriched using one-way ANOVA followed by the Bonferroni post-hoc test to determine difference from IgG background. Amplification of a downstream region of the acrv1 promoter at +5652 bp was used to indicate specificity of factor binding to the proximal acrv1 promoter. For plasmid-based ChIPs, transfections were performed in COS-7 cells. 1.5 × 106 cells were plated overnight in 100-mm tissue culture dishes (Corning Inc.; #430167). 3 μg of plasmid (bearing either wild-type or GTGTGT-mutant −186 + 28 acrv1 promoter) and 3 μg of FLAG TDP-43 were transfected as described above. ChIPs were performed as described above. 500 μg of soluble chromatin was immunoprecipitated with control IgG or anti-FLAG antibody. 3-μl aliquots of each sample was used in triplicate for qPCR analysis using plasmid-specific PCR primers (−186 to +27). Factor binding to the acrv1 plasmid promoter was determined to be significantly enriched using one-way ANOVA followed by the Bonferroni post-hoc test to determine difference from IgG background. Primers were: −267 acrv1 forward (GACCCTCTGCAAAGAAGTGC), −186 acrv1 forward (AGGATCCGAAGCTACCCCTA), +27 acrv1 reverse (GGCACACTCAAGAGCTGAGA); +5652 acrv1 forward (GAACAAAGTGAATGTTGTGCACAATC), and +5930 acrv1 reverse (TCAGTCATTCCAGGAGCTGG). All data are expressed as the mean ± S.E. Statistical analysis consisted of one-way ANOVAs followed by Bonferroni post tests to determine which means differ (p < 0.05). All data analyses were performed using the Number Cruncher Statistical System program (NCSS, Kaysville, UT). Here we directly tested the potential of TDP-43 to repress the acrv1 gene promoter using mouse spermatocyte cell line GC-2 and Gal 4 recruitment strategy. A luciferase reporter plasmid bearing five tandem Gal 4 binding sites upstream of the acrv1 core promoter (−91/+28) was constructed as a reporter (Fig. 1A). Full-length mouse TDP-43 was expressed as a fusion protein with the Gal4 DBD. Gal4DBD or Gal4DBD-TDP-43 plasmids were co-transfected with the above reporter plasmid into mouse GC-2 cells. The cells were harvested 48 h later, and luciferase activities were measured and normalized for transfection efficiencies. Transcriptional output from the vector expressing Gal4 DBD alone was used as the base line. The Gal4DBD-TDP-43 fusion protein repressed transcription of the reporter gene in a statistically significant manner, whereas the untargeted TDP-43 (FLAG-TDP-43) had no effect (Fig. 1B), indicating that the repressor effect of DBD-TDP-43 is a direct effect on the reporter gene. The positive control DBD-p53AD (activation domain of p53; a bona fide transcriptional activator) showed elevated reporter gene activity as expected. The DBD part contains a canonical nuclear localization signal that directs the location of the fusion proteins. Nuclear localization (supplemental Fig. S1A) as well as migration at the expected molecular size was verified (supplemental Fig. S1B) for all of the DBD-TDP43 fusion proteins used in reporter assays. The above results showed that TDP-43 represses transcription in the context of the acrv1 core promoter in a cell line (GC-2) of the spermatogenic lineage. Because TDP-43 is a ubiquitously expressed protein, we have also tested its function in the context of the generic c-fos minimal promoter in HeLa cells and found that TDP-43 acts as a repressor in that system as well (supplemental Fig. S2). These data suggest that the ubiquitously expressed TDP-43 protein likely functions as a repressor of transcription in multiple tissues. TDP-43 contains two RNA recognition motifs (RRM) in the N-terminal and a glycine-rich domain in the C-terminal halves (schematic in Fig. 1B). To identify which part of TDP-43 is responsible for transcriptional repression, we generated N- and C-terminal truncations of TDP-43 and expressed them as DBD fusion proteins. The DBD-TDP-43 fusion protein expression plasmids were cotransfected with 5XGal4 luciferase reporter as before. Deletion of the C-terminal portion did not alter the repressor function of TDP-43, as the 1–200 and 1–262 regions repressed transcription in a statistically significant manner (Fig. 1C). In contrast, removal of the N-terminal 191 amino acids completely abolished transcriptional repression, whereas deletion of only the first 104 amino acids maintained repression (Fig. 1C). These data showed that the 104–191 region corresponding to RRM1 is critical for the repressor function of TDP-43. To test whether RRM1 alone is sufficient for transcriptional repression, we made DBD-RRM1, DBD-RRM2, DBD-RRM1 + 2, and DBD-GLY domain fusion proteins and performed functional assays as above. The RRM1 domain alone or in combination with RRM2 caused statistically significant repression of transcription, whereas the RRM2 domain alone did not (Fig. 1D). The context of amino acids 1–104 also augmented the repressor function of RRM1 (Fig. 1C, DBD 1–200). An earlier study showed that TDP-43 1–95 region by itself does not repress transcription (1Ou S.H. Wu F. Harrich D. García-Martínez L.F. Gaynor R.B. J. Virol. 1995; 69: 3584-3596Crossref PubMed Google Scholar). This suggests that the repressor activity of DBD 1–200 is contributed by the RRM1 region. On the other hand, the C-terminal 274–414 region containing the glycine-rich domain up-regulated reporter a" @default.
