FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006495215> ?p ?o ?g. }

• W2006495215 endingPage "12473" @default.
• W2006495215 startingPage "12463" @default.
• W2006495215 abstract "Na+/Ca2+ exchanger-1 (NCX1) is a major calcium extrusion mechanism in renal epithelial cells enabling the efflux of one Ca2+ ion and the influx of three Na+ ions. The gradient for this exchange activity is provided by Na,K-ATPase, a hetero-oligomer consisting of a catalytic α-subunit and a regulatory β-subunit (Na,K-β) that also functions as a motility and tumor suppressor. We showed earlier that mice with heart-specific ablation (KO) of Na,K-β had a specific reduction in NCX1 protein and were ouabain-insensitive. Here, we demonstrate that Na,K-β associates with NCX1 and regulates its localization to the cell surface. Madin-Darby canine kidney cells with Na,K-β knockdown have reduced NCX1 protein and function accompanied by 2.1-fold increase in free intracellular calcium and a corresponding increase in the rate of cell migration. Increased intracellular calcium up-regulated ERK1/2 via calmodulin-dependent activation of PI3K. Both myosin light chain kinase and Rho-associated kinase acted as mediators of ERK1/2-dependent migration. Restoring NCX1 expression in β-KD cells reduced migration rate and ERK1/2 activation, suggesting that NCX1 functions downstream of Na,K-β in regulating cell migration. In parallel, inhibition of NCX1 by KB-R7943 in Madin-Darby canine kidney cells, LLC-PK1, and human primary renal epithelial cells (HREpiC) increased ERK1/2 activation and cell migration. This increased migration was associated with high myosin light chain phosphorylation by PI3K/ERK-dependent mechanism in HREpiC cells. These data confirm the role of NCX1 activity in regulating renal epithelial cell migration. Na+/Ca2+ exchanger-1 (NCX1) is a major calcium extrusion mechanism in renal epithelial cells enabling the efflux of one Ca2+ ion and the influx of three Na+ ions. The gradient for this exchange activity is provided by Na,K-ATPase, a hetero-oligomer consisting of a catalytic α-subunit and a regulatory β-subunit (Na,K-β) that also functions as a motility and tumor suppressor. We showed earlier that mice with heart-specific ablation (KO) of Na,K-β had a specific reduction in NCX1 protein and were ouabain-insensitive. Here, we demonstrate that Na,K-β associates with NCX1 and regulates its localization to the cell surface. Madin-Darby canine kidney cells with Na,K-β knockdown have reduced NCX1 protein and function accompanied by 2.1-fold increase in free intracellular calcium and a corresponding increase in the rate of cell migration. Increased intracellular calcium up-regulated ERK1/2 via calmodulin-dependent activation of PI3K. Both myosin light chain kinase and Rho-associated kinase acted as mediators of ERK1/2-dependent migration. Restoring NCX1 expression in β-KD cells reduced migration rate and ERK1/2 activation, suggesting that NCX1 functions downstream of Na,K-β in regulating cell migration. In parallel, inhibition of NCX1 by KB-R7943 in Madin-Darby canine kidney cells, LLC-PK1, and human primary renal epithelial cells (HREpiC) increased ERK1/2 activation and cell migration. This increased migration was associated with high myosin light chain phosphorylation by PI3K/ERK-dependent mechanism in HREpiC cells. These data confirm the role of NCX1 activity in regulating renal epithelial cell migration. Enhanced cell migration is a prerequisite for tumor cell invasion and metastasis. Calcium-dependent signaling is essential for directional movement, reorganization of actin cytoskeleton, and cleaving of cell-cell and cell-substrate attachments in the regulation of cell migration (1Monteith G.R. Davis F.M. Roberts-Thomson S.J. Calcium channels and pumps in cancer: changes and consequences.J. Biol. Chem. 2012; 287: 31666-31673Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 2Monteith G.R. McAndrew D. Faddy H.M. Roberts-Thomson S.J. Calcium and cancer: targeting Ca2+ transport.Nat. Rev. Cancer. 