FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006621746> ?p ?o ?g. }

• W2006621746 endingPage "1537" @default.
• W2006621746 startingPage "1531" @default.
• W2006621746 abstract "Human porphobilinogen synthase (PBGS) is a main target in lead poisoning. Human PBGS purifies with eight Zn(II) per homo-octamer; four ZnA have predominantly nonsulfur ligands, and four ZnB have predominantly sulfur ligands. Only four Zn(II) are required for activity. To better elucidate the roles of Zn(II) and Pb(II), we produced human PBGS mutants that are designed to lack either the ZnA or ZnB sites. These proteins, MinusZnA (H131A, C223A) and MinusZnB (C122A, C124A, C132A), each become purified with four Zn(II) per octamer, thus confirming an asymmetry in the human PBGS structure. MinusZnA is fully active, whereas MinusZnB is far less active, verifying an important catalytic role for ZnB and the removed cysteine residues. Kinetic properties of the mutants and wild type proteins are described. Comparison of Pb(II) inhibition of the mutants shows that ligands to both ZnA and ZnB interact with Pb(II). The ZnB ligands preferentially interact with Pb(II). At least one ZnA ligand is responsible for the slow tight binding behavior of Pb(II). The data support a novel model where a high affinity lead site is a hybrid of the ZnA and ZnB sites. We propose that the lone electron pair of Pb(II) precludes Pb(II) to function in PBGS catalysis. Human porphobilinogen synthase (PBGS) is a main target in lead poisoning. Human PBGS purifies with eight Zn(II) per homo-octamer; four ZnA have predominantly nonsulfur ligands, and four ZnB have predominantly sulfur ligands. Only four Zn(II) are required for activity. To better elucidate the roles of Zn(II) and Pb(II), we produced human PBGS mutants that are designed to lack either the ZnA or ZnB sites. These proteins, MinusZnA (H131A, C223A) and MinusZnB (C122A, C124A, C132A), each become purified with four Zn(II) per octamer, thus confirming an asymmetry in the human PBGS structure. MinusZnA is fully active, whereas MinusZnB is far less active, verifying an important catalytic role for ZnB and the removed cysteine residues. Kinetic properties of the mutants and wild type proteins are described. Comparison of Pb(II) inhibition of the mutants shows that ligands to both ZnA and ZnB interact with Pb(II). The ZnB ligands preferentially interact with Pb(II). At least one ZnA ligand is responsible for the slow tight binding behavior of Pb(II). The data support a novel model where a high affinity lead site is a hybrid of the ZnA and ZnB sites. We propose that the lone electron pair of Pb(II) precludes Pb(II) to function in PBGS catalysis. porphobilinogen synthase 5-aminolevulinic acid 2-mercaptoethanol extended x-ray absorption fine structure matrix-assisted laser desorption ionization time-of-flight 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid Porphobilinogen synthase (PBGS,1 EC 4.2.1.24, also known as 5-aminolevulinic acid dehydratase), an enzyme that functions in the first common step in tetrapyrrole biosynthesis (e.g.heme and chlorophyll), is a highly conserved protein throughout evolution but has significant phylogenetic variation in the number and types of metal ions that function in catalysis or at allosteric sites (1Jaffe E.K. Acta Crystallogr. Sect. D Biol. Crystallogr. 