FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006223695> ?p ?o ?g. }

• W2006223695 endingPage "49630" @default.
• W2006223695 startingPage "49621" @default.
• W2006223695 abstract "A library of 75 different chimeric cellulosomes was constructed as an extension of our previously described approach for the production of model functional complexes (Fierobe, H.-P., Mechaly, A., Tardif, C., Bélaı̈ch, A., Lamed, R., Shoham, Y., Bélaı̈ch, J.-P., and Bayer, E. A. (2001)J. Biol. Chem. 276, 21257–21261), based on the high affinity species-specific cohesin-dockerin interaction. Each complex contained three protein components: (i) a chimeric scaffoldin possessing an optional cellulose-binding module and two cohesins of divergent specificity, and (ii) two cellulases, each bearing a dockerin complementary to one of the divergent cohesins. The activities of the resultant ternary complexes were assayed using different types of cellulose substrates. Organization of cellulolytic enzymes into cellulosome chimeras resulted in characteristically high activities on recalcitrant substrates, whereas the cellulosome chimeras showed little or no advantage over free enzyme systems on tractable substrates. On recalcitrant cellulose, the presence of a cellulose-binding domain on the scaffoldin and enzyme proximity on the resultant complex contributed almost equally to their elevated action on the substrate. For certain enzyme pairs, however, one effect appeared to predominate over the other. The results also indicate that substrate recalcitrance is not necessarily a function of its crystallinity but reflects the overall accessibility of reactive sites. A library of 75 different chimeric cellulosomes was constructed as an extension of our previously described approach for the production of model functional complexes (Fierobe, H.-P., Mechaly, A., Tardif, C., Bélaı̈ch, A., Lamed, R., Shoham, Y., Bélaı̈ch, J.-P., and Bayer, E. A. (2001)J. Biol. Chem. 276, 21257–21261), based on the high affinity species-specific cohesin-dockerin interaction. Each complex contained three protein components: (i) a chimeric scaffoldin possessing an optional cellulose-binding module and two cohesins of divergent specificity, and (ii) two cellulases, each bearing a dockerin complementary to one of the divergent cohesins. The activities of the resultant ternary complexes were assayed using different types of cellulose substrates. Organization of cellulolytic enzymes into cellulosome chimeras resulted in characteristically high activities on recalcitrant substrates, whereas the cellulosome chimeras showed little or no advantage over free enzyme systems on tractable substrates. On recalcitrant cellulose, the presence of a cellulose-binding domain on the scaffoldin and enzyme proximity on the resultant complex contributed almost equally to their elevated action on the substrate. For certain enzyme pairs, however, one effect appeared to predominate over the other. The results also indicate that substrate recalcitrance is not necessarily a function of its crystallinity but reflects the overall accessibility of reactive sites. A number of cellulolytic anaerobic microorganisms degrade plant cell wall cellulose by means of macromolecular complexes termed cellulosomes (1Schwarz W.H. Appl. Microbiol. Biotechnol. 2001; 56: 634-649Crossref PubMed Scopus (535) Google Scholar, 2Bayer E.A. Morag E. Lamed R. Trends Biotechnol. 1994; 12: 379-386Abstract Full Text PDF PubMed Scopus (388) Google Scholar, 3Bayer E.A. Shimon L.J.W. Lamed R. Shoham Y. J. Struct. Biol. 1998; 124: 221-234Crossref PubMed Scopus (281) Google Scholar, 4Béguin P. Lemaire M. Crit. Rev. Biochem. Mol. 1996; 31: 201-236Crossref PubMed Scopus (170) Google Scholar, 5Belaich J.-P. Tardif C. Belaich A. Gaudin C. J. Biotechnol. 1997; 57: 3-14Crossref PubMed Scopus (96) Google Scholar, 6Doi R.H. Goldstein M. Hashida S. Park J.S. Takagi M. Crit. Rev. Microbiol. 1994; 20: 87-93Crossref PubMed Scopus (85) Google Scholar, 7Felix C.R. Ljungdahl L.G. Annu. Rev. Microbiol. 1993; 47: 791-819Crossref PubMed Scopus (147) Google Scholar, 8Lamed R. Setter E. Bayer E.A. J. Bacteriol. 