FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2006662979> ?p ?o ?g. }

• W2006662979 endingPage "2429" @default.
• W2006662979 startingPage "2421" @default.
• W2006662979 abstract "The etiologic agent of Lyme disease, Borrelia burgdorferi, is capable of circumventing the immune defense of a variety of potential vertebrate hosts. Previous work has shown that interaction of host-derived complement regulators, factor H and factor H-like protein 1 (FHL-1), with up to five complement regulator-acquiring surface proteins (CRASPs) expressed by resistant B. burgdorferi sensu lato isolates conferred complement resistance. In addition expression of CRASP-1 is directly correlated with complement resistance of Borrelia species. This work describes the functional characterization of BbCRASP-1 as the dominant factor H and FHL-1-binding protein of B. burgdorferi. The corresponding gene, zs7.a68, is located on the linear plasmid lp54 and is different from factor H-binding Erp proteins that are encoded by genes localized on circular plasmids (cp32). Deletion mutants of BbCRASP-1 were generated, and a high affinity binding site for factor H and FHL-1 was mapped to the C terminus of BbCRASP-1. Similarly, the predominant binding site of factor H and FHL-1 was localized to the short consensus repeat 7. Factor H and FHL-1 maintain their cofactor activity for factor I-mediated C3b inactivation when bound to BbCRASP-1, and factor H is up to 6-fold more efficient in mediating C3b conversion than FHL-1. In conclusion, BbCRASP-1 (i) binds the host complement regulators factor H and FHL-1 with high affinity, (ii) is the key molecule of the complement resistance of spirochetes, and (iii) is distinct from the Erp protein family. Thus, BbCRASP-1 most likely contributes to persistence of B. burgdorferi and to pathogenesis of Lyme disease. The etiologic agent of Lyme disease, Borrelia burgdorferi, is capable of circumventing the immune defense of a variety of potential vertebrate hosts. Previous work has shown that interaction of host-derived complement regulators, factor H and factor H-like protein 1 (FHL-1), with up to five complement regulator-acquiring surface proteins (CRASPs) expressed by resistant B. burgdorferi sensu lato isolates conferred complement resistance. In addition expression of CRASP-1 is directly correlated with complement resistance of Borrelia species. This work describes the functional characterization of BbCRASP-1 as the dominant factor H and FHL-1-binding protein of B. burgdorferi. The corresponding gene, zs7.a68, is located on the linear plasmid lp54 and is different from factor H-binding Erp proteins that are encoded by genes localized on circular plasmids (cp32). Deletion mutants of BbCRASP-1 were generated, and a high affinity binding site for factor H and FHL-1 was mapped to the C terminus of BbCRASP-1. Similarly, the predominant binding site of factor H and FHL-1 was localized to the short consensus repeat 7. Factor H and FHL-1 maintain their cofactor activity for factor I-mediated C3b inactivation when bound to BbCRASP-1, and factor H is up to 6-fold more efficient in mediating C3b conversion than FHL-1. In conclusion, BbCRASP-1 (i) binds the host complement regulators factor H and FHL-1 with high affinity, (ii) is the key molecule of the complement resistance of spirochetes, and (iii) is distinct from the Erp protein family. Thus, BbCRASP-1 most likely contributes to persistence of B. burgdorferi and to pathogenesis of Lyme disease. Lyme borreliosis is a complex multisystemic disorder caused by pathogenic species of the Borrelia burgdorferi sensu lato complex and is regarded as the most frequent vector-borne infectious disease in North America and Europe (1.Steere A.C. N. Engl. J. Med. 