2000; 56: 115-128Crossref PubMed Scopus (95) Google Scholar). The human PBGS protein and its metal binding properties are of particular interest, because human PBGS is a primary target for the environmental toxin lead (2Warren M.J. Cooper J.B. Wood S.P. Shoolingin-Jordan P.M. Trends Biochem. Sci. 1998; 23: 217-221Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). Past studies using yeast PBGS as a model for human lead poisoning are limited because of a phylogenetic difference in the metal binding stoichiometries of yeast and human PBGS (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 4Senior N.M. Brocklehurst K. Cooper J.B. Wood S.P. Erskine P. Shoolingin-Jordan P.M. Thomas P.G. Warren M.J. Biochem. J. 1996; 320: 401-412Crossref PubMed Scopus (55) Google Scholar). There are two codominant alleles, ALAD1 and ALAD2, which encode the human PBGS variants at position 59, K59 and N59, respectively. Recent data on the isolated K59 and N59 proteins do not support the epidemiological data that has correlated these alleles with a differential susceptibility to lead poisoning (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 5Wetmur J.G. Lehnert G. Desnick R.J. Environ. Res. 1991; 56: 109-119Crossref PubMed Scopus (140) Google Scholar). All PBGS proteins appear to be homo-octamers, and there is evidence for and against half-sites reactivity, including cases where any one type of metal is bound at four per octamer (e.g. Refs. 6Cheh A. Neilands J.B. Biochem. Biophys. Res. Commun. 1973; 55: 1060-1063Crossref PubMed Scopus (59) Google Scholar, 7Bevan D.R. Bodlaender P. Shemin D. J. Biol. Chem. 1980; 255: 2030-2035Abstract Full Text PDF PubMed Google Scholar, 8Dent A.J. Beyersmann D. Block C. Hasnain S.S. Biochemistry. 1990; 29: 7822-7828Crossref PubMed Scopus (77) Google Scholar, 9Petrovich R.M. Litwin S. Jaffe E.K. J. Biol. Chem. 1996; 271: 8692-8699Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 10Frankenberg N. Jahn D. Jaffe E.K. Biochemistry. 1999; 38: 13976-13982Crossref PubMed Scopus (25) Google Scholar). Mammalian PBGS enzymes purify with Zn(II) bound at a stoichiometry of eight per octamer (6Cheh A. Neilands J.B. Biochem. Biophys. Res. Commun. 1973; 55: 1060-1063Crossref PubMed Scopus (59) Google Scholar, 7Bevan D.R. Bodlaender P. Shemin D. J. Biol. Chem. 1980; 255: 2030-2035Abstract Full Text PDF PubMed Google Scholar, 11Jaffe E.K. Salowe S.P. Chen N.T. DeHaven P.A. J. Biol. Chem. 1984; 259: 5032-5036Abstract Full Text PDF PubMed Google Scholar). Only four Zn(II) appear to be tightly bound and only four Zn(II) appear to be required for full catalytic activity of human PBGS (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), consistent with data on bovine PBGS (6Cheh A. Neilands J.B. Biochem. Biophys. Res. Commun. 1973; 55: 1060-1063Crossref PubMed Scopus (59) Google Scholar, 7Bevan D.R. Bodlaender P. Shemin D. J. Biol. Chem. 1980; 255: 2030-2035Abstract Full Text PDF PubMed Google Scholar,11Jaffe E.K. Salowe S.P. Chen N.T. DeHaven P.A. J. Biol. Chem. 1984; 259: 5032-5036Abstract Full Text PDF PubMed Google Scholar, 12Jaffe E.K. Abrams W.R. Kaempfen H.X. Harris Jr., K.A. Biochemistry. 1992; 31: 2113-2123Crossref PubMed Scopus (46) Google Scholar). Preliminary data obtained on human PBGS show that Pb(II) can displace about half the enzyme-bound Zn(II) (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). There are two outstanding questions in the structure and mechanism of human PBGS: 1) Which of the two types of Zn(II) corresponds to the four Zn(II) that are essential for the activity of mammalian PBGS? and 2) What extent do the two Zn(II) sites play in the Pb(II) inhibition of enzyme activity? The crystal structure of yeast PBGS (Protein Data Bank code law5) revealed Zn(II) at two different sites with ligands that are consistent with prior chemical modification data (12Jaffe E.K. Abrams W.R. Kaempfen H.X. Harris Jr., K.A. Biochemistry. 1992; 31: 2113-2123Crossref PubMed Scopus (46) Google Scholar, 13Jaffe E.K. Volin M. Myers C.B. Abrams W.R. Biochemistry. 1994; 33: 11554-11562Crossref PubMed Scopus (28) Google Scholar). In the crystal structure, the two Zn(II) sites were not fully occupied (14Erskine P.T. Senior N. Awan S. Lambert R. Lewis G. Tickle I.J. Sarwar M. Spencer P. Thomas P. Warren M.J. Shoolingin-Jordan P.M. Wood S.P. Cooper J.B. Nat. Struct. Biol. 1997; 4: 1025-1031Crossref PubMed Scopus (133) Google Scholar). The most highly populated Zn(II) site shows the metal bound to a cluster of cysteine residues, which in the human protein correspond to Cys-122, Cys-124, and Cys-132. The Zn(II) that binds to this cysteine-rich site is defined as ZnB (8Dent A.J. Beyersmann D. Block C. Hasnain S.S. Biochemistry. 