FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006200975> ?p ?o ?g. }

• W2006200975 endingPage "5827" @default.
• W2006200975 startingPage "5821" @default.
• W2006200975 abstract "The yeast vacuolar ATPase (V-ATPase) contains three proteolipid subunits: c (Vma3p), c′ (Vma11p), and c“ (Vma16p). Each subunit contains a buried glutamate residue that is essential for function, and these subunits are not able to substitute for each other in supporting activity. Subunits c and c′ each contain four putative transmembrane segments (TM1–4), whereas subunit c” is predicted to contain five. To determine whether TM1 of subunit c“ serves an essential function, a deletion mutant of Vma16p was constructed lacking TM1 (Vma16p-ΔTM1). Although this construct does not complement the loss of Vma3p or Vma11p, it does complement the loss of full-length Vma16p. Vacuoles isolated from the strain expressing Vma16p-ΔTM1 showed V-ATPase activity and proton transport greater than 80% relative to wild type and displayed wild type levels of subunits A and a, suggesting normal assembly of the V-ATPase complex. These results suggest that TM1 of Vma16p is dispensable for both activity and assembly of the V-ATPase. To obtain information about the topology of Vma16p, labeling of single cysteine-containing mutants using the membrane-permeable reagent 3-(N-maleimidylpropionyl)biocytin (MPB) and the -impermeable reagent 4-acetamido-4′-maleimidylstilbene-2,2′-disulfonic acid (AMS) was tested. Both the Cys-less form of Vma16p and eight single cysteine-containing mutants retained greater than 80% of wild type levels of activity. Of the eight mutants tested, two (S5C and S178C) were labeled by MPB. MPB-labeling of S5C was blocked by AMS in intact vacuoles, whereas S178C was blocked by AMS only in the presence of permeabilizing concentrations of detergent. In addition, a hemagglutinin epitope tag introduced into the C terminus of Vma16p was recognized by an anti-hemagglutinin antibody in intact vacuolar membranes, suggesting a cytoplasmic orientation for the C terminus. These results suggest that subunit c” contains four rather than five transmembrane segments with both the N and C terminus on the cytoplasmic side of the membrane. The yeast vacuolar ATPase (V-ATPase) contains three proteolipid subunits: c (Vma3p), c′ (Vma11p), and c“ (Vma16p). Each subunit contains a buried glutamate residue that is essential for function, and these subunits are not able to substitute for each other in supporting activity. Subunits c and c′ each contain four putative transmembrane segments (TM1–4), whereas subunit c” is predicted to contain five. To determine whether TM1 of subunit c“ serves an essential function, a deletion mutant of Vma16p was constructed lacking TM1 (Vma16p-ΔTM1). Although this construct does not complement the loss of Vma3p or Vma11p, it does complement the loss of full-length Vma16p. Vacuoles isolated from the strain expressing Vma16p-ΔTM1 showed V-ATPase activity and proton transport greater than 80% relative to wild type and displayed wild type levels of subunits A and a, suggesting normal assembly of the V-ATPase complex. These results suggest that TM1 of Vma16p is dispensable for both activity and assembly of the V-ATPase. To obtain information about the topology of Vma16p, labeling of single cysteine-containing mutants using the membrane-permeable reagent 3-(N-maleimidylpropionyl)biocytin (MPB) and the -impermeable reagent 4-acetamido-4′-maleimidylstilbene-2,2′-disulfonic acid (AMS) was tested. Both the Cys-less form of Vma16p and eight single cysteine-containing mutants retained greater than 80% of wild type levels of activity. Of the eight mutants tested, two (S5C and S178C) were labeled by MPB. MPB-labeling of S5C was blocked by AMS in intact vacuoles, whereas S178C was blocked by AMS only in the presence of permeabilizing concentrations of detergent. In addition, a hemagglutinin epitope tag introduced into the C terminus of Vma16p was recognized by an anti-hemagglutinin antibody in intact vacuolar membranes, suggesting a cytoplasmic orientation for the C terminus. These results suggest that subunit c” contains four rather than five transmembrane segments with both the N and C terminus on the cytoplasmic side of the membrane. The vacuolar H+-ATPases (or V-ATPases) 1The abbreviations used are: V-ATPase, vacuolar proton-translocating adenosine triphosphatase; F-ATPase, F1F0-ATP synthase; HA, influenza hemagglutinin; TM, transmembrane segment; Vma16p-ΔTM1, the Vma16p protein lacking putative transmembrane segment 1; Me2SO, dimethyl sulfoxide; MES, 2-(N-morpholino)ethanesulfonic acid; YEPD, yeast extract peptone dextrose; MPB, 3-(N-maleimidylpropionyl) biocytin; AMS, 4-acetamido-4′-maleimidylstilbene-2,2′-disulfonic acid are found in a variety of intracellular compartments that function in both endocytic and secretory pathways (1Nishi T. Forgac M. Nat. Rev. Mol. Cell Biol. 2002; 3: 94-103Google Scholar, 2Forgac M. J. Biol. Chem. 1999; 274: 12951-12954Google Scholar, 3Graham L.A. Powell B. Stevens T.H. J. Exp. Biol. 2000; 203: 61-70Google Scholar, 4Kane P.M. Parra K.J. J. Exp. Biol. 2000; 203: 81-87Google Scholar, 5Bowman E.J. Bowman B.J. J. Exp. Biol. 2000; 203: 97-106Google Scholar, 6Futai M. Oka T. Sun-Wada G. Moriyama Y. Kanazawa H. Wada Y. J. Exp. Biol. 2000; 203: 107-116Google Scholar, 7Nelson N. Perzov N. Cohen A. Hagai K. Padler V. Nelson H. J. Exp. Biol. 2000; 203: 89-95Google Scholar, 8Sze H. Li X. Palmgren M.G. Plant Cell. 1999; 11: 677-689Google Scholar). Acidification of these compartments is essential for many cellular processes, including receptor-mediated endocytosis, intracellular targeting, protein processing and degradation, and coupled transport. V-ATPases are also present in the plasma membrane of certain specialized cells, including osteoclasts (9Lee B.S. Gluck S.L. Holliday L.S. J. Biol. Chem. 1999; 274: 29164-29171Google Scholar), renal intercalated cells (10Brown D. Breton S. J. Exp. Biol. 2000; 203: 137-145Google Scholar), and neutrophils (11Nanda A. Brumell J.H. Nordstrom T. Kjeldsen L. Sengelov H. Borregaard N. Rotstein O.D. Grinstein S. J. Biol. Chem. 1996; 271: 15963-15970Google Scholar), where they function in such processes as bone resorption, renal acidification, and pH homeostasis, respectively. The V-ATPases from fungi, plants, and animals are structurally very similar and are composed of two domains (1Nishi T. Forgac M. Nat. Rev. Mol. Cell Biol. 2002; 3: 94-103Google Scholar, 2Forgac M. J. Biol. Chem. 1999; 274: 12951-12954Google Scholar, 3Graham L.A. Powell B. Stevens T.H. J. Exp. Biol. 2000; 203: 61-70Google Scholar, 4Kane P.M. Parra K.J. J. Exp. Biol. 2000; 203: 81-87Google Scholar, 5Bowman E.J. Bowman B.J. J. Exp. Biol. 2000; 203: 97-106Google Scholar, 6Futai M. Oka T. Sun-Wada G. Moriyama Y. Kanazawa H. Wada Y. J. Exp. Biol. 2000; 203: 107-116Google Scholar, 7Nelson N. Perzov N. Cohen A. Hagai K. Padler V. Nelson H. J. Exp. Biol. 2000; 203: 89-95Google Scholar, 8Sze H. Li X. Palmgren M.G. Plant Cell. 1999; 11: 677-689Google Scholar). The V1domain is a 570-kDa peripheral complex composed of eight different subunits of molecular mass of 70 to 14 kDa (subunits A–H) that is responsible for ATP hydrolysis. The V0 domain is a 260-kDa integral complex composed of five subunits of molecular mass 100 to 17 kDa (subunits a, d, c, c′, and c“) that is responsible for proton translocation. The overall structure of the V-ATPase is therefore similar to that of the F1F0-ATP synthase (or F-ATPase) that functions in ATP synthesis in mitochondria, chloroplasts, and bacteria (12Cross R.L. Biochim. Biophys. Acta. 2000; 1458: 270-275Google Scholar, 13Weber J. Senior A.E. Biochim. Biophys. Acta. 2000; 1458: 300-309Google Scholar, 14Fillingame R.H. J. Exp. Biol. 2000; 203: 9-17Google Scholar, 15Yoshida M. Muneyuki E. Hisabori T. Nat. Rev. Mol. Cell Biol. 2001; 2: 669-677Google Scholar). Sequence homology between these classes of ATPase has been identified for both the nucleotide-binding subunits (16Zimniak L. Dittrich P. Gogarten J.P. Kibak H. Taiz L. J. Biol. Chem. 1988; 263: 9102-9112Google Scholar, 17Bowman B.J. Allen R. Wechser M.A. Bowman E.J. J. Biol. Chem. 1988; 263: 14002-14007Google Scholar) and the proteolipid subunits (18Mandel M. Moriyama Y. Hulmes J.D. Pan Y.C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5521-5524Google Scholar, 19Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Google Scholar). Unlike the F-ATPases, however, which contain a single type of proteolipid subunit (subunit c), the V-ATPases contain three different proteolipid subunits (c, c′, and c“). All three proteolipid subunits are highly hydrophobic