2007; 7: 519-530Crossref PubMed Scopus (528) Google Scholar3Parsons J.T. Horwitz A.R. Schwartz M.A. Cell adhesion: integrating cytoskeletal dynamics and cellular tension.Nat. Rev. Mol. Cell Biol. 2010; 11: 633-643Crossref PubMed Scopus (1348) Google Scholar). Thus, alteration in intracellular calcium levels can contribute to cell migration and invasion. Regulation of intracellular Ca2+ involves a balance between Ca2+ influx and efflux, which is governed by membrane-associated ion channels, ATPases, exchangers, and binding proteins. Indeed, modulation of specific calcium channels or pumps is associated with certain cancers. For example, transient receptor potential channel 8 (TRPM8) up-regulation in prostate cancer (4Tsavaler L. Shapero M.H. Morkowski S. Laus R. Trp-p8, a novel prostate-specific gene, is up-regulated in prostate cancer and other malignancies and shares high homology with transient receptor potential calcium channel proteins.Cancer Res. 2001; 61: 3760-3769PubMed Google Scholar) and sarco/endoplasmic reticulum calcium transport ATPase 3 (SERCA3) 2The abbreviations used are:SERCAsarco/endoplasmic reticulum calcium transport ATPaseNCX1sodium-calcium exchanger 1Na,K-αNa,K-ATPase α-subunitNa,K-βNa,K-ATPase β-subunitMDCKMadin-Darby canine kidneyPMCAplasma membrane calcium ATPaseβ-KDβ knockdownβ-KD/Rβ-KD cells rescued by overexpression of shRNA resistant Na,K-βHREpiChuman primary renal epithelial cellsECISelectrical cell-substrate impedance sensingMLCmyosin light chain. down-regulation in colon cancer (5Brouland J.P. Gélébart P. Kovàcs T. Enouf J. Grossmann J. Papp B. The loss of sarco/endoplasmic reticulum calcium transport ATPase 3 expression is an early event during the multistep process of colon carcinogenesis.Am J. Pathol. 2005; 167: 233-242Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) has been reported. sarco/endoplasmic reticulum calcium transport ATPase sodium-calcium exchanger 1 Na,K-ATPase α-subunit Na,K-ATPase β-subunit Madin-Darby canine kidney plasma membrane calcium ATPase β knockdown β-KD cells rescued by overexpression of shRNA resistant Na,K-β human primary renal epithelial cells electrical cell-substrate impedance sensing myosin light chain. In renal epithelial cells, the sodium-calcium exchanger 1 (NCX1), plasma membrane calcium ATPase (PMCA), and SERCA ATPases are the major regulators of intracellular Ca2+ ion concentration, with NCX1 being the protein responsible for Ca2+ extrusion (6Goldhaber J.I. Philipson K.D. Cardiac sodium-calcium exchange and efficient excitation-contraction coupling: implications for heart disease.Adv. Exp. Med. Biol. 2013; 961: 355-364Crossref PubMed Scopus (36) Google Scholar, 7Matsuda T. Takuma K. Baba A. Na+-Ca2+ exchanger: physiology and pharmacology.Jpn. J. Pharmacol. 1997; 74: 1-20Crossref PubMed Scopus (96) Google Scholar). The two other isoforms NCX2 and NCX3 are not expressed in the kidney (8Lytton J. Na+/Ca2+ exchangers: three mammalian gene families control Ca2+ transport.Biochem. J. 2007; 406: 365-382Crossref PubMed Scopus (286) Google Scholar). NCX1 consists of a 9 α-helical transmembrane domain and a large (550 residue) cytosolic domain that has two Ca2+ binding sites that mediate the extrusion of a Ca2+ and the influx of 3 Na+ in one exchange movement in the forward mode (9Hilge M. Aelen J. Vuister G.W. Ca2+ regulation in the Na+/Ca2+ exchanger involves two markedly different Ca2+ sensors.Mol. Cell. 2006; 22: 15-25Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). NCX1 has also been shown to function in reverse mode, i.e. the exchanger can cause an influx of the Ca2+ ions into the cells depending on intracellular Na+, Ca2+, pH, ATP, and membrane potential (10Reeves J.P. Na+/Ca2+ exchange and cellular Ca2+ homeostasis.J. Bioenerg. Biomembr. 1998; 30: 151-160Crossref PubMed Scopus (41) Google Scholar). Although there is no direct evidence linking NCX1 to cancer, there are isolated studies indicating that NCX1 is involved in cell adhesion. For example, cell adhesion in prostate epithelial cells induced by stromal cell co-culture caused an up-regulation of NCX1 transcript level among other genes involved in cell adhesion (11Chambers K.F. Pearson J.F. Pellacani D. Aziz N. Gužvić M. Klein C.A. Lang S.H. Stromal upregulation of lateral epithelial adhesions: gene expression analysis of signalling pathways in prostate epithelium.J. Biomed. Sci. 2011; 18: 45Crossref PubMed Scopus (12) Google Scholar). Furthermore, inhibition of NCX1 activity by KB-R7943 down-regulated cell adhesion molecule ICAM1 and suppressed cell adhesion (12Li J. Jin H.B. Sun Y.M. Su Y. Wang L.F. KB-R7943 inhibits high glucose-induced endothelial ICAM-1 expression and monocyte-endothelial adhesion.Biochem. Biophys. Res. Commun. 