1990; 29: 7822-7828Crossref PubMed Scopus (77) Google Scholar). Although ZnB is 8 Å from an active site lysine, its coordination environment more closely resembles structural rather than catalytic Zn(II). A lesser-populated Zn(II) site of yeast PBGS was only seen in a difference map and shows Zn(II) with an incomplete coordination shell consisting of one histidine and one cysteine, which in the human protein correspond to His-131 and Cys-223. The Zn(II) that binds to this site is known as ZnA (8Dent A.J. Beyersmann D. Block C. Hasnain S.S. Biochemistry. 1990; 29: 7822-7828Crossref PubMed Scopus (77) Google Scholar). Although these ligands are typical of catalytic Zn(II), the low occupancy and 12-Å distance from a Schiff base-forming lysine indicate ZnA to be of questionable significance in the PBGS reaction mechanism (14Erskine P.T. Senior N. Awan S. Lambert R. Lewis G. Tickle I.J. Sarwar M. Spencer P. Thomas P. Warren M.J. Shoolingin-Jordan P.M. Wood S.P. Cooper J.B. Nat. Struct. Biol. 1997; 4: 1025-1031Crossref PubMed Scopus (133) Google Scholar). Because yeast PBGS can bind 16 Zn(II) per octamer (4Senior N.M. Brocklehurst K. Cooper J.B. Wood S.P. Erskine P. Shoolingin-Jordan P.M. Thomas P.G. Warren M.J. Biochem. J. 1996; 320: 401-412Crossref PubMed Scopus (55) Google Scholar), which is twice as much as human PBGS (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), a homology model for human PBGS must accommodate this difference in stoichiometry. Our current model contains ZnA and ZnB bound to each of four subunits, whereas the other four subunits contain no metal ions (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). A picture of the Zn(II) sites of the human PBGS model is presented in Fig.1, where adjacent amino acids are seen as ligands to ZnA (His-131) and ZnB (Cys-132). We propose that this is the basis for communication between the two metal sites. To test this model, the current work addresses the stoichiometry and function of ZnA and ZnB by use of mutagenesis to remove (or incapacitate) each of the two sites to create the mutants here called MinusZnA and MinusZnB. The former is designed to bind only four ZnB, and the latter is designed to bind only four ZnA. We present a kinetic characterization of MinusZnA in comparison to the wild type human PBGS proteins K59, N59, K59/C162A, and N59/C162A, the latter of which is the parent of MinusZnA and MinusZnB. The C162A mutation was introduced to avoid a non-native disulfide and is shown to be benign. Less comprehensive data are presented for the relatively inactive MinusZnB. This work shows that Pb(II) can interact with human PBGS in at least two different ways, consistent with the interpretation of the yeast PBGS crystal structure complexed with Pb(II). However, interaction of Pb(II) with a ZnA ligand could not have been predicted from the crystal structure. Most chemicals and buffers were obtained from Fisher Scientific or Sigma in the purest available form. 2-Mercaptoethanol (βME) was from Fluka and vacuum-distilled prior to use. High purity KOH was from Aldrich. Concentration devices, originally sold under the Amicon label, were obtained from Fisher as were Slide-A-Lyzer dialysis cassettes, originally sold under the Pierce label. Atomic absorption standards were SpecPure grade and obtained from Alfa AESAR. Human PBGS and mutants thereof were expressed and purified from an artificial gene as described previously (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). The mutations were achieved using the QuikChange technology of Stratagene. The sense strand primers were GCGTATGCTAAGGCAGGTGCACAGGTGGTAGCCCCTTCC (for C162A), CCTGTGACGTCGCCCTGGCTCCGTACACTTCTCACGGTCACGCCGGTCTCC (for