FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006099689> ?p ?o ?g. }

• W2006099689 endingPage "20506" @default.
• W2006099689 startingPage "20500" @default.
• W2006099689 abstract "Cytochrome c maturation in the periplasms of many bacteria requires the heme chaperone CcmE, which binds heme covalently both in vivo and in vitro via a histidine residue before transferring the heme to apocytochromes c. To investigate the mechanism and specificity of heme attachment to CcmE, we have mutated the conserved histidine 130 of a soluble C-terminally His-tagged version of CcmE (CcmEsol-C-His6) from Escherichia coli to alanine or cysteine. Remarkably, covalent bond formation with heme occurs with the protein carrying the cysteine mutation, and the process occurs both in vivo and in vitro. The yield of holo-H130C CcmEsol-C-His6 produced in vivo is low compared with the wild type. In vitro heme attachment occurs only under reducing conditions. We demonstrate the involvement of one of the heme vinyl groups and a side chain at residue 130 in the bond formation by showing that in vitro attachment does not occur either with the heme analogue mesoheme or when alanine is present at residue 130. These results have implications for the mechanism of heme attachment to the histidine of CcmE. In vitro, CcmEsol lacking a His tag binds 8-anilino-1-naphthalenesulphonate and heme, the latter both noncovalently and via a covalent bond from the histidine side chain, similarly to the tagged proteins, thus countering a recent proposal that the His tag causes the heme binding. However, the His tag does appear to enhance the rate of in vitro covalent heme binding and to affect the heme ligation in the ferric b-type cytochrome form. Cytochrome c maturation in the periplasms of many bacteria requires the heme chaperone CcmE, which binds heme covalently both in vivo and in vitro via a histidine residue before transferring the heme to apocytochromes c. To investigate the mechanism and specificity of heme attachment to CcmE, we have mutated the conserved histidine 130 of a soluble C-terminally His-tagged version of CcmE (CcmEsol-C-His6) from Escherichia coli to alanine or cysteine. Remarkably, covalent bond formation with heme occurs with the protein carrying the cysteine mutation, and the process occurs both in vivo and in vitro. The yield of holo-H130C CcmEsol-C-His6 produced in vivo is low compared with the wild type. In vitro heme attachment occurs only under reducing conditions. We demonstrate the involvement of one of the heme vinyl groups and a side chain at residue 130 in the bond formation by showing that in vitro attachment does not occur either with the heme analogue mesoheme or when alanine is present at residue 130. These results have implications for the mechanism of heme attachment to the histidine of CcmE. In vitro, CcmEsol lacking a His tag binds 8-anilino-1-naphthalenesulphonate and heme, the latter both noncovalently and via a covalent bond from the histidine side chain, similarly to the tagged proteins, thus countering a recent proposal that the His tag causes the heme binding. However, the His tag does appear to enhance the rate of in vitro covalent heme binding and to affect the heme ligation in the ferric b-type cytochrome form. c-type cytochromes are important ubiquitous proteins that bind heme covalently via two thioether bonds between the cysteines in a conserved CXXCH motif in the protein and the vinyl groups of heme. In many Gram-negative bacteria, formation of these covalent bonds occurs in the periplasm in a multistep process involving the so-called Ccm (cytochrome cmaturation) proteins A–H, all of which are essential (1Thöny-Meyer L. Fischer F. Kunzler P. Ritz D. Hennecke H. J. Bacteriol. 1995; 177: 4321-4326Crossref PubMed Google Scholar, 2Thöny-Meyer L. Biochim. Biophys. Acta. 2000; 1459: 316-324Crossref PubMed Scopus (76) Google Scholar). The apocytochromes are synthesized in the cytoplasm and transported to the periplasm via the Sec pathway (3Thöny-Meyer L. Kunzler P. Eur. J. Biochem. 