2010; 392: 516-519Crossref PubMed Scopus (12) Google Scholar). NCX1 works in close partnership with Na,K-ATPase, by utilizing the sodium gradient generated by Na,K-ATPase to drive calcium efflux. Na,K-ATPase has also been shown to function as a motility and tumor suppressor (13Barwe S.P. Anilkumar G. Moon S.Y. Zheng Y. Whitelegge J.P. Rajasekaran S.A. Rajasekaran A.K. Novel role for Na,K-ATPase in phosphatidylinositol 3-kinase signaling and suppression of cell motility.Mol. Biol. Cell. 2005; 16: 1082-1094Crossref PubMed Scopus (134) Google Scholar, 14Inge L.J. Rajasekaran S.A. Yoshimoto K. Mischel P.S. McBride W. Landaw E. Rajasekaran A.K. Evidence for a potential tumor suppressor role for the Na,K-ATPase β1-subunit.Histol. Histopathol. 2008; 23: 459-467PubMed Google Scholar) and is involved in the maintenance of epithelial polarity (15Rajasekaran S.A. Palmer L.G. Quan K. Harper J.F. Ball Jr., W.J. Bander N.H. Peralta Soler A. Rajasekaran A.K. Na,K- ATPase β-subunit is required for epithelial polarization, suppression of invasion, and cell motility.Mol. Biol. Cell. 2001; 12: 279-295Crossref PubMed Scopus (169) Google Scholar) and cell adhesion (16Barwe S.P. Kim S. Rajasekaran S.A. Bowie J.U. Rajasekaran A.K. Janus model of the Na,K-ATPase β-subunit transmembrane domain: distinct faces mediate α/β assembly and β-β homo-oligomerization.J. Mol. Biol. 2007; 365: 706-714Crossref PubMed Scopus (45) Google Scholar, 17Kitamura N. Ikekita M. Sato T. Akimoto Y. Hatanaka Y. Kawakami H. Inomata M. Furukawa K. Mouse Na+/K+-ATPase β1-subunit has a K+-dependent cell adhesion activity for β-GlcNAc- terminating glycans.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 2796-2801Crossref PubMed Scopus (43) Google Scholar). Moreover, we previously reported that knockdown of Na,K-ATPase β1-subunit (Na,K-β) in MDCK cells led to mesenchymal phenotype accompanied by increased cell proliferation via activation of phosphoinositide-3 kinase (PI3K)/Akt and extracellular-signal-regulated kinase (ERK1/2) pathways (18Barwe S.P. Skay A. McSpadden R. Huynh T.P. Langhans S.A. Inge L.J. Rajasekaran A.K. Na,K-ATPase β-subunit cis homo-oligomerization is necessary for epithelial lumen formation in mammalian cells.J. Cell Sci. 2012; 125: 5711-5720Crossref PubMed Scopus (9) Google Scholar). In this study we demonstrate that MDCK cells with Na,K-β knockdown (β-KD) showed reduced NCX1 protein expression leading to an increase in intracellular calcium. Furthermore, we provide evidence that Na,K-β interacts with NCX1 and regulates NCX1 membrane localization. The activation of ERK1/2 and enhanced cell migration in β-KD cells was calcium-dependent and could be reversed when NCX1 was overexpressed in β-KD cells. Increased intracellular calcium activated calmodulin/PI3K/ERK signaling leading to myosin light chain kinase/Rho-associated protein kinase-dependent migration. Furthermore, inhibition of NCX1 in MDCK, LLC-PK1, and human primary renal epithelial cells (HREpiC) also led to activation of ERK1/2 and enhanced cell migration. Thus, our data reveal a novel role of forward mode NCX1 in regulation of cell migration in renal epithelial cells. DMEM supplemented with 10% fetal bovine serum, 2 mm l-glutamine, 25 units/ml penicillin, and 25 μg/ml streptomycin was used to grow MDCK and LLC-PK1 cells. Similarly, MDCK-Na,K-β1-KD and rescue cells (β-KD/R) as described in Barwe et al. (18Barwe S.P. Skay A. McSpadden R. Huynh T.P. Langhans S.A. Inge L.J. Rajasekaran A.K. Na,K-ATPase β-subunit cis homo-oligomerization is necessary for epithelial lumen formation in mammalian cells.J. Cell Sci. 2012; 125: 5711-5720Crossref PubMed Scopus (9) Google Scholar) were also cultured in supplemented DMEM. β-KD cells were maintained in 10 μg/ml puromycin, and β-KD/R cells were maintained in 10 μg/ml puromycin and 500 μg/ml neomycin. Full-length canine NCX1, a kind gift from Dr. Kenneth Philipson, UCLA (19Ottolia M. John S. Ren X. Philipson K.D. Fluorescent Na+-Ca2+ exchangers: electrophysiological and optical characterization.J. Biol. Chem. 2007; 282: 3695-3701Abstract Full Text Full Text PDF PubMed Scopus (6) Google Scholar), was transfected in β-KD cells using the calcium phosphate transfection method, and NCX1 expressing β-KD