C122A, C124A, C132A), CGTACACTTCTCACGGTGCCTGCGGTCTCCTGAGC (for H131A), and GGCGACCGCCGCGCCTATCAGCTGCC (for C223A). All resultant plasmids were sequenced throughout the artificial gene in both directions. For protein production, 6-liter growths of BLR(DE3)pMVhum (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar) (and mutants listed below) were started from single colonies of a fresh transformation at one colony per liter. The initial growth media was Luria Broth plus 0.4% glucose containing 12.5 μg ml−1tetracycline and 100 μg ml−1 ampicillin. After 16 h at 37 °C with shaking, the cells were harvested and resuspended in fresh broth without glucose to which tetracycline, ampicillin, and 20 μm Zn(II) had been added. Human PBGS induction was carried out at 15 °C with 100 μmisopropyl-1-thio-β-d-galactopyranoside and expression proceeded for an additional 45 h. The protein was purified from the soluble fraction of the lysed cells using a 25–45% ammonium sulfate fractionation, phenyl-Sepharose, DEAE-BioGel, and Sephacryl S300 columns as described previously (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). Care was taken to thoroughly regenerate all columns between preparations to prevent cross contamination of the proteins. Purifications of active and inactive human PBGS variants were carried out using two different batches of phenyl-Sepharose resin. Care was also taken to prevent contamination of the inactive proteins by chromosomally encoded Escherichia coli PBGS, the presence of which was determined by its ability to respond to Mg(II) as an allosteric activator (15Mitchell L.W. Jaffe E.K. Arch. Biochem. Biophys. 1993; 300: 169-177Crossref PubMed Scopus (52) Google Scholar, 16Jaffe E.K. Ali S. Mitchell L.W. Taylor K.M. Volin M. Markham G.D. Biochemistry. 1995; 34: 244-251Crossref PubMed Scopus (78) Google Scholar). The E. coli PBGS elutes from the DEAE column in the tail end of human PBGS peak (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). Protein was isolated in amounts varying from 150 to 400 mg for N59, N59/C162A, N59/C162A/H131A/C223A (hereafter called MinusZnA), and N59/C162A/C122A/C124A/C132A (hereafter called MinusZnB). The yield for K59 and K59/C162A was ∼50 mg of purified enzyme from 6 liters of growth. Purified proteins were concentrated to >5 mg/ml, aliquoted into portions, flash-frozen in liquid N2, and stored at −80 °C. Enzyme assays (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), Zn(II) analysis by atomic absorption spectroscopy, and Zn(II) binding by equilibrium dialysis (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 12Jaffe E.K. Abrams W.R. Kaempfen H.X. Harris Jr., K.A. Biochemistry. 1992; 31: 2113-2123Crossref PubMed Scopus (46) Google Scholar) were carried out according to procedures described previously. For MinusZnB activity, assays contained as much as 2 mg ml−1 protein and were allowed to proceed for between 2 and 40 h. All enzyme assays were carried out in metal-free plastic test tubes at 37 °C. Continuous assays monitoring the formation of porphobilinogen at 236 nm (17Huckel D. Beyersmann D. Anal. Biochem. 1979; 97: 277-281Crossref PubMed Scopus (5) Google Scholar) were carried out using a Cary 50 spectrometer fitted with an epoxy dip probe. Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectroscopy was performed on a PerSeptive Biosystems Voyager DE mass spectrometer in linear mode at an accelerating voltage of 20,000 V. To determine the stoichiometry of Zn(II) required for maximal activity, K59, N59, N59/C162A, and MinusZnA were dialyzed against 50 mm sodium acetate, pH 5.0, 10 mmβME overnight to prepare the Zn(II)-free apoenzyme (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). Following a brief (2 h) dialysis back into neutral pH buffer (0.1 mTES-KOH, 10 mm βME, pH 7.0), the proteins were analyzed for Zn(II) content by atomic absorption spectroscopy and assayed at 2 μm total subunit concentration in the presence