proteins, and all three are essential for V-ATPase function (19Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Google Scholar). In yeast, subunits c, c′, and c” are encoded by the VMA3, VMA11, and VMA16 genes, respectively. The V-ATPase proteolipid subunits are homologous both to each other and to the F-ATPase subunit c, from which they appear to have been derived by gene duplication and fusion (18Mandel M. Moriyama Y. Hulmes J.D. Pan Y.C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5521-5524Google Scholar). Thus, the F-ATPase subunit c is an 8-kDa protein containing two transmembrane segments with an essential aspartate residue present in TM2 (14Fillingame R.H. J. Exp. Biol. 2000; 203: 9-17Google Scholar). Subunits c and c′ of the V-ATPase are 16-kDa proteins containing four putative transmembrane segments with an essential glutamate residue present in TM4 (18Mandel M. Moriyama Y. Hulmes J.D. Pan Y.C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5521-5524Google Scholar, 19Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Google Scholar). The N- and C-terminal halves of subunits c and c′ are homologous to each other. Subunit c has been shown recently (20Bowman B.J. Bowman E.J. J. Biol. Chem. 2002; 277: 3965-3972Google Scholar) to contain the binding site for the specific V-ATPase inhibitor bafilomycin. By contrast, subunit c“ of the V-ATPase is a 21-kDa protein predicted to have five transmembrane helices (19Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Google Scholar). Although TM2 to TM5 of subunit c” are homologous to subunits c and c′, TM1 is not similar to anything in these proteins. Interestingly, the essential glutamate residue of subunit c“ is located in TM3 (19Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Google Scholar). Previously, we demonstrated that the C terminus of mouse subunit c is present on the lumenal side of the membrane, whereas the C terminus of subunit c” is located on the cytoplasmic side (21Nishi T. Kawasaki-Nishi S. Forgac M. J. Biol. Chem. 2001; 276: 34122-34130Google Scholar). These results suggest that the membrane organization of subunit c“ is different from that of subunit c. In this study, we address the functional role of the first transmembrane segment of subunit c”, and we report additional information concerning the membrane topology of this protein. Zymolyase 100T was obtained from Seikagaku America, Inc. Concanamycin A was purchased from Fluka Chemical Corp. Protease inhibitors were from Roche Molecular Biochemicals. The monoclonal antibody 3F10 (directed against the HA antigen) that is conjugated with horseradish peroxidase was also from Roche Molecular Biochemicals. The monoclonal antibody 8B1-F3 against the yeast V-ATPase A subunit (22Kane P.M. Yamashiro C.T. Stevens T.H. J. Biol. Chem. 1989; 264: 19236-19244Google Scholar), the monoclonal antibody 10D7 against the 100-kDa a subunit (23Kane P.M. Kuehn M.C. Howald-Stevenson I. Stevens T. J. Biol. Chem. 1992; 267: 447-454Google Scholar), 3-(N-maleimidylpropionyl)biocytin (MPB), and 4-acetamido-4′-maleimidylstilbene-2,2′-disulfonic acid (AMS) were from Molecular Probes. Escherichia coli and yeast culture media were purchased from Difco. Restriction endonucleases, T4 DNA ligase, and other molecular biology reagents were from Invitrogen, Promega, and New England Biolabs. ATP, phenylmethylsulfonyl fluoride, and most other chemicals were purchased from Sigma. Yeast strains lacking the proteolipid genes, TNY101 (vma3Δ), TNY102 (vma11Δ), and TNY103 (vma16Δ), were constructed by replacing the entire coding region of each gene (VMA3, VMA11, or VMA16) with theTRP gene in the YPH500 strain. YEPD buffered to pH 5.5 or pH 7.5 was used for selection of strains showing a vma− phenotype. VMA3, VMA11, and VMA16genes were amplified from genomic DNA isolated from yeast strain YPH500 and then cloned into the pRS413 yeast shuttle vector. The sequences of the cloned genes were confirmed by DNA sequencing using an automated sequencer from Applied Biosystems. The oligonucleotides primers used for amplification of these genes are as follows: VMA3 forward, ggctctagaacttctgcgttattattaataattg, and VMA3 reverse, gccatcgatgaaatgaggtagtttggatatgaag; VMA11 forward, gatctattgaccaaaacaggtgtggaaac, and VMA11 reverse, ggaggcctagggttttctttcaagtatacacag; VMA16 forward, cacatgacgccgatttagaagtttcaatg, and