1997; 246: 794-799Crossref PubMed Scopus (66) Google Scholar). The mechanism by which heme, which is also synthesized cytoplasmically, is transported to the periplasm is as yet uncertain (4Goldman B.S. Beck D.L. Monika E.M. Kranz R.G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5003-5008Crossref PubMed Scopus (93) Google Scholar, 5Schulz H. Fabianek R.A. Pellicioli E.C. Hennecke H. Thöny-Meyer L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6462-6467Crossref PubMed Scopus (103) Google Scholar, 6Cook G.M. Poole R.K. Microbiology. 2000; 146: 527-536Crossref PubMed Scopus (35) Google Scholar). However, it has been shown that the membrane-bound protein CcmC is required for presentation of heme to the membrane-anchored periplasmic protein CcmE (7Ren Q. Thöny-Meyer L. J. Biol. Chem. 2001; 276: 32591-32596Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). CcmE has been identified as the heme chaperone and binds heme covalently via a conserved histidine residue (His130 in Escherichia coli) before transferring the heme to apocytochromes (8Schulz H. Hennecke H. Thöny-Meyer L. Science. 1998; 281: 1197-1200Crossref PubMed Scopus (156) Google Scholar). Recently, structures of the CcmE apoproteins from two different bacterial species have been reported (9Arnesano F. Banci L. Barker P.D. Bertini I. Rosato A. Su X.C. Viezzoli M.S. Biochemistry. 2002; 41: 13587-13594Crossref PubMed Scopus (40) Google Scholar, 10Enggist E. Thöny-Meyer L. Guntert P. Pervushin K. Structure. 2002; 10: 1551-1557Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar), which shows that the heme-binding histidine is exposed on the protein surface but provides no clue as to the unusual properties of this residue. CcmE has been shown to be part of a complex with CcmF in vivo (11Ren Q. Ahuja U. Thöny-Meyer L. J. Biol. Chem. 2002; 277: 7657-7663Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), which together with CcmH forms what is proposed to be a bacterial heme lyase. CcmH interacts with CcmG, which is part of the system that provides reductant to the periplasm, specifically for reducing the cysteines in the CXXCH motif of the apocytochromes (12Reid E. Cole J. Eaves D.J. Biochem. J. 2001; 355: 51-58Crossref PubMed Scopus (60) Google Scholar). The nature of the novel bond between the histidine of CcmE and the heme remains unknown, although it has been shown that one of the vinyl groups of heme is involved (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). CcmE has been identified in a number of bacteria as well as in Arabidopsis and presumably other plant mitochondria (14Spielewoy N. Schulz H. Grienenberger J.M. Thöny-Meyer L. Bonnard G. J. Biol. Chem. 2001; 276: 5491-5497Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). In vitro studies of a soluble version of CcmE (CcmE′) have shown that the covalent attachment occurs under reducing conditions and that release of the heme to apocytochromes will only occur if heme is in its ferrous state (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). To probe further the covalent attachment of heme in vitro or in vivo, we have altered by site-directed mutagenesis the histidine 130 that has been shown previously to be the site of heme attachment in vivo (8Schulz H. Hennecke H. Thöny-Meyer L. Science. 1998; 281: 1197-1200Crossref PubMed Scopus (156) Google Scholar). Replacement of this histidine by cysteine or alanine was expected to generate proteins with either a potentially reactive or an unreactive side chain at position 130. The CcmE′ protein used in previous in vitro studies (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar) had a His tag at the C terminus. Very recently it has been suggested that such a His tag may significantly influence the binding of heme to CcmE′ in vitro to the extent that protein from Shewanella putrefaciens lacking a tag is reported to be unable to bind heme in vitro (9Arnesano F. Banci L. Barker P.D. Bertini I. Rosato A. Su X.C. Viezzoli M.S. Biochemistry. 