of 0, 0.1, 0.2, 0.3, 0.4, and 0.5 μm Zn(II) added to the assay. For all data points, A555 values were ≥0.10 and thus of high confidence. The pH rate profiles were determined using buffers containing 0.1 m bis-tris propane-HCl (initial pH varied from 6 to 9), 10 mm βME, 10 μm Zn(II), and a fixed amount of recombinant human PBGS (K59 at 4.3 μg/ml, N59 at 10 μg/ml, N59/C162A at 15 μg/ml, K59/C162A at 15 μg/ml, MinusZnA at 15 μg/ml, and MinusZnB at 1.0 mg/ml). In all cases the enzyme-buffer mixture was preincubated for 10 min at 37 °C prior to the addition of ALA-HCl to a final concentration of 10 mm. The final pH was measured in mock assays at room temperature. The active proteins were assayed using a 5-min fixed time assay; MinusZnB was assayed for 5 h. For determination of Km and Vmaxvalues, the ALA-HCl concentrations were 10 μm, 30 μm, 100 μm, 300 μm, 1 mm, 3 mm, and 10 mm with stock dilutions made in 0.1 m HCl to keep the assay pH and ionic strength constant. All assays were terminated with a one-half volume of STOP reagent (20% trichloroacetic acid, 0.1 mHgCl2). Km and Vmax determinations for MinusZnB used 0.5 mg ml−1 and 18-h assays. Because the catalytic activity of MinusZnB was reduced by five orders of magnitude, Km and Vmax determinations were carried out in the presence and absence of Mg(II) to control for activity due to trace contamination by E. coli PBGS. Mg(II) causes a pH-dependent activation of the E. coli protein (16Jaffe E.K. Ali S. Mitchell L.W. Taylor K.M. Volin M. Markham G.D. Biochemistry. 1995; 34: 244-251Crossref PubMed Scopus (78) Google Scholar), but not the human protein. Porphobilinogen formed was determined by absorbance at 555 nm about 8 min after the addition of a one and one-half volume of modified Ehrlich's reagent. The extinction coefficient of the pink complex formed (ε555) was 62,000 cm−1m−1. Fixed-time lead inhibition assays included the holoenzymes as purified and were carried out with no added metals, with 20 μm Pb(II), and with both 10 μm Zn(II) and 20 μm Pb(II) added to the assay preincubation mixture. Because of the ability of phosphate to buffer metal ions, these assays were carried out in TES-KOH at an initial pH of 7.0. Free Pb(II) is <20 μm due to complexation by βME. After the addition of ALA to 10 mm, the active proteins were assayed for 5 min. For MinusZnB, 2 mg ml−1 of protein was used and the assays were monitored from 1 to 6 h, removing aliquots at 0.5-h intervals for porphobilinogen determination. Continuous assays of the active enzymes were allowed to proceed for 1 h with A236readings taken at 20 per minute. The rate of approach to equilibrium was calculated from ΔA236 between the actual reading and the steady-state rate extrapolated back to the point of substrate addition. The ΔA236 data were fitted to a simple exponential decay model and results are reported as t12 values. Previous work showed that human PBGS corresponding to the N59 allele partitioned into the soluble fraction of E. coli 3-fold better than K59 (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). The C162A mutation was prepared with the intention of removing an internal disulfide bond with Cys-119. This disulfide was apparent in a model of human PBGS based on the yeast PBGS crystal structure (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar) and is seen in preliminary crystallographic data on bovine and human PBGS. 2H. L. Carrell, unpublished results. The resulting protein, which is named N59/C162A, partitioned almost completely into the soluble fraction of the E. coli host cell and exhibited purification properties as described for Asn-59 (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). The mutant proteins MinusZnA and MinusZnB also expressed very well, partitioned into the soluble fraction of the host cell, and purified like the wild type proteins. K59/C162A was found to partition like K59 where the predominant fraction was