VMA16 reverse, ggtctagatcccaggtctcacggaaatcttatc. An HA tag was introduced at the C terminus of each protein using a PCR-based recombination method (21Nishi T. Kawasaki-Nishi S. Forgac M. J. Biol. Chem. 2001; 276: 34122-34130Google Scholar). Yeast cells lacking functional endogenous Vma3p, Vma11p, or Vma16p were transformed using the lithium acetate method (24Gietz D. St. Jean A. Woods R.A. Schiestl R.H. Nucleic Acids Res. 1992; 20: 1425Google Scholar). The transformants were selected on histidine minus (HIS−) plates, and growth phenotypes of the mutants were assessed on YEPD plates buffered with 50 mmKH2PO4 or 50 mm succinic acid to either pH 7.5 or pH 5.5. Vacuolar membrane vesicles were isolated using a modification of the protocol described by Uchida et al. (25Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1985; 260: 1090-1095Google Scholar). Yeast cells were grown overnight at 30 °C to 1 × 107 cells/ml in 1 liter of selective medium. Cells were pelleted, washed once with water, and resuspended in 100 ml of 10 mm dithiothreitol and 100 mmTris-HCl, pH 9.4. After incubation at 30 °C for 15 min, cells were pelleted again, washed once with 100 ml of YEPD medium containing 0.7m sorbitol, 2 mm dithiothreitol, and 100 mm MES-Tris, pH 7.5, resuspended in 100 ml of YEPD medium containing 0.7 m sorbitol, 2 mm dithiothreitol, 100 mm MES-Tris, pH 7.5, and 2 mg of Zymolase 100T, and incubated at 30 °C with gentle shaking for 60 min. The resulting spheroplasts were osmotically lysed, and the vacuoles were isolated by flotation on two consecutive Ficoll gradients. Protein concentrations were measured by the BCA protein assay (Pierce). Vacuolar membrane proteins were separated by SDS-PAGE on 8 or 12.5% acrylamide gels. The expression of Vma16p and Vma16p-ΔTM1 was detected by Western blotting using the horseradish peroxidase-conjugated monoclonal antibody 3F10 against HA, whereas Vph1p or Vma1p was detected by monoclonal antibody 10D7 and 8B1-F3 (Molecular Probes, OR), respectively, followed by a horseradish peroxidase-conjugated secondary antibody (Bio-Rad). Assembly of the V-ATPase was assessed by measurement of the amount of subunit A present on isolated vacuolar membranes (23Kane P.M. Kuehn M.C. Howald-Stevenson I. Stevens T. J. Biol. Chem. 1992; 267: 447-454Google Scholar, 26Leng X.H. Manolson M. Liu Q. Forgac M. J. Biol. Chem. 1996; 271: 22487-22493Google Scholar). Blots were developed using a chemiluminescent detection method obtained from Kirkegaard & Perry Laboratories (Gaithersburg, MD). To determine whether the C terminus of Vma16p is exposed on the cytoplasmic side of the membrane, the accessibility of the HA epitope tag introduced at the C terminus in intact vacuoles was determined. Anti-HA antibody was added to intact vacuolar membrane vesicle (100 μg) and incubated for 2 h at 4 °C. Vacuolar membranes were washed with the overlay buffer (20 mm MES-Tris, pH 7.6, 0.25 mmMgCl2, 1.1 m glycerol) and solubilized with phosphate-buffered saline containing 1% C12E9, and the Vma16p::HA was recovered with protein G-Sepharose. As a control, the anti-HA antibody was added to C12E9-solubilized vacuolar membranes followed by precipitation of the Vma16p::HA with protein G-Sepharose. Samples were separated by SDS-PAGE and transferred to nitrocellulose, and Vma16p was detected using a peroxidase-conjugated anti-HA antibody (Roche Molecular Biochemicals) and the Supersignal ULTRA chemiluminescent system (Pierce). Chemical labeling of introduced cysteine residues by the membrane-permeant sulfhydryl reagent MPB and blocking by the membrane-impermeant reagent AMS was performed using a modification of the protocol described previously (27Leng X.H. Nishi T. Forgac M. J. Biol. Chem. 1999; 274: 14655-14661Google Scholar). Briefly, vacuolar membrane vesicles were washed using labeling buffer (10 mmMES-Tris, pH 7.0, 0.25 mm MgCl2, and 1.1m glycerol) and divided into two tubes. AMS (100 μm) was added to one tube, and both samples were incubated for 5 min at 15 °C. Samples were then transferred to ice and diluted 5-fold with labeling buffer followed immediately by addition of 250 μm MPB and incubation for 15 min at 25 °C. The labeling reaction was then stopped by addition of 15 mm 2-mercaptoethanol. After MPB labeling, vesicles were pelleted and solubilized in ice-cold