cells were selected with 10 μg/ml puromycin and 100 μg/ml hygromycin post transfection. β-KD cells were also transfected with pWZL-neo Δ-p85 (Addgene Plasmid #10888) and selected with 10 μg/ml puromycin and 500 μg/ml neomycin post transfection. The cells that survived the selection media were confirmed to express the transfected constructs and were utilized for the experiments. HREpiC purchased from ScienCell™ (Carlsbad, CA) were maintained as per the supplier's recommendations and treated with inhibitors as indicated. Monoclonal Na,K-β1 (M17-P5-F11) antibody from ThermoFisher Scientific Inc. (Waltham, MA) and monoclonal NCX1 antibody from Abcam® (Cambridge, MA) were used. Antibodies against PMCA4 and SERCA2 were purchased from BIOSS antibodies (Woburn, MA). Antibodies against phospho-p44/p42 MAPK (ERK1/2), total p44/p42 MAPK (ERK1/2), phospho-Akt (Ser-473), total Akt, phospho p70S6 kinase (Thr-389), phospho MLC2 (Ser-19), and horseradish peroxidase-conjugated secondary antibodies against mouse and rabbit IgG were obtained from Cell Signaling Technology® (Lexington, KY). Monoclonal β-actin antibody was purchased from Sigma. KB-R7943, PD98059, U0126, and LY294002 were purchased from Tocris (Minneapolis, MN). MK-2206 and Y27632 were from Selleckchem (Houston, TX). W-13, KN-93, and ML-7 were from Cayman (Ann Harbor, MI). Cells were lysed in a buffer containing 20 mm Tris, pH 7.4, 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% Triton X-100, 2.5 mm sodium pyrophosphate, 1 mm β-glycerol phosphate, 1 mm sodium vanadate, 1 mm phenylmethylsulfonyl fluoride (PMSF), 5 mg/ml anti-papain, leupeptin, and pepstatin. For detection of NCX1 protein, cells were lysed in the lysis buffer supplemented with 2% sodium dodecyl sulfate (SDS). Based on protein estimation, 50 or 100 μg of cell lysates were resolved by SDS-PAGE and transferred onto nitrocellulose membrane. The immunoblots were blocked in 5% nonfat dried milk in Tris-buffered saline with 0.1% Tween 20 (TBST). Primary antibodies were diluted either in 5% bovine serum albumin (BSA) or nonfat dried milk in TBST and incubated overnight at 4 °C. Secondary antibodies were diluted in 5% nonfat dried milk in TBST. Immunoblots were developed with chemiluminescent lightning system ECL or ECL Prime (GE Healthcare) according to the manufacturer's recommendations. TINA 2.0 software (Open Source Image Analysis Environment) was utilized for immunoblot quantification and image analysis. Cell lysate corresponding to 1 mg of protein was precleared with Protein A Mag-agarose beads (GE Healthcare) and incubated overnight with control IgG, Na,K-β, or NCX1 antibodies pre-coupled to Mag beads for 4 h. The beads were washed and separated by SDS-PAGE, and the proteins bound to the beads were immunoblotted as described above. For resolution of Na,K-β protein (55 kDa) from heavy chain IgG band (50 kDa), immunoprecipitates were treated with peptide N-glycosidase F (New England Biolabs, Ipswitch, MA) as described previously (13Barwe S.P. Anilkumar G. Moon S.Y. Zheng Y. Whitelegge J.P. Rajasekaran S.A. Rajasekaran A.K. Novel role for Na,K-ATPase in phosphatidylinositol 3-kinase signaling and suppression of cell motility.Mol. Biol. Cell. 2005; 16: 1082-1094Crossref PubMed Scopus (134) Google Scholar). The deglycosylated Na,K-β (32 kDa) appears as a single band. Cell surface biotinylation was performed as described previously (16Barwe S.P. Kim S. Rajasekaran S.A. Bowie J.U. Rajasekaran A.K. Janus model of the Na,K-ATPase β-subunit transmembrane domain: distinct faces mediate α/β assembly and β-β homo-oligomerization.J. Mol. Biol. 2007; 365: 706-714Crossref PubMed Scopus (45) Google Scholar). The sub-confluent monolayer of cells was labeled with 0.5 μg/ml membrane-impermeable EZ-Link Sulfo-NHS-LC-Biotin, Pierce in TEA buffer (10 mm triethanolamine, pH 9, 150 mm NaCl, 0.1 mm CaCl2, 1 mm MgCl2) on ice and quenched with buffer containing 50 mm NH4Cl in phosphate-buffered saline (PBS) with 0.1 mm CaCl2, and 1 mm MgCl2 and lysed in 1000 μl of lysis buffer (150 mm NaCl, 20 mm Tris, pH 8, 5 mm EDTA, 1% Triton X-100, 0.1% BSA, 1 mm PMSF, 5 μg/ml antipain, leupeptin, and pepstatin). The lysate was incubated with 30 μl of Ultralink streptavidin beads (Pierce) overnight at 4 °C. The beads were washed with lysis buffer, and the bound proteins were separated on SDS-PAGE