2002; 41: 13587-13594Crossref PubMed Scopus (40) Google Scholar). Any possibility that a His tag might direct heme to form a nonphysiological covalent bond to other than residue 130 would also be addressed by the present mutagenesis studies. Further test of whether a His tag affects the binding of heme has been made by comparing the tagged and untagged proteins with histidine at 130. Furthermore, the mechanistic implications of our studies are discussed. Plasmid Construction and Mutagenesis—E. coli strain DH5α was used for cloning, and JM109(DE3) was used for protein expression. The expression vector for CcmEsol-C-His6 (CcmE′) was constructed as described (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar) and produces the soluble periplasmic region of the protein from Ser32 with a cleavable pelB signal sequence for periplasmic targeting of the protein. Amino acid substitutions in this expression vector were performed using the ExSite PCR-based site-directed mutagenesis method (Stratagene) using the primers pET22bH130AF and -R for the H130A mutant and pET22bH130CF and -R for the H130C mutant (as listed in Table I). The vector for the cytoplasmic expression of the thrombin-cleavable His-tagged version of the protein (N-His6-CcmEsol) was constructed by PCR amplification of the gene from the plasmid pEC86 (which was kindly provided by L. Thöny-Meyer) using the primers pET15bF and -R, which include XhoI and BamHI restriction sites, respectively (Table I). The PCR products were cloned into the vector pET15-b (Novagen) using these restriction sites, producing the plasmid pE151. Mutations were made in this plasmid using the QuikChange method (Stratagene). The mutations made were H130A using the primers pET15bH130AF and -R, H130C using the primers pET15bH130CF and -R, as well as mutation of the His and Met (both to Ala) that remain on the protein following thrombin cleavage, using the primers pET15bHMAAF and -R (Table I). All of the resulting plasmids were sequenced to confirm that only the desired mutations had been incorporated.Table IOligonucleotides used for mutagenesis and plasmid constructionPrimerSequence (5′ to 3′)Plasmid madepET22bH130AFGCCGATGAAAACTATACGCCGpE222pET22bH130ARTTTCGCCAGCACTTCTTTCGCpE222pET22bH130CFTGCGATGAAAACTATACGCCGpE223pET22bH130CRTTTCGCCAGCACTTCTTTCGCpE223pET15bFAAAACTCGAGTCGAATATCGATCTCpE151pET15bRAAAAGGATCCTCATGATGCTGGGTCpE151pET15bH130AFGTGCTGGCGAAAGCCGATGAAAACTATACGCCGpE152pET15bH130ARCGGCGTATAGTTTTCATCGGCTTTCGCCAGCACpE152pET15bH130CFGTGCTGGCGAAATGCGATGAAAACTATACGCCGpE153pET15bH130CRCGGCGTATAGTTTTCATCGCATTTCGCCAGCACpE153pET15bHMAAFGGTGCCGCGCGGCAGCGCTGCGCTCGAGTCGAATATCGpE154pET15bHMAARCGATATTCGACTCGAGCGCAGCGCTGCCGCGCGGCACCpE154 Open table in a new tab Protein Expression and Purification—For expression of the holoforms of the periplasmic proteins, the expression vectors pE221, pE222, and pE223 were co-transformed with the plasmid pEC86 (15Arslan E. Schulz H. Zufferey R. Kunzler P. Thöny-Meyer L. Biochem. Biophys. Res. Commun. 1998; 251: 744-747Crossref PubMed Scopus (342) Google Scholar), which expresses the Ccm proteins A–H. Co-expression of these proteins is essential for production of wild-type holo-CcmE′ (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). High levels of the apoproteins were expressed in the periplasm in the absence of pEC86. E. coli cultures were grown as described previously, and the proteins were purified using Ni2+-chelating Sepharose columns equilibrated with 50 mm Tris-HCl, pH 7.4, as described (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). The cytoplasmically expressed proteins (from the plasmids pE151, pE152, pE153, and pE154) were purified in the same way, except that the cells were sonicated on ice three times for 30 s to prepare the cell extracts, and the buffer contained 300 mm NaCl throughout. Thrombin cleavage of N-His6-CcmEsol and mutants thereof was performed using a thrombin CleanCleave Kit (Sigma) according to the manufacturer's instructions. Uncleaved protein was removed by re-applying the reaction mixture to the Ni2+-Sepharose column. Western blots were performed using a peroxidase conjugate of a monoclonal anti-polyhistidine antibody (Sigma) to confirm that the His tags had been completely cleaved. Protein Characterization—Discontinuous SDS-PAGE (15 or 17.5% acrylamide) (16Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207227) Google Scholar) was used to analyze the proteins, and staining for covalently bound heme was performed according to the method of Goodhew et al. (17Goodhew C.F. Brown K.R. Pettigrew G.W. Biochim. Biophys. Acta. 1986; 852: 288-294Crossref Scopus (155) Google Scholar), following acidified acetone extraction to remove noncovalently bound heme. Visible absorption spectra were recorded on a Perkin-Elmer Lambda 2 spectrophotometer using between 2 and 5 μm heme-protein samples in either 50 mm sodium phosphate buffer, pH 7.0, or 50 mm Tris-HCl buffer, pH 7.4, 300 mm NaCl. Pyridine hemochrome spectra were obtained according to the method of Bartsch (18Bartsch R.G. Methods Enzymol. 