phosphate-buffered saline containing 1% C12E9. The V0domain was immunoprecipitated using the mouse monoclonal antibody 10D7 specific for Vph1p plus protein G-Sepharose. Samples were then subjected to SDS-PAGE on 10% acrylamide gels and transferred to nitrocellulose membranes. The blots were probed with horseradish peroxidase-conjugated NeutrAvidin and developed using the Supersignal ULTRA chemiluminescent system (Pierce). Protein concentrations were determined by the Lowry method (28Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Google Scholar). ATPase activity was measured using a coupled spectrophotometric assay in the presence or absence of 1 μm concanamycin, as described previously (29Kawasaki-Nishi S. Nishi T. Forgac M. J. Biol. Chem. 2001; 276: 17941-17948Google Scholar). ATP-dependent proton transport was measured in transport buffer (25 mm MES-Tris, pH 7.2, 5 mmMgCl2) using the fluorescence probe ACMA (9-amino-6-chloro-2-methoxyacridine) in the presence or absence of 1 μm concanamycin, as described previously (29Kawasaki-Nishi S. Nishi T. Forgac M. J. Biol. Chem. 2001; 276: 17941-17948Google Scholar). SDS-PAGE was carried out as described by Laemmli (30Laemmli U.K. Nature. 1970; 227: 680-685Google Scholar). Fig. 1 shows the sequence alignment of the three proteolipid subunits of the yeast V-ATPase: subunit c (Vma3p), subunit c′ (Vma11p), and subunit c“ (Vma16p). As can be seen, subunits c and c′ both contain four putative transmembrane helices and share significant sequence homology with each other and with transmembrane segments 2–5 of subunit c”. By contrast, TM1 of subunit c“ is not homologous to any other sequence in the other two proteolipid subunits. The location of the buried glutamate residue critical for function of each of the proteolipid subunits is depicted in Fig. 2 a. To address the functional role of TM1 of subunit c”, a deleted form of subunit c“ was constructed (Vma16p-ΔTM1) lacking amino acid residues 2–41 that contain TM1 (Fig. 1). We first tested the ability of this construct to complement the phenotype of yeast strains disrupted in each of the proteolipid genes. It has been shown previously that yeast lacking any of the V-ATPase genes (or the pair of genes encoding subunit a) display a conditional lethal phenotype (vma−) characterized by an inability to grow at pH 7.5 but retaining the ability to grow at pH 5.5 (31Kane P.M. Yamashiro C.T. Wolczyk D.F. Neff N. Goebl M. Stevens T.H. Science. 1990; 250: 651-657Google Scholar, 32Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3503-3507Google Scholar). As can be seen in Fig. 2 b, the full-length genes are only able to complement their own disruption and not that of the other proteolipid genes. Moreover, Vma16p-ΔTM1 does not complement the loss of either Vma3p or Vma11p. Surprisingly, however, Vma16p-ΔTM1 does complement the loss of the full-length Vma16p protein. This result suggests that TM1 is not essential for V-ATPase function.Figure 2Deletion of the first transmembrane region of Vma16p does not alter V-ATPase function. a, schematic illustration of the domain structure of Vma3p, Vma11p, and Vma16p. Putative transmembrane regions are indicated asboxes, and the positions of the essential glutamate residues in each subunit are indicated as open circles. The glutamate residue shown in the shaded circle in TM5 of Vma16p has been shown not to be essential for function (19Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Google Scholar).b, growth phenotype at pH 7.5 of yeast strains disrupted in the indicated proteolipid genes (host cell) upon introduction of the indicated full-length genes or the Vma16p-ΔTM1 construct. c, Western blot analysis of vacuoles isolated from a vma16Δ strain expressing HA-tagged forms of Vma16p or the Vma16p-ΔTM1 construct. Western blotting was performed using antibodies against the HA epitope, the V1subunit Vma1p, or the V0 subunit Vph1p as described under “Experimental Procedures.” d, concanamycin-sensitive ATPase activity (hatched bars) or ATP-dependent proton transport (open bars) was measured for vacuoles isolated from the vma16Δ strain expressing the HA-tagged forms of Vma16p or Vma16p-ΔTM1. The specific activity of the ATPase in the vacuoles isolated from the strain expressing the full-length HA-tagged Vma16p was 0.49 μmol of ATP/min/mg of protein at 30 °C and 0.5 mm ATP, which corresponds to ∼70% of the activity measured for the full-length untagged Vma16p.View Large Image Figure ViewerDownload (PPT) Previous results (33Liu J. Kane P.M. Biochemistry. 