and immunoblotted for NCX1 and Na,K-β. RNA was extracted by TRIzol, and cDNA was generated by iScript™ cDNA Synthesis kit (Bio-Rad) as per the manufacturer's instructions. Quantitative PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems) in a 384-well plate on a 7900HT Fast Real-time PCR system (Applied Biosystems). The following primers were used: Na,K-β (forward, TTACCCTTACTACGGCAAGCTCCT; reverse, TTCAGTGTCCATGGTGAGGTTGGT); NCX1 (forward, TTAGCCGTTGTGGCTCTCTT; reverse, TGTAGACCATGGCCACAAAA); GAPDH (forward, GCTGTCCAACCACATCTCCTC; reverse, TGGGGCCGAAGATCCTGTT). RNA levels were calculated by relative quantification (RQ) normalized to the endogenous control GAPDH. Samples were assayed in triplicate. Cells (200,000) were grown on 60-mm dishes for 24 h in complete DMEM. Cells were incubated in methionine and cysteine-free DMEM containing 1% FBS 2 h before pulsing with 0.5 mCi/ml Tran35S-label (PerkinElmer Life Sciences) for 20 min. Cells were washed twice with PBS and lysed on ice in a lysis buffer. Lysates were incubated with protein A-agarose beads coated 1 μg/ml NCX1 antibody. Beads were washed and resolved by 10% SDS-PAGE and detected by fluorography using Typhoon Trio-phosphorimager (GE® Healthcare). Cells were cultured on glass coverslips and fixed with either ice-cold methanol (−20 °C) or 4% paraformaldehyde in PBS at room temperature. The coverslips were incubated overnight at 4 °C with primary antibodies diluted in 1% BSA in PBS with 100 μm calcium chloride and 1 mm magnesium chloride followed by Alexa-488™-, Alexa-546™-, or Alexa-633™-conjugated secondary antibodies and TO-PRO®-3-Iodide (Life Technologies) for nuclear staining. The coverslips were mounted on glass slides with ProLong gold antifade reagent (Life Technologies). The images were captured using Leica TCS SP5 Confocal Microscope (Leica Microsystems, Buffalo Grove, IL). Cells (200,000) were seeded in a 6-well tissue culture plate 24 h before a wound was made by scratching across the bottom of the well with a pipette tip. Wounded cell monolayers were washed three times with phosphate-buffered saline to remove the detached cells. Culture dishes were returned to the incubator for recovery of the wound in the presence or absence of the indicated inhibitors or reagents in serum-free media for 16 h. The scratches were photographed using an inverted microscope under the same configuration at the start and end of the experiment. The images were used to calculate the distance migrated by the cell sheet. The rate at which the wound was closed was calculated using the formula, speed = distance/time. ECIS Model 1600R, Applied BioPhysics (Troy, NY) was utilized. 1 × 105 cells in 200 μl of media were plated on ECIS electrode arrays (8W1E), each array containing 8 individual wells, with an active gold electrode in the base, and allowed to incubate overnight. Cell impedance and resistance levels were continuously measured. The resistance gained steadily and plateaued when cell confluence was attained. At this point, the electrodes were supplied an AC signal of 1 μA, between a small measuring electrode (250-μm diameter) and a large counter electrode, resulting in a sharp drop in resistance. As the cells re-grew and spread on the small electrode, the resistance increased proportionally to the distance migrated by the cells. The rate of migration was calculated as a ratio of the area covered (49,062.5 μm2) in a given period of time (number of hours taken for the resistance to reach the plateau). Cells (5 × 105) were plated in a 6-well dish for 48 h. On the day of the experiment cells were detached without the use of trypsin using 1× Hanks' buffer saline solution + 0.5 m EDTA at 37 °C for 10 min, centrifuged at 3000 rpm for 3 min, and resuspended in complete medium. 1 × 105 cells were resuspended in Tyrode's buffer without calcium containing 0.5 μm Fluo4-AM in pluronic acid (both from Life Technologies) and incubated at 37 °C for 20 min. Tyrode's buffer containing calcium was added to the cell suspension to make the final calcium concentration 0.5 mm before data acquisition using flow cytometer, BD Accuri C6 flow cytometer (BD Biosciences). The fluorescence intensity was continuously monitored for 8–10 min. 100 μm ouabain was added to the cells 2 min after start, and changes in intracellular calcium were calculated as described previously (20Khan A. Li D. Ibrahim S. Smyth E. Woulfe D.S. The physical association of the P2Y12 receptor with PAR4 regulates arrestin-mediated Akt activation.Mol. Pharmacol. 