1971; 23: 344-363Crossref Scopus (198) Google Scholar) using 5 μm protein in 19% (v/v) pyridine and 0.15 m NaOH. Electrospray ionization mass spectrometry (ES-MS) 1The abbreviations used are: ES-MS, electrospray ionization mass spectrometry; ANS, 8-anilino-1-naphthalenesulfonate. was performed using a Micromass Bio-Q II-ZS triple quadrupole atmospheric pressure mass spectrometer. 10-μl protein samples in 1:1 water:acetonitrile, 1% formic acid at a concentration of 20 pmol/μl were injected into the electrospray source at a flow rate of 10 μl/min. Heme Addition—Hemin (Sigma) or mesoheme (Frontier Science) (1 mm in Me2SO) was added to apoprotein solutions in 50 mm sodium phosphate buffer, pH 7.0. Quantitative loading of the proteins with heme was achieved by incubating 1 equivalent of protein with 1.1 equivalents of heme at room temperature. Desalting columns were used to remove excess heme from the protein solutions. Disodium dithionite (Sigma) was used to reduce heme. The fluorescence measurements were made using a Perkin Elmer LS 50B fluorimeter, and the dissociation constants for heme and ANS were determined as described (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). Covalent Heme Attachment—Disodium dithionite and dithiothreitol (5 mm) were added to solutions (in 50 mm sodium phosphate buffer, pH 7.0) containing protein (50 μm) and heme (10 μm; added from 1 mm stocks in Me2SO), which were incubated at room temperature. The solutions were deoxygenated by thoroughly sparging with humidified argon. The reactions were carried out in the dark. Characterization of CcmEsol Lacking a His Tag—Recently, it was suggested that the His tag on a soluble CcmE construct, described in our previous work (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar), causes artifactual noncovalent binding of heme and that the heme binding described is nonphysiological (9Arnesano F. Banci L. Barker P.D. Bertini I. Rosato A. Su X.C. Viezzoli M.S. Biochemistry. 2002; 41: 13587-13594Crossref PubMed Scopus (40) Google Scholar). To address this point, we have made a construct of CcmE that can be studied with and without the His tag, using a protease cleavage site between the His tag and the soluble CcmE domain. The protein with the cleavable His tag (N-His6-CcmEsol) was analyzed by ES-MS and had a mass of 16,641 Da (theoretical mass, 16,641 Da); the protein ran as a single band during SDS-PAGE analysis (Fig. 1, lane 1). After thrombin treatment and removal of uncleaved protein, the cleaved protein (CcmEsol) had a mass of 14,890 Da (theoretical mass, 14,890). The difference in the mass of the protein could also be seen by SDS-PAGE analysis (Fig. 1, lane 4). The absence of the His tag was also confirmed by Western blotting. After the addition of ferric heme to apoprotein lacking a His tag, followed by reduction by disodium dithionite, no differences in the visible spectra, characteristic of a low spin state, were observed compared with the His tag-containing protein (Table II). There was a subsequent disappearance of these spectral characteristics upon reduction, as we have observed for the wild-type protein with the C-terminal His tag (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). Interestingly, in the visible spectrum of ferric heme and CcmEsol, a species was obtained that is similar to that observed upon the addition of ferric heme to horse heart apocytochrome c (19Dumont M.E. Corin A.F. Campbell G.A. Biochemistry. 