1996; 35: 10938-10948Google Scholar, 34MacLeod K.J. Vasilyeva E. Baleja J.D. Forgac M. J. Biol. Chem. 1998; 273: 150-156Google Scholar) have suggested that retention of ∼20% of wild type V-ATPase activity is sufficient to confer on cells a wild type growth phenotype. It is therefore necessary to measure directly V-ATPase activity and proton transport in vacuoles isolated from cells expressing the Vma16p-ΔTM1 construct in order to determine quantitatively the effect of removal of TM1 of Vma16p on V-ATPase function. We first wished to test the stability of the Vma16p-ΔTM1 protein and its ability to assemble with other V-ATPase subunits. To accomplish this, an HA epitope tag was inserted at the C-terminal end of both the full-length Vma16p and the Vma16p-ΔTM1. This was necessary because of the lack of available antibodies against the native Vma16p protein. As can be seen in Fig. 2 c, although Western blots of vacuoles isolated from the strain expressing Vma16p-ΔTM1 showed somewhat reduced reactivity with the anti-HA antibody relative to vacuoles isolated from the strain expressing the full-length Vma16p, both Vma1p (subunit A of the V1 domain) and Vph1p (subunit a of the V0 domain) were present at normal levels on the vacuolar membrane. It has been shown previously (19Hirata R. Graham L.A. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Google Scholar, 23Kane P.M. Kuehn M.C. Howald-Stevenson I. Stevens T. J. Biol. Chem. 1992; 267: 447-454Google Scholar) that the absence of any of the proteolipid subunits results in the failure of V1 to assemble onto the vacuolar membrane and aberrant assembly and targeting of the V0 domain. These results thus suggest that TM1 of subunit c“ is dispensable for normal assembly of the V-ATPase complex. The lower level of antibody staining of the Vma16p-ΔTM1 construct in isolated vacuoles may reflect partial proteolytic removal of the HA tag or altered reactivity of the HA epitope in this construct. Finally, measurement of both concanamycin-sensitive ATPase activity and ATP-dependent proton transport (as assessed by quenching of ACMA fluorescence) in isolated vacuoles (Fig. 2 d) indicates that V-ATPase complexes containing Vma16p-ΔTM1 have nearly the same activity and coupling as complexes containing the full-length Vma16p. These results confirm that TM1 of Vma16p is not necessary for V-ATPase function. Previously, we demonstrated that the C terminus of the mouse subunit c“ appears to be facing the cytoplasmic side of the membrane in COS-1 cells transfected with a HA-tagged form of the mouse Vma16p homologue (21Nishi T. Kawasaki-Nishi S. Forgac M. J. Biol. Chem. 2001; 276: 34122-34130Google Scholar). To confirm this result for the yeast protein, we compared the accessibility of an HA epitope attached at the C terminus of Vma16p in intactversus solubilized vacuolar membrane vesicles. One sample of vacuolar membranes was incubated with an anti-HA antibody followed by washing, detergent solubilization, and immunoprecipitation of the complexes containing the bound HA antibody. As a control, vacuolar membranes were solubilized with detergent first before addition of the anti-HA antibody and immunoprecipitation. Both samples were then subjected to SDS-PAGE and Western blotting using the anti-HA antibody. As shown in Fig. 3, the amount of anti-HA antibody binding to Vma16p::HA is similar whether the immunoprecipitating antibody was added before or after detergent solubilization. The somewhat higher level of antibody binding observed in the right lane of Fig. 3 may be due to some change in interaction between the subunits upon detergent solubilization of the complex or to the loss of some antibody during washing of the membranes in the case where antibody is added before detergent solubilization. This result indicates that the antibody-binding site at the C terminus of Vma16p::HA is exposed in intact vacuolar membrane vesicles and hence resides on the cytoplasmic side of the membrane. In order to obtain additional information about the topology of subunit c“, we employed cysteine mutagenesis and covalent modification by the membrane-permeant sulfhydryl