1983; 156: 828-836Crossref PubMed Google Scholar). In addition to a collection of cellulases, these large complexes can also include enzymes specialized for the degradation of other plant cell wall polymers, such as hemicellulases and pectinases (9Blum D.L. Kataeva I.A. Li X.L. Ljungdahl L.G. J. Bacteriol. 2000; 182: 1346-1351Crossref PubMed Scopus (123) Google Scholar, 10Tamaru Y. Doi R.H. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4125-4129Crossref PubMed Scopus (73) Google Scholar). Bacterial cellulosomes are typically composed of a scaffolding protein containing several cohesin domains, which bind to the dockerin domains of the catalytic subunits. The complete dissociation of all known bacterial cellulosomes into individual components requires harsh treatments, such as elevated temperatures and/or the presence of chaotropic agents, thus reflecting the strength of the cohesin-dockerin interaction. In the case of Clostridium cellulolyticum and Clostridium thermocellum, the interaction is Ca2+-dependent (11Fierobe H.-P. Pagès S. Bélaı̈ch A. Champ S. Lexa D. Bélaı̈ch J.-P. Biochemistry. 1999; 38: 12822-12832Crossref PubMed Scopus (83) Google Scholar, 12Mechaly A. Fierobe H.-P. Bélaı̈ch A. Bélaı̈ch J.-P. Lamed R. Shoham Y. Bayer E.A. J. Biol. Chem. 2001; 276: 9883-9888Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar) and of high affinity (≥109m−1; see Refs. 11Fierobe H.-P. Pagès S. Bélaı̈ch A. Champ S. Lexa D. Bélaı̈ch J.-P. Biochemistry. 1999; 38: 12822-12832Crossref PubMed Scopus (83) Google Scholar and 13Schaeffer F. Matuschek M. Guglielmi G. Miras I. Alzari P.M. Beguin P. Biochemistry. 2002; 41: 2106-2114Crossref PubMed Scopus (64) Google Scholar). The scaffoldins produced by C. cellulolyticum and C. thermocellum contain multiple cohesin domains and a single family 3A cellulose-binding domain (CBD). 1The abbreviations used are: CBD, cellulose-binding domain; CBM, carbohydrate-binding module; BC, bacterial cellulose; BMCC, bacterial microcrystalline cellulose; PAS-cellulose, phosphoric acid swollen cellulose; DP, degree of polymerization The latter is located at the N terminus of the C. cellulolyticum scaffoldin, whereas the scaffoldin CBD from C. thermocellum adopts an internal position (14Pagès S. Bélaı̈ch A. Tardif C. Reverbel-Leroy C. Gaudin C. Bélaı̈ch J.-P. J. Bacteriol. 1996; 178: 2279-2286Crossref PubMed Google Scholar, 15Gerngross U.T. Romaniec M.P. Kobayashi T. Huskisson N.S. Demain A.L. Mol. Microbiol. 1993; 8: 325-334Crossref PubMed Scopus (178) Google Scholar). It has been shown for both species that the cohesins can interact with any of the dockerin domains of the same species, suggesting a random incorporation of the catalytic subunits along the scaffoldin (16Pagès S. Bélaı̈ch A. Fierobe H.-P. Tardif C. Gaudin C. Bélaı̈ch J.-P. J. Bacteriol. 1999; 181: 1801-1810Crossref PubMed Google Scholar, 17Gal L. Pagès S. Gaudin C. Bélaı̈ch A. Reverbel-Leroy C. Tardif C. Bélaı̈ch J.-P. Appl. Environ. Microbiol. 1997; 63: 903-909Crossref PubMed Google Scholar, 18Yaron S. Morag E. Bayer E.A. Lamed R. Shoham Y. FEBS Lett. 1995; 360: 121-124Crossref PubMed Scopus (125) Google Scholar). The cohesin-dockerin interaction, however, is species-specific, at least between these two clostridia (19Pagès S. Bélaı̈ch A. Bélaı̈ch J.-P. Morag E. Lamed R. Shoham Y. Bayer E.A. Proteins. 1997; 29: 517-527Crossref PubMed Scopus (185) Google Scholar). In a previous study (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), we exploited the species specificity of the cohesin-dockerin interaction to selectively incorporate desired enzymes into precise positions within chimeric cellulosome complexes. For this purpose, a chimeric scaffoldin containing an optional CBD and divergent cohesins from each species binds selectively the appropriate dockerin-containing enzymes. In this manner, two cellulases fromC. cellulolyticum, the family-5 CelA and the family-48 CelF, were engineered to bear the dockerin domain of CelS from C. thermocellum. The hybrid enzymes were then incorporated onto the chimeric scaffoldins together with the native CelA or CelF. It was observed that complexation induced enhanced levels of synergy, especially in the case of the heterogeneous enzyme mixtures (i.e. the native CelA and the hybrid CelF or vice versa). In the present report, the technology involving the use of cellulosome chimeras was further extended to study binary mixtures of all available cellulases from C. cellulolyticum bound to a chimeric scaffoldin. To increase the number of enzyme pairs that can be incorporated in the complex, the native dockerin of CelE, one of the two major enzymes of the cellulosomes (17Gal L. Pagès S. Gaudin C. Bélaı̈ch A. Reverbel-Leroy C. Tardif C. Bélaı̈ch J.