2014; 86: 1-11Crossref PubMed Scopus (41) Google Scholar). Cells (10,000) were plated on glass-bottom dishes (MatTek Corp., Ashland, MA) and cultured until confluent. Cell cultures were then incubated with fluorescent calcium indicator, FURA-2, AM (Life Technologies) at a concentration of 10 μm in a Pluronic acid/DMSO mixture in a 37 °C incubator for 30 min protected from light. The MatTek plates were washed twice with HBSS containing 140 mm NaCl, 5 mm KCl, 2 mm CaCl2, 10 mm glucose, 10 mm 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid, pH 7.4. Cells were allowed to recover after loading in Hanks' buffer saline solution for 10 min before imaging. A xenon lamp equipped with quartz collector lenses was used to excite the cells, and the cells were imaged with a Nikon inverted microscope (Intracellular Imaging, Cincinnati, OH). The fluorescence intensity was measured continuously for 5 min to obtain baseline calcium values. The ratio of the fluorescence intensity emitted at 510 nm after excitation at 340 nm over excitation at 380 nm was used to calculate -fold change in intracellular calcium concentrations as described previously (21Li W. Duncan R.L. Karin N.J. Farach-Carson M.C. 1,25(OH)2D3 enhances PTH-induced Ca2+ transients in preosteoblasts by activating L-type Ca2+ channels.Am. J. Physiol. 1997; 273: E599-E605PubMed Google Scholar). Alternatively, cells were incubated with 10 μm Fluo-4 AM in a Pluronic acid/DMSO mixture for 20 min at 37 °C. The plates were washed twice with Hanks' buffer saline solution with or without 2 mm CaCl2. After recovery for 15 min, the fluorescence intensity corresponding to cytosolic calcium was continuously measured by an LSM 710 confocal microscope system (Zeiss, Thornwood, NY). The amplitude of the response was calculated by subtracting basal fluorescence obtained during the initial 2 min from the maximum intensity of fluorescence after adding the 10 μm KB-R7943. Paired t test was used to evaluate the differences between average of two groups using data from at least three independent experiments, and a p of < 0.05 was considered statistically significant. MDCK cells with stable knockdown of Na,K-β using the RNA interference technique (β-KD) and with specific rescue of Na,K-β (β-KD/R), generated by introducing silent mutations within the shRNA recognition site in the Na,K-β cDNA, have been described previously (18Barwe S.P. Skay A. McSpadden R. Huynh T.P. Langhans S.A. Inge L.J. Rajasekaran A.K. Na,K-ATPase β-subunit cis homo-oligomerization is necessary for epithelial lumen formation in mammalian cells.J. Cell Sci. 2012; 125: 5711-5720Crossref PubMed Scopus (9) Google Scholar). Immunoblot analysis confirmed 80% reduction in Na,K-β protein level in β-KD cells. These cells also showed 42% reduction in NCX1 protein level compared with MDCK cells when normalized to β-actin used as a loading control (Fig. 1A). β-KD/R cells with renewed Na,K-β expression had restored NCX1 protein, highlighting the specificity of Na,K-β in the regulation of NCX1. The reduction in NCX1 protein in β-KD cells was consistent with the reduction of NCX1 in β-KO hearts as we reported previously (22Barwe S.P. Jordan M.C. Skay A. Inge L. Rajasekaran S.A. Wolle D. Johnson C.L. Neco P. Fang K. Rozengurt N. Goldhaber J.I. Roos K.P. Rajasekaran A.K. Dysfunction of ouabain-induced cardiac contractility in mice with heart-specific ablation of Na,K-ATPase β1-subunit.J. Mol. Cell. Cardiol. 2009; 47: 552-560Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). Changes in the protein levels of other Ca2+ transport proteins such as PMCA and SERCA were not observed in β-KO hearts (22Barwe S.P. Jordan M.C. Skay A. Inge L. Rajasekaran S.A. Wolle D. Johnson C.L. Neco P. Fang K. Rozengurt N. Goldhaber J.I. Roos K.P. Rajasekaran A.K. Dysfunction of ouabain-induced cardiac contractility in mice with heart-specific ablation of Na,K-ATPase β1-subunit.J. Mol. Cell. Cardiol. 