reagent MPB and the membrane-impermeant sulfhydryl reagent AMS. This method has been employed previously to study the membrane folding of subunit a of the F1F0-ATP synthase of E. coli (35Valiyaveetil F.I. Fillingame R.H. J. Biol. Chem. 1998; 273: 16241-16247Google Scholar, 36Long J.C. Wang S. Vik S.B. J. Biol. Chem. 1998; 273: 16235-16240Google Scholar), and we have used this method to study the topology of subunit a of the yeast V-ATPase (27Leng X.H. Nishi T. Forgac M. J. Biol. Chem. 1999; 274: 14655-14661Google Scholar). In order to apply this method to subunit c”, we first constructed a Cys-less form of Vma16p by replacing each of the three endogenous cysteine residues present at positions 67, 105, and 159 with serine (Fig. 1). Site-directed mutagenesis was performed on the HA-tagged form of Vma16p described above in order to facilitate detection of the expressed proteins by Western blot. As can be seen in Fig.4 a, the Cys-less form of the HA-tagged Vma16p was expressed at normal levels in isolated vacuoles relative to the wild type HA-tagged Vma16p. Moreover, both Vma1p and Vph1p were present at normal levels in isolated vacuoles, suggesting that removal of the endogenous cysteine residues of Vma16p did not perturb assembly of the V-ATPase. Finally, measurement of concanamycin-sensitive ATPase activity and ATP-dependent proton transport indicated that the Cys-less form of Vma1p gave rise to V-ATPase complexes possessing wild type levels of both ATPase activity and proton transport (Fig. 4 b). By using this Cys-less, HA-tagged form of Vma16p as the starting point, seven single-cysteine containing mutants were constructed by replacement of the endogenous residues at positions Ser-5, Ser-11, Ser-55, Ser-135, Ser-137, Ser-178, and Ser-210 with cysteine by site-directed mutagenesis. An additional mutant (Q213C) of the untagged form of Vma16p was also constructed. Because this mutant contained a cysteine residue at the very C terminus, it was felt that it would be better to use an untagged form of Vma16p to analyze labeling because of the possibility of interference with access of the labeling reagents by the presence of the C-terminal HA tag. These mutant forms of Vma16p were expressed in the VMA16 deletion strain, and the growth phenotype was analyzed at pH 7.5 and 5.5. All mutants displayed a wild type growth phenotype at both pH values (data not shown). Western blot analysis of vacuoles isolated from the mutant strains (Fig.4 a) revealed wild type levels of the HA-tagged Vma16p protein for six of the seven tagged mutants (only S210C showed somewhat lower labeling than wild type). In addition, all of the mutants (including Q213C) showed normal levels of Vma1p and Vph1p on the vacuolar membrane. Finally, vacuoles isolated from each of the mutant strains displayed at least 80% of wild type levels of activity for both concanamycin-sensitive ATPase activity and ATP-dependent proton transport (Fig. 4 b). These results indicate that the cysteine substitutions in Vma16p do not significantly compromise stability, assembly, or activity of the V-ATPase complex. We next determined the ability of each of the introduced cysteine residues to react with the membrane-permeant reagent MPB. Vacuolar membrane vesicles isolated from each of the mutant strains were reacted with 250 μm MPB for 15 min at 25 °C followed by detergent solubilization and immunoprecipitation of the V0complexes with the monoclonal antibody 10D7 directed against subunit a. Previous studies have shown that this antibody only recognizes its epitope on subunit a in the free V0 domain and not in the intact V1V0 complex (23Kane P.M. Kuehn M.C. Howald-Steven" @default.
• W2006200975 created "2016-06-24" @default.
• W2006200975 creator A5058274702 @default.
• W2006200975 creator A5059756327 @default.
• W2006200975 creator A5082973060 @default.
• W2006200975 date "2003-02-01" @default.
• W2006200975 modified "2023-09-28" @default.
• W2006200975 title "The First Putative Transmembrane Segment of Subunit c“ (Vma16p) of the Yeast V-ATPase Is Not Necessary for Function" @default.
• W2006200975 cites W1481801182 @default.
• W2006200975 cites W1489057324 @default.
• W2006200975 cites W1489326505 @default.
• W2006200975 cites W1497289365 @default.
• W2006200975 cites W1544439362 @default.
• W2006200975 cites W1557391975 @default.