-P. Appl. Environ. Microbiol. 1997; 63: 903-909Crossref PubMed Google Scholar) (the other one being CelF), was also replaced by the dockerin of CelS from C. thermocellum. Thus three different dockerin-engineered hybrid cellulases (CelA, CelE, and CelF) are now available for combination with one of the five available wild-type cellulases (CelA, CelC, CelE, CelF, and CelG). In addition, the collection of the four previously described chimeric scaffoldins, containing either one or lacking a family-3A CBD, was extended to include a fifth chimeric scaffoldin that bears a family-3A CBD at both extremities. In total, 75 different chimeric cellulosomes were assembled in vitro by mixing the three types of components, and their activity was assayed on various cellulose substrates of different source, crystallinity, and ultrastructure. The plasmids and encoded proteins used in this work are summarized in Fig. 1. Previous reports described the construction of pJFAc (21Fierobe H.-P. Gaudin C. Bélaı̈ch A. Loutfi M. Faure E. Bagnara C. Baty D. Bélaı̈ch J.-P. J. Bacteriol. 1991; 173: 7956-7962Crossref PubMed Google Scholar), pJFAt (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), pETEc (22Gaudin C. Bélaı̈ch A. Champ S. Bélaı̈ch J.-P. J. Bacteriol. 2000; 182: 1910-1915Crossref PubMed Scopus (71) Google Scholar), pETFc (23Reverbel-Leroy C. Bélaı̈ch A. Bernadac A. Gaudin C. Bélaı̈ch J.-P. Tardif C. Microbiology. 1996; 142: 1013-1023Crossref PubMed Scopus (43) Google Scholar), pETFt (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), pETGc (24Gal L. Gaudin C. Bélaı̈ch A. Pagès S. Tardif C. Bélaı̈ch J.-P. J. Bacteriol. 1997; 179: 6595-6601Crossref PubMed Google Scholar), pETscaf1 (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), pETscaf2 (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), pETscaf3 (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), pETscaf4 (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), pETCipC1 (14Pagès S. Bélaı̈ch A. Tardif C. Reverbel-Leroy C. Gaudin C. Bélaı̈ch J.-P. J. Bacteriol. 1996; 178: 2279-2286Crossref PubMed Google Scholar), pETcoh1A (11Fierobe H.-P. Pagès S. Bélaı̈ch A. Champ S. Lexa D. Bélaı̈ch J.-P. Biochemistry. 1999; 38: 12822-12832Crossref PubMed Scopus (83) Google Scholar), pET2CBD (18Yaron S. Morag E. Bayer E.A. Lamed R. Shoham Y. FEBS Lett. 1995; 360: 121-124Crossref PubMed Scopus (125) Google Scholar), and pQE-Coh2 (25Yaron S. Shimon L.J.W. Frolow F. Lamed R. Morag E. Shoham Y. Bayer E.A. J. Biotechnol. 1996; 51: 243-249Crossref PubMed Scopus (12) Google Scholar). The plasmid pJFCc, encoding Cel8C of C. cellulolyticumcontaining a His tag at the C terminus, was obtained by inserting the primer 5′-TCAGCTAAAAGTTAAACTGCTTAACCACCACCACCACCACCACTAGC-3′ into a BlpI site (the His tag is underlined in all sequences) located at the 3′-extremity of the coding sequence of pC17 (26Fierobe H.-P. Bagnara-Tardif C. Gaudin C. Guerlesquin F. Sauve P. Bélaı̈ch A. Bélaı̈ch J.-P. Eur. J. Biochem. 