1994; 33: 7368-7378Crossref PubMed Scopus (67) Google Scholar), showing features of a high spin heme-protein species. Thus, the spectrum of the oxidized heme-protein complex obtained without a His tag (a broad Soret band around 400 nm) was different from those for the proteins with the His tag at either the C or N terminus, both of which have a Soret band at 413 nm. These data suggest that the His tag can affect the coordination chemistry of the ferric heme-CcmEsol complex leading to a high spin/low spin equilibrium. However, in light of the known effects of polyhistidine on the coordination characteristics of heme, this is arguably not surprising (20Tohjo M. Shibata K. Arch. Biochem. Biophys. 1963; 103: 401-408Crossref PubMed Scopus (16) Google Scholar). This contrasts with the spectrum of the reduced heme-CcmEsol complex not being altered by the absence of the His tag (Table II).Table IIVisible absorption maxima for various forms of CcmEsolNature of heme-CcmEsol complexAbsorption maximaFerrous oxidation statePyridine hemochrome (α band)nmnmWild typeaRef. 13.b-type heme-CcmEsol-C-His6560530425556H130Mesoheme-CcmEsol-C-His6549521412546In vivo holo-CcmEsol-C-His6555526421551b-type heme-CcmEsol560530426556H130Ab-type heme-CcmEsol-C-His6NDNDND556Mesoheme-CcmEsol-C-His6549521410546H130Cb-type heme-CcmEsol-C-His6560530425556Mesoheme-CcmEsol-C-His6550522411546In vivo holo-CcmEsol-C-His6555525419∼552In vitro holo-CcmEsol556526423552.5a Ref. 13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar. Open table in a new tab In addition, further analysis of the protein without the His tag showed that it has a similar ANS affinity to the protein with the tag and the same maximum emission wavelength at 480 nm (results not shown). Also, it was possible to displace bound ANS from CcmEsol by the addition of heme, as we have shown for the tagged protein (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). The reaction of ferrous heme with N-His6-CcmEsol led to a protein with covalently bound heme that had characteristics indistinguishable from CcmEsol-C-His6 (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar) (Fig. 1, lane 2, and data not shown). After thrombin cleavage of the His tag, heme was shown to be covalently bound to CcmEsol as shown in Fig. 1 (lane 3). Reaction of CcmEsol with heme in the absence of the His tag led to the same qualitative result (Fig. 1, lane 5), but the half-life of reaction was increased by at least 10-fold relative to versions of the protein with His tags at either end. Following thrombin cleavage of the protein expressed from pET15-b, two potential extra heme-ligating residues remain on the N terminus of the protein, namely histidine and methionine. To avoid any potential artifactual heme ligation by the untagged protein obtained by thrombin treatment of the N-terminal His-tagged protein, these residues were mutated to alanines. The proteins with and without the His tag were pure as judged by SDS-PAGE analysis (data not shown) and had the expected masses as indicated by ES-MS analysis. Upon the addition of ferric heme to apoprotein without the His tag, the spectrum changed compared with the spectrum of free ferric heme (Fig. 2). The heme-protein complex appeared to be high spin in the ferric state and switched to low spin in the reduced state upon the addition of disodium dithionite (Fig. 2). Therefore, the presence of an extra methionine and histidine, derived from the linker region, had no observable effect on interactions with heme. Characterization of the Mutants H130A and H130C—Both the H130A and H130C variants of CcmEsol-C-His6 were expressed well as their apoforms in the E. coli periplasm. The masses of the proteins were confirmed by ES-MS, which also showed that the periplasmic targeting sequences had been completely cleaved. The observed masses were 15,447 Da for the H130A mutant (theoretical mass, 15,450 Da) and 15,483 Da for the H130C mutant (theoretical mass, 15,482 Da). Both proteins were also expressed in E. coli with co-expression of the other Ccm proteins, and the covalent attachment of heme to the proteins was examined by SDS-PAGE analysis followed by heme staining (Fig. 3). Fig. 3A shows that the proteins were purified to homogeneity (lanes 2 and 4 for H130A and H130C, respectively). As expected, the H130A mutant did not appear to bind heme covalently in vivo as judged by heme staining of the SDS-PAGE gel (Fig. 3B, lane 2), which is in agreement with previous experiments (8Schulz H. Hennecke H. Thöny-Meyer L. Science. 