• W2006084593 created "2016-06-24" @default.
• W2006084593 creator A5015380232 @default.
• W2006084593 creator A5031450624 @default.
• W2006084593 creator A5051408938 @default.
• W2006084593 date "2011-04-01" @default.
• W2006084593 modified "2023-10-16" @default.
• W2006084593 title "TDP-43 Is a Transcriptional Repressor" @default.
• W2006084593 cites W1511534554 @default.
• W2006084593 cites W1967932847 @default.
• W2006084593 cites W1977290507 @default.
• W2006084593 cites W1978212578 @default.
• W2006084593 cites W1984145170 @default.
• W2006084593 cites W1991234732 @default.
• W2006084593 cites W2003618511 @default.
• W2006084593 cites W2008092626 @default.
• W2006084593 cites W2011396520 @default.
• W2006084593 cites W2015462677 @default.
• W2006084593 cites W2015574691 @default.
• W2006084593 cites W2023311454 @default.
• W2006084593 cites W2026931179 @default.
• W2006084593 cites W2027720028 @default.
• W2006084593 cites W2029925836 @default.
• W2006084593 cites W2035974120 @default.
• W2006084593 cites W2037602187 @default.
• W2006084593 cites W2051582477 @default.
• W2006084593 cites W2053773691 @default.
• W2006084593 cites W2060076138 @default.
• W2006084593 cites W2069350252 @default.
• W2006084593 cites W2076047037 @default.
• W2006084593 cites W2078616043 @default.
• W2006084593 cites W2088017477 @default.
• W2006084593 cites W2089422977 @default.
• W2006084593 cites W2095911393 @default.
• W2006084593 cites W2098513996 @default.
• W2006084593 cites W2107754763 @default.
• W2006084593 cites W2114909406 @default.
• W2006084593 cites W2123812291 @default.
• W2006084593 cites W2131725903 @default.
• W2006084593 cites W2139267086 @default.
• W2006084593 cites W2143658931 @default.
• W2006084593 cites W2154417593 @default.
• W2006084593 cites W2164828556 @default.
• W2006084593 cites W54353042 @default.
• W2006084593 doi "https://doi.org/10.1074/jbc.m110.166587" @default.
• W2006084593 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3064152" @default.
• W2006084593 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21252238" @default.
• W2006084593 hasPublicationYear "2011" @default.
• W2006084593 type Work @default.
• W2006084593 sameAs 2006084593 @default.
• W2006084593 citedByCount "61" @default.
• W2006084593 countsByYear W20060845932012 @default.
• W2006084593 countsByYear W20060845932013 @default.
• W2006084593 countsByYear W20060845932014 @default.
• W2006084593 countsByYear W20060845932015 @default.
• W2006084593 countsByYear W20060845932016 @default.
• W2006084593 countsByYear W20060845932017 @default.
• W2006084593 countsByYear W20060845932018 @default.
• W2006084593 countsByYear W20060845932019 @default.
• W2006084593 countsByYear W20060845932020 @default.
• W2006084593 countsByYear W20060845932021 @default.
• W2006084593 countsByYear W20060845932022 @default.
• W2006084593 countsByYear W20060845932023 @default.
• W2006084593 crossrefType "journal-article" @default.
• W2006084593 hasAuthorship W2006084593A5015380232 @default.
• W2006084593 hasAuthorship W2006084593A5031450624 @default.
• W2006084593 hasAuthorship W2006084593A5051408938 @default.
• W2006084593 hasBestOaLocation W20060845931 @default.
• W2006084593 hasConcept C104317684 @default.
• W2006084593 hasConcept C158448853 @default.
• W2006084593 hasConcept C185592680 @default.
• W2006084593 hasConcept C54355233 @default.
• W2006084593 hasConcept C70721500 @default.
• W2006084593 hasConcept C86339819 @default.
• W2006084593 hasConcept C86803240 @default.
• W2006084593 hasConcept C95444343 @default.
• W2006084593 hasConceptScore W2006084593C104317684 @default.
• W2006084593 hasConceptScore W2006084593C158448853 @default.
• W2006084593 hasConceptScore W2006084593C185592680 @default.
• W2006084593 hasConceptScore W2006084593C54355233 @default.
• W2006084593 hasConceptScore W2006084593C70721500 @default.
• W2006084593 hasConceptScore W2006084593C86339819 @default.
• W2006084593 hasConceptScore W2006084593C86803240 @default.
• W2006084593 hasConceptScore W2006084593C95444343 @default.
• W2006084593 hasIssue "13" @default.
• W2006084593 hasLocation W20060845931 @default.
• W2006084593 hasLocation W20060845932 @default.
• W2006084593 hasLocation W20060845933 @default.
• W2006084593 hasLocation W20060845934 @default.
• W2006084593 hasOpenAccess W2006084593 @default.
• W2006084593 hasPrimaryLocation W20060845931 @default.
• W2006084593 hasRelatedWork W1828691184 @default.
• W2006084593 hasRelatedWork W1903732681 @default.
• W2006084593 hasRelatedWork W1991523530 @default.
• W2006084593 hasRelatedWork W2002128513 @default.
• W2006084593 hasRelatedWork W2020824267 @default.
• W2006084593 hasRelatedWork W2031436818 @default.
• W2006084593 hasRelatedWork W2057739827 @default.

• next