1993; 217: 557-565Crossref PubMed Scopus (59) Google Scholar). Replacement of the native dockerin of Cel9E by the dockerin of C. thermocellum Cel48S was performed by the overlap-extension PCR method (27Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6851) Google Scholar). The C. thermocellum dockerin-encoding region of pJFAt was amplified using the forward primer 5′-GATGAAAAGGGGCCAGAGATTGCCAAGACAAGCCCTAGCCCATC-3′ and reverse primer 5′-CCCCCCCTCGAGTTAGTGGTGGTGGTGGTGGTGGTTCTTGTACGGCAAT GT-3′, thus introducing an XhoI site (boldface type) at the 3′-extremity of the coding sequence. The region coding for the C-terminal part of the catalytic domain of Cel9E (including the uniqueBamHI site in pETEc) was amplified using the forward 5′-GTCATATGCTTATGAATTCAG-3′ and reverse 5′-GATGGGCTAGGGCTTGTCTTGGCAATCTCTGGCCCCTTTTCATC-3′ primers. The two resultant overlapping fragments (overlapping regions in italics) were mixed, and a combined fragment was synthesized using the external primers. The fragment was cloned intoBamHI-XhoI linearized pETEc, thereby generating pETEt. pETscaf5 was constructed from pETCip1X (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar) coding for the miniCipC1 (C. cellulolyticum) and pET2CBD encoding cohesin2-CBD from CipA of C. thermocellum. The region encoding cohesin2-CBD from C. thermocellum was amplified using the forward 5′-GGGCGGCTCGAGGTTCCGTCAGACGGT-3′ and reverse 5′-GGGCGGCTCGAGTATTGCATTCGGATCATC-3′ primers, introducing anXhoI site (boldface) at both extremities of the coding sequence. The resulting fragment was cloned intoXhoI-linearized pETCip1X, thus generating pETscaf5. Positive clones were verified by DNA sequencing. DH5α and JM109Escherichia coli strains (Clontech, Palo Alto CA) were used as production hosts for pJF and pQE derivatives, respectively. For pET derivatives, BL21(DE3) (Novagen, Madison, WI), was used as production host. E. coli was grown at 37 °C toA 600 = 1.5 in Luria-Bertani medium supplemented with glycerol (12 g/liter) and the appropriate antibiotic. The culture was then cooled to 25 (5Ac, 5At, 8Cc, all cohesin(s)-containing proteins), 18 (48Fc and 48Ft), or 15 °C (9Ec, 9Et, and 9Gc), and isopropyl thio-β-d-galactoside was added to a final concentration of 400 (5Ac, 5At, 8Cc, all cohesin(s)-containing proteins) or 40 μm (48Fc, 48Ft, 9Ec, 9Et, and 9Gc). After 16 h, the cells were harvested by centrifugation (3000 ×g, 20 min), resuspended in 30 mm Tris-HCl, pH 8, and broken in a French press. The purification of His-tagged proteins (see Fig. 1) was performed on nickel-nitrilotriacetic acid resin (28Porath J. Carlsson J. Olsson I. Belfrage G. Nature. 1975; 258: 598-599Crossref PubMed Scopus (1762) Google Scholar) (Qiagen, Venlo, The Netherlands). Scaf1, Scaf2, miniCipC1, and C2-CBDt were purified on Avicel PH101 (Fluka, Buchs, Switzerland) as described previously (18Yaron S. Morag E. Bayer E.A. Lamed R. Shoham Y. FEBS Lett. 1995; 360: 121-124Crossref PubMed Scopus (125) Google Scholar). Purification was achieved on Q-Sepharose fast flow (Amersham Biosciences) equilibrated in 25 mmTris-HCl, pH 8.5. The proteins of interest were eluted by a linear gradient from 0 to 400 mm NaCl in 25 mmTris-HCl, pH 8.5. The concentration of purified proteins was routinely estimated by absorbance (280 nm) in 6 m guanidine hydrochloride and 25 mm sodium phosphate, pH 6.5, using the program ProtParam tool (www.expasy.ch/tools/protparam.html) and also by quantitative amino acid analysis on a Beckman 6300 system (Fullerton, CA) using ninhydrin detection. The protein samples were dialyzed by ultrafiltration against 10 mm Tris-HCl, pH 8.0, 1 mm CaCl2, aliquoted, and stored at −20 °C. The β-glucosidase Novozyme 188 (Novozymes, Bagsvaerd, Denmark) produced by Aspergillus niger was purified by gel filtration as described previously (29Boisset C. Fraschini C. Schülein M. Henrissat B. Chanzy H. Appl. Environ. Microbiol. 2000; 66: 1444-1452Crossref PubMed Scopus (185) Google Scholar) except that AcA34 Ultrogel (Sepracor, Villeneuve-la-Garenne, France), equilibrated in 50 mm Tris-HCl, pH 7.5, 0.2 m NaCl, was used. The activity of the fractions was analyzed usingp-nitrophenyl β-d-glucopyranoside (Sigma), and the purity was verified by SDS-PAGE (Phast System, AmershamBiosciences). Fractions containing a single band at around 100 kDa were pooled and concentrated using a PM10 membrane (Millipore, Bedford, MA) with a cut-off of 10 kDa. The protein concentration was determined by the method of Lowry et al. (30Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar), using bovine serum albumin as the standard. The cellulosome produced by C. cellulolyticum was purified as described previously (17Gal L. Pagès S. Gaudin C. Bélaı̈ch A. Reverbel-Leroy C. Tardif C. Bélaı̈ch J.