• W2006200975 cites W1574501720 @default.
• W2006200975 cites W1578803116 @default.
• W2006200975 cites W1591326119 @default.
• W2006200975 cites W1625553880 @default.
• W2006200975 cites W1775749144 @default.
• W2006200975 cites W1964051078 @default.
• W2006200975 cites W1969830416 @default.
• W2006200975 cites W1974459427 @default.
• W2006200975 cites W1977120851 @default.
• W2006200975 cites W1993357241 @default.
• W2006200975 cites W1997682893 @default.
• W2006200975 cites W1999131004 @default.
• W2006200975 cites W2004953882 @default.
• W2006200975 cites W2010239636 @default.
• W2006200975 cites W2015872817 @default.
• W2006200975 cites W2017063860 @default.
• W2006200975 cites W2019078656 @default.
• W2006200975 cites W2031098293 @default.
• W2006200975 cites W2045890776 @default.
• W2006200975 cites W2046585193 @default.
• W2006200975 cites W2046818599 @default.
• W2006200975 cites W2047945647 @default.
• W2006200975 cites W2049638544 @default.
• W2006200975 cites W2051815675 @default.
• W2006200975 cites W2058521638 @default.
• W2006200975 cites W2067449056 @default.
• W2006200975 cites W2068015571 @default.
• W2006200975 cites W2076066586 @default.
• W2006200975 cites W2084121452 @default.
• W2006200975 cites W2086660631 @default.
• W2006200975 cites W2092831966 @default.
• W2006200975 cites W2095296208 @default.
• W2006200975 cites W2100837269 @default.
• W2006200975 cites W2130261095 @default.
• W2006200975 cites W2131220361 @default.
• W2006200975 cites W2137356688 @default.
• W2006200975 cites W2140583034 @default.
• W2006200975 cites W2141075240 @default.
• W2006200975 cites W2151957387 @default.
• W2006200975 cites W2155167712 @default.
• W2006200975 cites W2168968856 @default.
• W2006200975 cites W2257692174 @default.
• W2006200975 cites W2346307042 @default.
• W2006200975 cites W4213226226 @default.
• W2006200975 doi "https://doi.org/10.1074/jbc.m209875200" @default.
• W2006200975 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12482875" @default.
• W2006200975 hasPublicationYear "2003" @default.
• W2006200975 type Work @default.
• W2006200975 sameAs 2006200975 @default.
• W2006200975 citedByCount "35" @default.
• W2006200975 countsByYear W20062009752012 @default.
• W2006200975 countsByYear W20062009752013 @default.
• W2006200975 countsByYear W20062009752015 @default.
• W2006200975 countsByYear W20062009752016 @default.
• W2006200975 countsByYear W20062009752017 @default.
• W2006200975 crossrefType "journal-article" @default.
• W2006200975 hasAuthorship W2006200975A5058274702 @default.
• W2006200975 hasAuthorship W2006200975A5059756327 @default.
• W2006200975 hasAuthorship W2006200975A5082973060 @default.
• W2006200975 hasBestOaLocation W20062009751 @default.
• W2006200975 hasConcept C104292427 @default.
• W2006200975 hasConcept C104317684 @default.
• W2006200975 hasConcept C118892022 @default.
• W2006200975 hasConcept C14036430 @default.
• W2006200975 hasConcept C170493617 @default.
• W2006200975 hasConcept C181199279 @default.
• W2006200975 hasConcept C185592680 @default.
• W2006200975 hasConcept C191678065 @default.
• W2006200975 hasConcept C23265538 @default.
• W2006200975 hasConcept C24530287 @default.
• W2006200975 hasConcept C2779222958 @default.
• W2006200975 hasConcept C41625074 @default.
• W2006200975 hasConcept C55493867 @default.
• W2006200975 hasConcept C86803240 @default.
• W2006200975 hasConcept C95444343 @default.
• W2006200975 hasConceptScore W2006200975C104292427 @default.
• W2006200975 hasConceptScore W2006200975C104317684 @default.
• W2006200975 hasConceptScore W2006200975C118892022 @default.
• W2006200975 hasConceptScore W2006200975C14036430 @default.
• W2006200975 hasConceptScore W2006200975C170493617 @default.
• W2006200975 hasConceptScore W2006200975C181199279 @default.
• W2006200975 hasConceptScore W2006200975C185592680 @default.
• W2006200975 hasConceptScore W2006200975C191678065 @default.
• W2006200975 hasConceptScore W2006200975C23265538 @default.

• next