1998; 281: 1197-1200Crossref PubMed Scopus (156) Google Scholar). The H130C mutant, however, was found to heme stain when expressed with the other Ccm proteins (Fig. 3B, lane 6), indicating that the protein was recognized to some extent by the Ccm system for heme delivery and attachment. To detect the stain from covalently bound heme, the gel had to be overloaded such that a broad band was seen. It was found that the apo-H130C protein formed intermolecular disulfide bonds in vitro when dialyzed extensively against oxygenated 50 mm sodium phosphate buffer, pH 7.0, as shown in Fig. 3A (lane 5). This observation was supported by analysis with Ellman's reagent, which showed 1 and 0.2 equivalents of free thiol for reduced and oxidized protein, respectively. A significant proportion of the protein ran at a molecular mass of ∼30 kDa, corresponding to a covalently linked dimer, which was also identified by ES-MS analysis. In vivo-produced H130C holo-CcmEsol-C-His6 is produced at a very low level, where less than 0.5% of the protein is in the holo-form containing covalently bound heme, as determined from the relative ratio of the Soret band to the absorption at 280 nm. In Vitro Heme Binding to the H130A and H130C Apoproteins—Upon the addition of ferric heme to the mutant CcmEsol-C-His6, both H130A and H130C formed noncovalent b-type cytochrome complexes, as determined by visible spectroscopy. The complexes formed within the mixing time and appeared to be stable in this form for several hours. The absorbance maxima for the complexes of both proteins with ferrous heme and mesoheme as well as the pyridine hemochrome spectra are shown in Table II. Mesoheme is a heme analogue that has ethyl substituents in the normal positions of the vinyl groups. The visible spectrum of the complex of H130C with ferric heme shows the characteristics of a b-type cytochrome, with an α-band at 560 nm following reduction with dithionite and immediate recording of the spectrum. Interestingly, it was not possible to record an accurate visible spectrum of the dithionite-reduced H130A mutant b-type complex because dissociation of heme from the protein was too rapid. Heme dissociation upon reduction was also observed with the wild-type heme-protein complex (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). The pyridine hemochrome spectra of the b-type complexes of both mutants with heme have absorbance maxima at 556 nm, which is characteristic of unsaturated vinyl groups and shows that covalent attachment does not occur under these conditions. The dissociation constants (Kd) of the mutant proteins for ferric heme were measured by fluorescence spectroscopy as described for the wild-type protein (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar). The dissociation constants of the high affinity binding sites were compared, because these are likely to be the physiologically relevant sites. The Kd of the H130A mutant was found to be 0.72 (± 0.16) μm, which shows that it has a slightly lower affinity for heme than the wild-type protein (Kd, 0.2 μm (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar)). This result is not unexpected because the loss of the histidine side chain is likely to have changed the conformation of the heme-binding site in the protein. The Kd of the H130C mutant was found to be 0.48 ± 0.08 μm, also higher than the wild type. Both mutant proteins, however, have retained a significant affinity for heme. It should be noted, however, that the model of heme binding presented for this protein suggests that a conformational change occurs in the flexible C-terminal region upon heme binding (10Enggist E. Thöny-Meyer L. Guntert P. Pervushin K. Structure. 