-P. Appl. Environ. Microbiol. 1997; 63: 903-909Crossref PubMed Google Scholar) from 1 liter of culture after 5 days of growth in a medium containing 7.5 g/liter of cellulose as the carbon source. The final protein concentration was determined as above. Samples (10 μm final concentration) were mixed at room temperature in 20 mm Tris maleate, pH 6.0, 10 mm CaCl2, and 100 mm NaCl, and 1–4 μl were subjected to PAGE (4–15% gradient) using a PhastSystem device (Amersham Biosciences). Proteins (10 μm final concentration) were mixed at room temperature in 20 mm Tris maleate, pH 6.0, 1 mm CaCl2, 0.01% NaN3, and incubated at 37 °C. Aliquots were pipetted at 0, 1, 6, and 24 h, and their residual activity toward carboxymethyl cellulose (Sigma) (8 g/liter) was determined as described previously (21Fierobe H.-P. Gaudin C. Bélaı̈ch A. Loutfi M. Faure E. Bagnara C. Baty D. Bélaı̈ch J.-P. J. Bacteriol. 1991; 173: 7956-7962Crossref PubMed Google Scholar). The samples were also subjected to nondenaturing PAGE (4–15% gradient) and to SDS-PAGE (12.5%) after addition of loading buffer (25% v/v) and 5 min of boiling. An aqueous suspension of homogenized ribbons of bacterial cellulose (BC) was prepared from Nata de coco (Daiwa Fine Products, Singapore) as described previously (29Boisset C. Fraschini C. Schülein M. Henrissat B. Chanzy H. Appl. Environ. Microbiol. 2000; 66: 1444-1452Crossref PubMed Scopus (185) Google Scholar). Bacterial microcrystalline cellulose (BMCC) was prepared from BC as described previously (31Väljamäe P. Sild V. Nutt A. Pettersson G. Johansson G. Eur. J. Biochem. 1999; 266: 327-334Crossref PubMed Scopus (126) Google Scholar). The concentration was determined by dry weight and by neutral sugar analysis (32Dubois M. Gilles K.A. Hamilton J.K. Rebers P.A. Smith F. Anal. Chem. 1956; 28: 350-356Crossref Scopus (41197) Google Scholar). Phosphoric acid swollen (PAS)-cellulose was obtained from Avicel PH101 according to Ref. 33Walseth C.S. Tech. Assoc. Pulp Pap. Ind. 1952; 35: 228-233Google Scholar. Relative crystallinity indices of the cellulose suspensions (20 ml, 1 g/liter) were verified by x-ray diffraction (31Väljamäe P. Sild V. Nutt A. Pettersson G. Johansson G. Eur. J. Biochem. 1999; 266: 327-334Crossref PubMed Scopus (126) Google Scholar) after vacuum filtration and air drying. The celluloses were resuspended in 20 mm Tris maleate, 1 mm CaCl2, and 0.01% NaN3. Aliquots (40 μl) of the protein samples (10 μm in 20 mm Tris maleate, pH 6.0, 10 mm CaCl2, and 100 mm NaCl) were incubated at 37 °C with 4 ml of substrate. The final protein concentration was thus 0.1 μm. At 0, 1, 6, and 24 h, 0.9-ml aliquots were centrifuged and examined for reducing sugars (34Park J.T. Johnson M.S. J. Biol. Chem. 1949; 181: 149-151Abstract Full Text PDF PubMed Google Scholar). In selected experiments, purified β-glucosidase (see above) was added at a final concentration of 0.05 g/liter. In this case, aliquots were examined after centrifugation for reducing sugars (34Park J.T. Johnson M.S. J. Biol. Chem. 1949; 181: 149-151Abstract Full Text PDF PubMed Google Scholar) and glucose content using the glucose oxidase method (35Huggett A.S.G. Nixon D.A. Lancet. 1957; 2: 368-370Abstract Scopus (1123) Google Scholar). The recombinant and engineered proteins (scaffoldins and enzymes), used in this study for incorporation into cellulosome chimeras, are presented in Fig. 1. Based on data published earlier (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), which demonstrated that scaffoldins containing a single CBD (Scaf1, -2, and -3) induced higher stimulation than those lacking a CBD (Scaf4), a fifth hybrid scaffoldin, derived from Scaf3, was designed and produced in E. coli. The resultant protein (Scaf5) contained a second family 3A CBD, stemming from CipA of C. thermocellum and located at the C terminus. Thus, Scaf5 contains one family 3A CBD from both species. The replacement of the intrinsic dockerin domain of CelE fromC. cellulolyticum by the dockerin of CelS from C. thermocellum was also performed, thereby