2009; 47: 552-560Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). Similarly, PMCA and SERCA protein levels in β-KD cells were comparable to parental MDCK cells (Fig. 1B), indicating that Na,K-β specifically regulates NCX1 protein. To determine whether Na,K-β alters NCX1 transcription, the mRNA level of NCX1 in β-KD cells was quantified. Compared with MDCK, β-KD cells did not show a significant change in NCX1 mRNA (Fig. 1C), suggesting that Na,K-β-mediated NCX1 regulation is post-transcriptional. It has been reported previously that Na,K-β regulates the rate of protein synthesis of its binding partner Na,K-α (23Rajasekaran S.A. Gopal J. Willis D. Espineda C. Twiss J.L. Rajasekaran A.K. Na,K-ATPase β1-subunit increases the translation efficiency of the α1-subunit in MSV-MDCK cells.Mol. Biol. Cell. 2004; 15: 3224-3232Crossref PubMed Scopus (48) Google Scholar). Therefore, we tested NCX1 protein synthesis rate in β-KD cells by performing 35S metabolic labeling. The newly synthesized NCX1 protein detected by fluorography was comparable in MDCK, β-KD, and β-KD/R cells (Fig. 1D), indicating that Na,K-β does not alter the rate of synthesis of NCX1. Next, we determined the membrane localization of NCX1 using cell surface biotinylation assay. Na,K-β on the cell surface was reduced by 85% in β-KD cells. The NCX1 level on the cell membrane was drastically diminished (by 89%) (Fig. 2A), although the NCX1 total protein level was reduced only by 42% (Fig. 1A). NCX1 membrane expression was restored in β-KD/R cells, highlighting the specificity of Na,K-β in targeting NCX1 to the membrane. The cell surface level of occludin, a well known tight junction protein, remained the same and was used as a control for successful biotinylation and equal loading. Immunofluorescence analysis confirmed that NCX1 staining was diminished in β-KD cells. Moreover, whereas NCX1 was localized to the membrane in MDCK and β-KD/R cells, such localization was not prominent in β-KD cells (Fig. 2B). Immunofluorescence analysis also showed that Na,K-β and NCX1 co-localize on the cell surface in MDCK and β-KD/R cells. To test the possibility that Na,K-β interacts with NCX1, a co-immunoprecipitation analysis was performed. Na,K-β was captured by anti-NCX1 immunoprecipitation, and NCX1 was detected in Na,K-β antibody immunoprecipitates (Fig. 2C), indicating that Na,K-β associates with NCX1. NCX1 activity is required for ouabain-induced increase in intracellular calcium (24Blaustein M.P. Physiological effects of endogenous ouabain: control of intracellular Ca2+ stores and cell responsiveness.Am. J. Physiol. 1993; 264: C1367-C1387Crossref PubMed Google Scholar). Therefore, the effect of ouabain on intracellular calcium was tested to determine whether NCX1 function is altered in β-KD cells. Treatment of MDCK and β-KD/R cells with 100 μm ouabain elicited an immediate increase in intracellular calcium shown by the spike in fluorescence intensity above the threshold, i.e. the percentage of response to ouabain treatment above the baseline calcium level (Fig. 3A). However, the percentage of response to ouabain treatment was 50% lower in β-KD cells compared with MDCK cells, suggesting that β-KD cells have reduced NCX1 activity, consistent with reduced NCX1 protein. NCX1 is the major Ca2+ extrusion mechanism in kidney. To test whether reduced NCX1 affects calcium concentration in β-KD cells, the baseline intracellular free calcium levels were measured by Fura-2AM ratiometric imaging. The baseline intracellular calcium was 2.1-fold higher in β-KD cells compared with MDCK cells (Fig. 3B). The baseline calcium level in β-KD/R cells was similar to MDCK cells. Thus, the baseline intracellular calcium levels were inversely proportional to NCX1 protein levels. Because enhanced intracellular calcium can increase cell migration and Na,K-β is a motility suppressor (13Barwe S.P. Anilkumar G. Moon S.Y. Zheng Y. Whitelegge J.P. Rajasekaran S.A. Rajasekaran A.K. Novel role for Na,K-ATPase in phosphatidylinositol 3-kinase signaling and suppression of cell motility.Mol. Biol. Cell. 2005; 16: 1082-1094Crossref PubMed Scopus (134) Google Scholar, 15Rajasekaran S.A. Palmer L.G. Quan K. Harper J.F. Ball Jr., W.J. Bander N.H. Peralta Soler A. Ra" @default.
• W2006495215 created "2016-06-24" @default.
• W2006495215 creator A5013236796 @default.
• W2006495215 creator A5023306059 @default.
• W2006495215 creator A5035529353 @default.
• W2006495215 creator A5038744179 @default.
• W2006495215 creator A5088184269 @default.
• W2006495215 date "2015-05-01" @default.