2002; 10: 1551-1557Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Covalent Attachment of Heme to H130C—Upon reduction by disodium dithionite of the C-terminal His-tagged b-type H130C variant protein, with a 5-fold excess of protein over heme, the absorbance spectrum shifted toward a cytochrome spectrum corresponding to a covalent bond between heme and protein. The α-band shifted from 560 to 556 nm over several hours, and the β-band and Soret band also shifted accordingly with time (Table II). After desalting the reaction mixture, the spectrum of H130C produced in this way was very similar to the spectrum of the in vivo-produced H130C protein (Table II). The pyridine hemochrome spectrum of the in vitro produced holo-form of the protein yielded a maximum around 553 nm, which is consistent with the presence of a single free vinyl group, as has been observed for single cysteine variants of c-type cytochromes (21Tomlinson E.J. Ferguson S.J. J. Biol. Chem. 2000; 275: 32530-32534Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). Interestingly, the in vivo produced holo-form of this mutant had broad absorption maxima in the reduced and pyridine hemochrome spectra. This observation suggests that as a consequence of the substitution of histidine 130 with a cysteine residue, heme attachment is not completely selective and that the formation of incorrect side products can occur. The oxidation state of heme and the cysteine thiol in vivo might not be as tightly controlled during the periplasmic attachment of heme to the protein compared with the reducing conditions of the in vitro experiments. To prove that the spectroscopic data were indicative of in vivo and in vitro covalent bond formation between heme and the H130C mutant protein, SDS-PAGE analysis followed by heme staining was performed. Fig. 3 (lane 8) shows the reaction of the b-type complex of heme and H130C with dithionite after 14 h. The fact that the protein stains for covalently bound heme (Fig. 3B, lane 8), as does the in vivo produced holo-H130C in lane 6, indicates that in vitro and in vivo covalent attachment of heme to the protein had occurred. The controls for this experiment are shown in lanes 3, 7, and 9. These are H130A incubated with ferric heme followed by reduction with dithionite, H130C incubated with ferric heme, and the addition of ferric mesoheme to H130C protein followed by reduction with dithionite and incubation for 14 h, respectively. These controls show that covalent attachment of heme to the CcmEsol protein samples did not occur under these conditions, because no heme staining could be observed for CcmEsol. The results establish that one of the vinyl groups of heme is involved in formation of the covalent bond, because attachment was not observed with mesoheme. The results also show that the bond forms with the cysteine residue of the protein, because it is not observed with the alanine mutant. Therefore, it is shown that covalent heme binding can only occur with a reactive side chain of amino acid 130. As was observed for the wild-type protein (13Daltrop O. Stevens J.M. Higham C.W. Ferguson S.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9703-9708Crossref PubMed Scopus (59) Google Scholar), these results also highlight the requirement for reduction of the heme in the covalent bond formation, because no heme staining was observed with the oxidized sample. To remove any ambiguity regarding the effect of the His tag on the covalent heme attachment to the H130C variant and the inability of the H130A mutant to bind heme covalently in vitro, proteins with these active site mutations were also made with a N-terminal cleavable His tag. The purified proteins were shown to be pure by SDS-PAGE analysis as shown in Fig. 4 (la" @default.
• W2006099689 created "2016-06-24" @default.
• W2006099689 creator A5001614024 @default.
• W2006099689 creator A5031745695 @default.
• W2006099689 creator A5032339459 @default.
• W2006099689 creator A5049767244 @default.
• W2006099689 date "2003-06-01" @default.
• W2006099689 modified "2023-09-30" @default.
• W2006099689 title "Interaction of Heme with Variants of the Heme Chaperone CcmE Carrying Active Site Mutations and a Cleavable N-terminal His Tag" @default.
• W2006099689 cites W122189005 @default.
• W2006099689 cites W1576988856 @default.
• W2006099689 cites W1757348122 @default.
• W2006099689 cites W1966052679 @default.
• W2006099689 cites W1969332064 @default.
• W2006099689 cites W1970521687 @default.
• W2006099689 cites W1974384244 @default.
• W2006099689 cites W1985718139 @default.
• W2006099689 cites W2009085335 @default.
• W2006099689 cites W2021592146 @default.
• W2006099689 cites W2027951872 @default.
• W2006099689 cites W2040963577 @default.
• W2006099689 cites W2044371825 @default.