generating 9Et. For the purposes of this study, the enzymes are given a descriptive notation (see Fig. 1), whereby the initial number designates the corresponding glycosylhydrolase family (36Coutinho P.M. Henrissat B. Ohmiya K. Hayashi K. Sakka K. Kobayashi Y. Karita S. Kimura T. Genetics, Biochemistry and Ecology of Cellulose Degradation. Uni Publishers Co., Tokyo1999: 15-23Google Scholar); the capital letter refers to the original name of the C. cellulolyticum cellulase (i.e. CelE in this instance), and the lowercase letter indicates the origin of the dockerin domain (either C. cellulolyticum or C. thermocellum). Three hybridC. cellulolyticum cellulases, bearing a C. thermocellum dockerin, were therefore available, 5At, 9Et, and 48Ft, and can be complemented for assembly of chimeric complexes by one of the five available native cellulases 5Ac (21Fierobe H.-P. Gaudin C. Bélaı̈ch A. Loutfi M. Faure E. Bagnara C. Baty D. Bélaı̈ch J.-P. J. Bacteriol. 1991; 173: 7956-7962Crossref PubMed Google Scholar), 8Cc (26Fierobe H.-P. Bagnara-Tardif C. Gaudin C. Guerlesquin F. Sauve P. Bélaı̈ch A. Bélaı̈ch J.-P. Eur. J. Biochem. 1993; 217: 557-565Crossref PubMed Scopus (59) Google Scholar), 9Ec (22Gaudin C. Bélaı̈ch A. Champ S. Bélaı̈ch J.-P. J. Bacteriol. 2000; 182: 1910-1915Crossref PubMed Scopus (71) Google Scholar), 48Fc (37Reverbel-Leroy C. Pagès S. Bélaı̈ch A. Bélaı̈ch J.-P. Tardif C. J. Bacteriol. 1997; 179: 46-52Crossref PubMed Google Scholar), and 9Gc (24Gal L. Gaudin C. Bélaı̈ch A. Pagès S. Tardif C. Bélaı̈ch J.-P. J. Bacteriol. 1997; 179: 6595-6601Crossref PubMed Google Scholar). C. cellulolyticum cellulases 5Ac and 8Cc were described previously as typical endoglucanases (21Fierobe H.-P. Gaudin C. Bélaı̈ch A. Loutfi M. Faure E. Bagnara C. Baty D. Bélaı̈ch J.-P. J. Bacteriol. 1991; 173: 7956-7962Crossref PubMed Google Scholar, 26Fierobe H.-P. Bagnara-Tardif C. Gaudin C. Guerlesquin F. Sauve P. Bélaı̈ch A. Bélaı̈ch J.-P. Eur. J. Biochem. 1993; 217: 557-565Crossref PubMed Scopus (59) Google Scholar), whereas 9Gc is an unusual endocellulase, the activity pattern of which resembles that of the homologous enzyme Cel9A from Thermobifida fusca (24Gal L. Gaudin C. Bélaı̈ch A. Pagès S. Tardif C. Bélaı̈ch J.-P. J. Bacteriol. 1997; 179: 6595-6601Crossref PubMed Google Scholar, 38Irwin D. Shin D.-H. Zhang S. Barr B.K. Sakon J. Karplus P.A. Wilson D.B. J. Bacteriol. 1998; 180: 1709-1714Crossref PubMed Google Scholar). Cellulosomal enzyme subunits 9Ec and 48Fc, however, were unambiguously identified as endo-processive cellulases (22Gaudin C. Bélaı̈ch A. Champ S. Bélaı̈ch J.-P. J. Bacteriol. 2000; 182: 1910-1915Crossref PubMed Scopus (71) Google Scholar, 37Reverbel-Leroy C. Pagès S. Bélaı̈ch A. Bélaı̈ch J.-P. Tardif C. J. Bacteriol. 1997; 179: 46-52Crossref PubMed Google Scholar). As shown in Fig. 1, 9Ec (or 9Et) and 9Gc contain additional accessory domain(s) compared with the other cellulases used in the present study; 9Ec has a family-4 CBM and an Ig-like domain at the N terminus, whereas 9Gc contains a family-3C CBM between the catalytic domain and the C-terminal dockerin domain. Thus 15 different enzyme pairs can be incorporated onto each of the five hybrid scaffoldin leading to 75 different cellulosome chimeras. The various proteins were produced in E. coli and were purified by a two-step procedure. The first step involved affinity chromatography on either cellulose or nickel-nitrilotriacetic acid according to the presence of a CBD or His tag, respectively; final purification was subsequently achieved by a chromatography on an anion exchanger. Prior to addition of the substrate, stoichiometric mixtures of two desired enzymes and a test scaffoldin were subjected to nondenaturing PAGE in order to verify complex formation. As described previously (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), all ternary mixtures resulted in a single major band of altered mobility, indicating that complete or near-complete complex formation was observed in all cases. Enzyme pairs in the free state displayed little or no synergy on 3.5 g/liter Avicel, except the 48Ft + 9Gc pair for