• W2006495215 modified "2023-10-17" @default.
• W2006495215 title "Sodium-Calcium Exchanger 1 Regulates Epithelial Cell Migration via Calcium-dependent Extracellular Signal-regulated Kinase Signaling" @default.
• W2006495215 cites W1557224032 @default.
• W2006495215 cites W1568617917 @default.
• W2006495215 cites W1575582096 @default.
• W2006495215 cites W1579089374 @default.
• W2006495215 cites W177000286 @default.
• W2006495215 cites W1966714020 @default.
• W2006495215 cites W1985735643 @default.
• W2006495215 cites W1988819052 @default.
• W2006495215 cites W1998450939 @default.
• W2006495215 cites W2000097697 @default.
• W2006495215 cites W2004123711 @default.
• W2006495215 cites W2011828261 @default.
• W2006495215 cites W2012381843 @default.
• W2006495215 cites W2014808669 @default.
• W2006495215 cites W2018360823 @default.
• W2006495215 cites W2021269584 @default.
• W2006495215 cites W2021460711 @default.
• W2006495215 cites W2023755879 @default.
• W2006495215 cites W2027409743 @default.
• W2006495215 cites W2028044346 @default.
• W2006495215 cites W2028649508 @default.
• W2006495215 cites W2028685332 @default.
• W2006495215 cites W2030290443 @default.
• W2006495215 cites W2031193906 @default.
• W2006495215 cites W2031635095 @default.
• W2006495215 cites W2032781215 @default.
• W2006495215 cites W2037367454 @default.
• W2006495215 cites W2038765646 @default.
• W2006495215 cites W2038968531 @default.
• W2006495215 cites W2040196938 @default.
• W2006495215 cites W2049143026 @default.
• W2006495215 cites W2052647839 @default.
• W2006495215 cites W2054414022 @default.
• W2006495215 cites W2057315057 @default.
• W2006495215 cites W2063961981 @default.
• W2006495215 cites W2079595896 @default.
• W2006495215 cites W2082295460 @default.
• W2006495215 cites W2088485943 @default.
• W2006495215 cites W2091545354 @default.
• W2006495215 cites W2095906506 @default.
• W2006495215 cites W2097111828 @default.
• W2006495215 cites W2102200723 @default.
• W2006495215 cites W2102278085 @default.
• W2006495215 cites W2109523366 @default.
• W2006495215 cites W2111638415 @default.
• W2006495215 cites W2112487257 @default.
• W2006495215 cites W2115715486 @default.
• W2006495215 cites W2117554463 @default.
• W2006495215 cites W2123508838 @default.
• W2006495215 cites W2125155338 @default.
• W2006495215 cites W2132906612 @default.
• W2006495215 cites W2138790773 @default.
• W2006495215 cites W2138800560 @default.
• W2006495215 cites W2142083272 @default.
• W2006495215 cites W2145413187 @default.
• W2006495215 cites W2145822440 @default.
• W2006495215 cites W2159377192 @default.
• W2006495215 cites W2173877678 @default.
• W2006495215 cites W2335815721 @default.
• W2006495215 cites W2346310888 @default.
• W2006495215 cites W2410802513 @default.
• W2006495215 cites W4211241931 @default.
• W2006495215 cites W67399661 @default.
• W2006495215 doi "https://doi.org/10.1074/jbc.m114.629519" @default.
• W2006495215 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4432267" @default.
• W2006495215 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25770213" @default.
• W2006495215 hasPublicationYear "2015" @default.
• W2006495215 type Work @default.
• W2006495215 sameAs 2006495215 @default.
• W2006495215 citedByCount "18" @default.
• W2006495215 countsByYear W20064952152015 @default.
• W2006495215 countsByYear W20064952152016 @default.
• W2006495215 countsByYear W20064952152017 @default.
• W2006495215 countsByYear W20064952152019 @default.
• W2006495215 countsByYear W20064952152020 @default.
• W2006495215 countsByYear W20064952152021 @default.
• W2006495215 countsByYear W20064952152022 @default.
• W2006495215 countsByYear W20064952152023 @default.
• W2006495215 crossrefType "journal-article" @default.
• W2006495215 hasAuthorship W2006495215A5013236796 @default.
• W2006495215 hasAuthorship W2006495215A5023306059 @default.
• W2006495215 hasAuthorship W2006495215A5035529353 @default.
• W2006495215 hasAuthorship W2006495215A5038744179 @default.
• W2006495215 hasAuthorship W2006495215A5088184269 @default.
• W2006495215 hasBestOaLocation W20064952151 @default.
• W2006495215 hasConcept C155985219 @default.
• W2006495215 hasConcept C178790620 @default.
• W2006495215 hasConcept C184235292 @default.

• next