in inclusion bodies (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). As before, all proteins were purified from the soluble fraction. The final purified pools from the S-300 column were analyzed for Zn(II) content by atomic absorption spectroscopy. Wild type variants N59, K59, N59/C162A, and K59/C162A contained ∼8 Zn per octamer, MinusZnA purified with 3.9 ± 0.6 Zn/octamer, and MinusZnB purified with 4.0 ± 0.5 Zn/octamer. DEAE fractions of MinusZnB that contained trace activity that can be activated by Mg(II) indicated E. coli PBGS contamination, and this MinusZnB was further purified by a second pass through the DEAE column, and once again, the activity activated by Mg(II) eluted solely in the tail end of the protein peak. Because high level heterologous expression in E. coli can lead to incomplete N-terminal processing, the purified protein was digested with trypsin and subjected to MALDI-TOF mass spectral analysis. No evidence was found for aberrant N-terminal processing. The N-terminal methionine was present with complete removal of the formyl group (data not shown). The N59/C162A and K59/C162A variants of PBGS as well as MinusZnA are all enzymatically active with specific activities comparable with N59 and K59 (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar) under standard assay conditions (0.1 m potassium phosphate, final pH 6.8, 10 μm Zn(II), 10 mm βME). The specific activities at pH 6.8 are constant from 1 to 30 μm Zn(II). To maintain consistency with our prior published work on mammalian PBGS, 10 μm Zn(II) was used for most kinetic studies. The specific activities of Asn-59, Lys-59, N59/C162A, K59/C162A, and Minus ZnA were determined at 10 mm ALA over the pH range of 6–9 using the buffer bis-tris propane. All showed broad roughly bell-shaped curves with an apparent pH optimum between 6.8 and 7.3, similar to bovine and other mammalian PBGS (18Gibson K.D. Neuberger A. Scott J.J. Biochem. J. 1955; 61: 618-629Crossref PubMed Scopus (218) Google Scholar, 19Despaux N. Comoy E. Bohuon C. Boudene C. Biochimie (Paris). 1979; 61: 1021-1028Crossref PubMed Scopus (12) Google Scholar, 20Schlosser M. Beyersmann D. Biol. Chem. Hoppe-Seyler. 1987; 368: 1469-1477Crossref PubMed Scopus (16) Google Scholar). The dependence of specific activity on pH was also determined for MinusZnB, which has a much reduced catalytic potency. In this case there was a nonlinear rise of specific activity with increasing pH from pH 6 to 9. The detailed analysis of MinusZnB is the subject of ongoing work. Km and Vmax values were determined for the human PBGS proteins at pH 6, 7, and 8 in bis-tris propane; the results are presented in TableI. As previously reported in terms of specific activities for wild type forms K59 and N59 (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), K59/C162A is 1.5- to 2-fold more active than N59/C162A. Table I shows that there are no significant phenomenological differences between K59, N59, K59/C162A, and N59/C162A. Thus, N59/C162A is an appropriate parent for our mutants. The general trends described below have been seen for other PBGS (21Mitchell L.W. Volin M. Jaffe E.K. J. Biol. Chem. 1995; 270: 24054-24059Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar). Table I illustrates that Vmaxvalues for any one protein in the pH range from 6 to 8 vary by factors of 2 to 5, whereas Km values show a more significant variation with pH. At pH 6, the reciprocal relationship between [ALA] and enzyme activity is linear from 10 μm to 10 mm and the Km values are fairly large, >1 mm. The high Km at below optimal pH may be related to a pH-dependent decrease in enzyme-bound Zn(II) (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), because Zn(II) has been shown to be essential for binding and reactivity of the ALA substrate that is not involved in Schiff base formation to Lys-252 (22Jaffe E.K. Hanes D. J. Biol. Chem. 1986; 261: 9348-9353Abstract