which the synergy reaches 2 (TableI). In contrast, most ternary complexes were found to be more active than the corresponding free enzyme pairs. The enhancement of the activity increased with incubation time to reach a maximum at 24 h, in the case of scaffoldins containing one or two CBDs, whereas for Scaf4-containing complexes the maximum enhancement was often reached after 6 h and remained constant until the end of the kinetic study (data not shown). The highest stimulation factors (SF, Table I), because of complexation, were observed for 5At and 9Gc bound to Scaf1 or Scaf2. In general, for a given enzyme pair, the same “hierarchy” between the scaffoldins in terms of activity enhancement was found: Scaf1 = Scaf2 > Scaf3 > Scaf5 ≥ Scaf4, thus indicating that the second family 3A CBD introduced in Scaf5 has a negative impact on the activity of the complexes, because Scaf3-containing complexes were more efficient. Lower but significant enhancements were observed for complexes containing Scaf4; the values varied from 3.5 (5At + 9Gc) to no enhancement for homogeneous enzyme pairs such as 9Et + 9Ec, indicating that in most cases bringing two different cellulases together is enough to trigger enhanced synergy. This suggests that the increase of activity observed when enzyme pairs are bound to Scaf2, for instance, is because of both the proximity of the catalytic domains in the complex and the presence of the family 3A CBD of the scaffoldin. To estimate the relative contribution of the CBD and the proximity in this type of complex, the data obtained with Scaf2 and -4 (Table I) were plotted in Fig.2 A. On the abscissaare reported the enhanced synergies exclusively due to enzyme proximity (SFScaf4), and the ordinates represent the calculated contribution of the CBD in Scaf2-based complexes (SFScaf2/SFScaf4). Many spots are located near or just above the diagonal line, indicating that both the CBD and the proximity of the enzymes contribute almost equally to the enhanced synergy observed for the Scaf2-based complexes. For selected enzyme pairs, however, one effect seemed to predominate over the other. For example, the inclusion of 48Ft and 8Cc into a Scaf4-based complex has no impact on the activity, and the observed enhancement when these cellulases are bound to Scaf2 would presumably reflect the presence of the CBD of the scaffoldin. On the other hand, the impact of the enzyme proximity is predominant when the cellulase pair 5At + 9Gc is attached to Scaf2, although the CBD still induces an additional 2-fold increase. An unexpected result concerns the homogeneous enzyme pair 5At + 5Ac, which, as previously reported (20Fierobe H.-P. Mechaly A. Tardif C. Bélaı̈ch A. Lamed R. Shoham Y. Bélaı̈ch J.-P. Bayer E.A. J. Biol. Chem. 2001; 276: 21257-21261Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar), is 30–40% more active when bound to Scaf4. On the basis of these data, the impact of the complexation of these two enzyme pairs was subjected to additional investigation.Table IReleased soluble sugars from Avicel (3.5 g/liter) after 24 h at 37 °C by cellulosome chimeras, free enzyme pairs, and free enzymesPairsScaf1Scaf2Scaf3Scaf4Scaf5Free enzyme pairsμmSF1-aStimulation Factor (SF) is the impact of the complexation of an enzyme pair on a given scaffoldin: SF = (released soluble sugars by ternary complex)/(released soluble sugars by the corresponding free enzyme pairs).μmSFμmSFμmSFμmSFμmsynergy1-bSynergy between enzymes in the free state: synergy factor = (released soluble sugars by a free enzyme pair)/(sum of released soluble sugars by corresponding enzymes alone).5At/5Ac701-cAverages of 2–6 e" @default.
• W2006223695 created "2016-06-24" @default.
• W2006223695 creator A5005689103 @default.
• W2006223695 creator A5007452889 @default.
• W2006223695 creator A5013855075 @default.
• W2006223695 creator A5045973927 @default.
• W2006223695 creator A5057228291 @default.
• W2006223695 creator A5060754910 @default.
• W2006223695 creator A5062483518 @default.
• W2006223695 creator A5071192479 @default.
• W2006223695 creator A5079418780 @default.
• W2006223695 date "2002-12-01" @default.