• W2006099689 cites W2069659352 @default.
• W2006099689 cites W2081433217 @default.
• W2006099689 cites W2088879257 @default.
• W2006099689 cites W2091287125 @default.
• W2006099689 cites W2091896722 @default.
• W2006099689 cites W2100837269 @default.
• W2006099689 cites W2103528571 @default.
• W2006099689 cites W2118564550 @default.
• W2006099689 cites W2129384282 @default.
• W2006099689 cites W2143848921 @default.
• W2006099689 cites W2163990363 @default.
• W2006099689 cites W2167644591 @default.
• W2006099689 cites W4246703345 @default.
• W2006099689 cites W943944575 @default.
• W2006099689 doi "https://doi.org/10.1074/jbc.m212925200" @default.
• W2006099689 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12657624" @default.
• W2006099689 hasPublicationYear "2003" @default.
• W2006099689 type Work @default.
• W2006099689 sameAs 2006099689 @default.
• W2006099689 citedByCount "38" @default.
• W2006099689 countsByYear W20060996892012 @default.
• W2006099689 countsByYear W20060996892013 @default.
• W2006099689 countsByYear W20060996892014 @default.
• W2006099689 countsByYear W20060996892018 @default.
• W2006099689 countsByYear W20060996892022 @default.
• W2006099689 crossrefType "journal-article" @default.
• W2006099689 hasAuthorship W2006099689A5001614024 @default.
• W2006099689 hasAuthorship W2006099689A5031745695 @default.
• W2006099689 hasAuthorship W2006099689A5032339459 @default.
• W2006099689 hasAuthorship W2006099689A5049767244 @default.
• W2006099689 hasBestOaLocation W20060996891 @default.
• W2006099689 hasConcept C142724271 @default.
• W2006099689 hasConcept C181199279 @default.
• W2006099689 hasConcept C185592680 @default.
• W2006099689 hasConcept C2775962898 @default.
• W2006099689 hasConcept C2776217839 @default.
• W2006099689 hasConcept C2779664074 @default.
• W2006099689 hasConcept C41008148 @default.
• W2006099689 hasConcept C55493867 @default.
• W2006099689 hasConcept C71924100 @default.
• W2006099689 hasConcept C76155785 @default.
• W2006099689 hasConceptScore W2006099689C142724271 @default.
• W2006099689 hasConceptScore W2006099689C181199279 @default.
• W2006099689 hasConceptScore W2006099689C185592680 @default.
• W2006099689 hasConceptScore W2006099689C2775962898 @default.
• W2006099689 hasConceptScore W2006099689C2776217839 @default.
• W2006099689 hasConceptScore W2006099689C2779664074 @default.
• W2006099689 hasConceptScore W2006099689C41008148 @default.
• W2006099689 hasConceptScore W2006099689C55493867 @default.
• W2006099689 hasConceptScore W2006099689C71924100 @default.
• W2006099689 hasConceptScore W2006099689C76155785 @default.
• W2006099689 hasIssue "23" @default.
• W2006099689 hasLocation W20060996891 @default.
• W2006099689 hasOpenAccess W2006099689 @default.
• W2006099689 hasPrimaryLocation W20060996891 @default.
• W2006099689 hasRelatedWork W1586294006 @default.
• W2006099689 hasRelatedWork W2056545556 @default.
• W2006099689 hasRelatedWork W2056821345 @default.
• W2006099689 hasRelatedWork W2063084317 @default.
• W2006099689 hasRelatedWork W2090421667 @default.
• W2006099689 hasRelatedWork W2095940932 @default.
• W2006099689 hasRelatedWork W2161180152 @default.
• W2006099689 hasRelatedWork W2279101380 @default.
• W2006099689 hasRelatedWork W2565088527 @default.
• W2006099689 hasRelatedWork W2782497155 @default.
• W2006099689 hasVolume "278" @default.
• W2006099689 isParatext "false" @default.
• W2006099689 isRetracted "false" @default.
• W2006099689 magId "2006099689" @default.
• W2006099689 workType "article" @default.