Full Text PDF PubMed Google Scholar). At pH 7, the reciprocal relationships were again linear over three orders of magnitude variation in [ALA] and the Km values, which are all on the order of 0.1 mm, resembled those previously published for all PBGS at their optimum pH when their divalent metal ion requirements are met. However, above the optimal pH, at pH 8, the reciprocal relationships deviate from linearity and reveal what might be interpreted as a substrate activation phenomenon. Fig. 2 A, which shows the kinetic data at pH 6, 7, and 8 for N59, illustrates the magnitude of this phenomenon. The apparent Km at pH 8, considering only [ALA] below 300 μm, was in the range of 15–50 μm and is reported in Table I. However, above 300 μm ALA all the active human PBGS showed pronounced downward curvature at pH 8 (for N59, triangles in Fig.2A), and the apparent Km values were about twice that seen at pH 7. The human PBGS mutant MinusZnA shows a relatively unremarkable pH dependence for the Km and Vmax values with the exception of the 3- to 6-fold elevated Km for ALA at pH 6. This may indicate a role for ZnA, His-131, or Cys-223 in substrate binding. The comparable Vmax values of MinusZnA relative to wild type PBGS suggest that ZnA, His-131, and Cys-223 do not function in a rate-determining step of catalysis.Table IKinetic parameters for variants of human PBGS in 0.1 mbis-tris propane-HCl, 10 mm β-ME, 10 μmZn(II)pHK59N59K59/C162AN59/C162AN59/C162AMinusZnAMinusZnBK mV maxK mV maxK mV maxK mV maxK mV maxK mV max61.4431.2262.6322.6207.718NA1-aNA, not assayed.NA70.09440.18210.17360.17280.101920.41-bValues adjusted for trace contamination with E. coli PBGS as determined by a second set of assays done in the presence of 1 mm Mg(II) (raw data Km = 8.5 mm and Vmax= 0.004).0.00680.041-cSubstrate activation was observed at [ALA] > 300 μm.230.0141-cSubstrate activation was observed at [ALA] > 300 μm.50.041-cSubstrate activation was observed at [ALA] > 300 μm.250.051-cSubstrate activation was observed at [ALA] > 300 μm.140.039NANAKm values are in units of mm;Vmax values are in units of μmol h−1mg−1. Linear regression R values were uniformly 0.99.1-a NA, not assayed.1-b Values adjusted for trace contamination with E. coli PBGS as determined by a second set of assays done in the presence of 1 mm Mg(II) (raw data Km = 8.5 mm and Vmax= 0.004).1-c Substrate activation was observed at [ALA] > 300 μm. Open table in a new tab Km values are in units of mm;Vmax values are in units of μmol h−1mg−1. Linear regression R values were uniformly 0.99. Determination of kinetic constants for MinusZnB, which exhibits very low activity, required 0.5 mg ml−1 enzyme and assay times of ∼18 h. The observed a" @default.
• W2006621746 created "2016-06-24" @default.
• W2006621746 creator A5011036334 @default.
• W2006621746 creator A5052883326 @default.
• W2006621746 creator A5053977807 @default.
• W2006621746 creator A5055179810 @default.
• W2006621746 creator A5081576631 @default.
• W2006621746 date "2001-01-01" @default.
• W2006621746 modified "2023-09-27" @default.
• W2006621746 title "The Molecular Mechanism of Lead Inhibition of Human Porphobilinogen Synthase" @default.
• W2006621746 cites W1524100537 @default.
• W2006621746 cites W1587278423 @default.
• W2006621746 cites W1593421540 @default.
• W2006621746 cites W182540526 @default.
• W2006621746 cites W1970436809 @default.
• W2006621746 cites W1974616082 @default.
• W2006621746 cites W1975208766 @default.
• W2006621746 cites W1975514075 @default.
• W2006621746 cites W1983981760 @default.
• W2006621746 cites W1984193507 @default.
• W2006621746 cites W1991748250 @default.
• W2006621746 cites W1998198488 @default.
• W2006621746 cites W1999730856 @default.
• W2006621746 cites W2000129995 @default.
• W2006621746 cites W2002041987 @default.
• W2006621746 cites W2018811892 @default.
• W2006621746 cites W2021116136 @default.
• W2006621746 cites W2028231353 @default.