• W2006223695 modified "2023-10-18" @default.
• W2006223695 title "Degradation of Cellulose Substrates by Cellulosome Chimeras" @default.
• W2006223695 cites W1528715746 @default.
• W2006223695 cites W1561750927 @default.
• W2006223695 cites W1574334279 @default.
• W2006223695 cites W1775749144 @default.
• W2006223695 cites W1923082905 @default.
• W2006223695 cites W1967990382 @default.
• W2006223695 cites W1968329759 @default.
• W2006223695 cites W1968834637 @default.
• W2006223695 cites W1969439217 @default.
• W2006223695 cites W1975624480 @default.
• W2006223695 cites W1983140978 @default.
• W2006223695 cites W1984636178 @default.
• W2006223695 cites W1988266865 @default.
• W2006223695 cites W1989448360 @default.
• W2006223695 cites W1996974482 @default.
• W2006223695 cites W1997189279 @default.
• W2006223695 cites W1999336080 @default.
• W2006223695 cites W2000662339 @default.
• W2006223695 cites W2003470884 @default.
• W2006223695 cites W2029045342 @default.
• W2006223695 cites W2039229660 @default.
• W2006223695 cites W2046017287 @default.
• W2006223695 cites W2055095001 @default.
• W2006223695 cites W2060913542 @default.
• W2006223695 cites W2078149273 @default.
• W2006223695 cites W2082396629 @default.
• W2006223695 cites W2082553848 @default.
• W2006223695 cites W2086890067 @default.
• W2006223695 cites W2090651336 @default.
• W2006223695 cites W2091664616 @default.
• W2006223695 cites W2095254228 @default.
• W2006223695 cites W2098787289 @default.
• W2006223695 cites W2099172250 @default.
• W2006223695 cites W2113729289 @default.
• W2006223695 cites W2115780236 @default.
• W2006223695 cites W2123527619 @default.
• W2006223695 cites W2128012804 @default.
• W2006223695 cites W2132411280 @default.
• W2006223695 cites W2133853189 @default.
• W2006223695 cites W2134359468 @default.
• W2006223695 cites W2135038396 @default.
• W2006223695 cites W2146833798 @default.
• W2006223695 cites W2152156215 @default.
• W2006223695 cites W2152310034 @default.
• W2006223695 cites W2170765652 @default.
• W2006223695 cites W2198954883 @default.
• W2006223695 cites W72184262 @default.
• W2006223695 doi "https://doi.org/10.1074/jbc.m207672200" @default.
• W2006223695 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12397074" @default.
• W2006223695 hasPublicationYear "2002" @default.
• W2006223695 type Work @default.
• W2006223695 sameAs 2006223695 @default.
• W2006223695 citedByCount "267" @default.
• W2006223695 countsByYear W20062236952012 @default.
• W2006223695 countsByYear W20062236952013 @default.
• W2006223695 countsByYear W20062236952014 @default.
• W2006223695 countsByYear W20062236952015 @default.
• W2006223695 countsByYear W20062236952016 @default.
• W2006223695 countsByYear W20062236952017 @default.
• W2006223695 countsByYear W20062236952018 @default.
• W2006223695 countsByYear W20062236952019 @default.
• W2006223695 countsByYear W20062236952020 @default.
• W2006223695 countsByYear W20062236952021 @default.
• W2006223695 countsByYear W20062236952022 @default.
• W2006223695 countsByYear W20062236952023 @default.
• W2006223695 crossrefType "journal-article" @default.
• W2006223695 hasAuthorship W2006223695A5005689103 @default.
• W2006223695 hasAuthorship W2006223695A5007452889 @default.
• W2006223695 hasAuthorship W2006223695A5013855075 @default.
• W2006223695 hasAuthorship W2006223695A5045973927 @default.
• W2006223695 hasAuthorship W2006223695A5057228291 @default.
• W2006223695 hasAuthorship W2006223695A5060754910 @default.
• W2006223695 hasAuthorship W2006223695A5062483518 @default.
• W2006223695 hasAuthorship W2006223695A5071192479 @default.
• W2006223695 hasAuthorship W2006223695A5079418780 @default.
• W2006223695 hasBestOaLocation W20062236951 @default.
• W2006223695 hasConcept C104317684 @default.
• W2006223695 hasConcept C141603559 @default.
• W2006223695 hasConcept C185592680 @default.
• W2006223695 hasConcept C2776029434 @default.
• W2006223695 hasConcept C2776061948 @default.
• W2006223695 hasConcept C2779251873 @default.
• W2006223695 hasConcept C2779679103 @default.
• W2006223695 hasConcept C30278631 @default.

• next