• W2006621746 cites W2032628299 @default.
• W2006621746 cites W2038216298 @default.
• W2006621746 cites W2048139771 @default.
• W2006621746 cites W2052696170 @default.
• W2006621746 cites W2054627528 @default.
• W2006621746 cites W2056567154 @default.
• W2006621746 cites W2062124141 @default.
• W2006621746 cites W2068224930 @default.
• W2006621746 cites W2078248419 @default.
• W2006621746 cites W2080136729 @default.
• W2006621746 cites W2083786664 @default.
• W2006621746 cites W2086863310 @default.
• W2006621746 cites W2115526102 @default.
• W2006621746 cites W2149391857 @default.
• W2006621746 cites W2152326664 @default.
• W2006621746 cites W2155806500 @default.
• W2006621746 cites W2230504093 @default.
• W2006621746 cites W2312900235 @default.
• W2006621746 doi "https://doi.org/10.1074/jbc.m007663200" @default.
• W2006621746 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11032836" @default.
• W2006621746 hasPublicationYear "2001" @default.
• W2006621746 type Work @default.
• W2006621746 sameAs 2006621746 @default.
• W2006621746 citedByCount "98" @default.
• W2006621746 countsByYear W20066217462012 @default.
• W2006621746 countsByYear W20066217462013 @default.
• W2006621746 countsByYear W20066217462014 @default.
• W2006621746 countsByYear W20066217462015 @default.
• W2006621746 countsByYear W20066217462016 @default.
• W2006621746 countsByYear W20066217462017 @default.
• W2006621746 countsByYear W20066217462018 @default.
• W2006621746 countsByYear W20066217462019 @default.
• W2006621746 countsByYear W20066217462020 @default.
• W2006621746 countsByYear W20066217462021 @default.
• W2006621746 countsByYear W20066217462022 @default.
• W2006621746 countsByYear W20066217462023 @default.
• W2006621746 crossrefType "journal-article" @default.
• W2006621746 hasAuthorship W2006621746A5011036334 @default.
• W2006621746 hasAuthorship W2006621746A5052883326 @default.
• W2006621746 hasAuthorship W2006621746A5053977807 @default.
• W2006621746 hasAuthorship W2006621746A5055179810 @default.
• W2006621746 hasAuthorship W2006621746A5081576631 @default.
• W2006621746 hasBestOaLocation W20066217461 @default.
• W2006621746 hasConcept C111472728 @default.
• W2006621746 hasConcept C112243037 @default.
• W2006621746 hasConcept C138885662 @default.
• W2006621746 hasConcept C181199279 @default.
• W2006621746 hasConcept C185592680 @default.
• W2006621746 hasConcept C2776217839 @default.
• W2006621746 hasConcept C2776682811 @default.
• W2006621746 hasConcept C2778503633 @default.
• W2006621746 hasConcept C2781374117 @default.
• W2006621746 hasConcept C44538786 @default.
• W2006621746 hasConcept C55493867 @default.
• W2006621746 hasConcept C89611455 @default.
• W2006621746 hasConceptScore W2006621746C111472728 @default.
• W2006621746 hasConceptScore W2006621746C112243037 @default.
• W2006621746 hasConceptScore W2006621746C138885662 @default.
• W2006621746 hasConceptScore W2006621746C181199279 @default.
• W2006621746 hasConceptScore W2006621746C185592680 @default.
• W2006621746 hasConceptScore W2006621746C2776217839 @default.
• W2006621746 hasConceptScore W2006621746C2776682811 @default.
• W2006621746 hasConceptScore W2006621746C2778503633 @default.
• W2006621746 hasConceptScore W2006621746C2781374117 @default.
• W2006621746 hasConceptScore W2006621746C44538786 @default.
• W2006621746 hasConceptScore W2006621746C55493867 @default.
• W2006621746 hasConceptScore W2006621746C89611455 @default.
• W2006621746 hasIssue "2" @default.
• W2006621746 hasLocation W20066217461 @default.
• W2006621746 hasOpenAccess W2006621746 @default.

• next