1989; 321: 586-596Crossref PubMed Scopus (1362) Google Scholar). Because of the complex enzootic cycle of B. burgdorferi in nature including diverse environments such as arthropod vectors and a variety of vertebrate hosts, spirochetes have developed strategies to survive in both vector and reservoir hosts. These include their ability (i) to evade an immune defense by differential expression of polymorphic outer surface proteins (2.Zhang J.R. Hardham J.M. Barbour A.G. Norris S.J. Cell. 1997; 89: 275-285Abstract Full Text Full Text PDF PubMed Scopus (526) Google Scholar), (ii) to sequester into immune privileged sites (3.Ma Y. Sturrock A. Weis J.J. Infect. Immun. 1991; 59: 671-678Crossref PubMed Google Scholar, 4.Montgomery R.R. Nathanson M.H. Malawista S.E. J. Immunol. 1993; 150: 909-1015PubMed Google Scholar), and (iii) to adapt to new environmental stimuli (5.Liang F.T. Jacobs M.B. Bowers L.C. Philipp M.T. J. Exp. Med. 2002; 195: 415-422Crossref PubMed Scopus (152) Google Scholar). One particular strategy of spirochetes involves their resistance to complement-mediated killing in the mammalian host (6.Brade V. Kleber I. Acker G. Immunobiology. 1992; 185: 453-465Crossref PubMed Scopus (53) Google Scholar, 7.Breitner-Ruddock S. Würzner R. Schulze J. Brade V. Med. Microbiol. Immunol. 1997; 185: 253-260Crossref PubMed Scopus (91) Google Scholar, 8.Van Dam A.P. Oei A. Jaspars R. Fijen C. Wilske B. Spanjaard L. Dankert J. Infect. Immun. 1997; 65: 1228-1236Crossref PubMed Google Scholar, 9.Kurtenbach K. De Michaelis S. Etti S. Schäfer S.M. Sewell H.-S. Brade V. Kraiczy P. Trends Microbiol. 2002; 10: 74-79Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar). The complement system forms an important part of the innate immunity and plays a crucial role in the elimination of invading microorganisms. Direct activation of complement via the alternative or the mannose-binding lectin pathway results in opsonization and formation of the lytic membrane attack complex leading to killing of the invading microorganisms (10.Walport M.J. N. Engl. J. Med. 2001; 344: 1058-1066Crossref PubMed Scopus (2427) Google Scholar). An increasing number of microorganisms pathogenic to humans, including B. burgdorferi (11.Alitalo A. Meri T. Ramo L. Jokiranta T.S. Heikkila T. Sepälä I.J.T. Oksi J. Vijanen M. Meri S. Infect. Immun. 2001; 69: 3685-3691Crossref PubMed Scopus (141) Google Scholar, 12.Hellwage J. Meri T. Heikkila A. Panelius J. Lahdenne P. Seppälä I. Meri S. J. Biol. Chem. 2001; 276: 8427-8435Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar, 13.Kraiczy P. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Eur. J. Immunol. 2001; 31: 1674-1684Crossref PubMed Scopus (217) Google Scholar), Neisseria gonorrhoeae (14.Ram S. Sharma A.K. Simpson S.C. Gulati D.S. McQuillen D. Pangburn M.K. Rice P.A. J. Exp. Med. 1998; 187: 743-752Crossref PubMed Scopus (324) Google Scholar), Neisseria meningitidis (15.Ram S. Mackinnon F.G. Gulati S. McQuillen D.P. Vogel U. Frosch M. Elkins C. Guttormsen H.K. Wetzler L.M. Oppermann M. Pangburn M.K. Rice P.A. Mol. Immunol. 1999; 36: 915-928Crossref PubMed Scopus (131) Google Scholar), Streptococcus pyogenes (16.Horstmann R.D. Sievertsen H.J. Knobloch J. Fischetti V.A. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 1657-1661Crossref PubMed Scopus (348) Google Scholar, 17.Johnsson E. Berggard K. Kotarsky H. Hellwage J. Zipfel P.F. Sjobring U. Lindahl G. J. Immunol. 1998; 161: 4894-4901PubMed Google Scholar, 18.Kotarsky H. Hellwage J. Johnsson E. Skerka C. Svensson H.G. Lindahl G. Sjobring U. Zipfel P.F. J. Immunol. 1998; 160: 3349-3354PubMed Google Scholar, 19.Pérez-Caballero D. Alberti S. Vivanco F. Sánchez-Corral P. Rodríguez de Córdoba S. Eur. J. Immunol. 2000; 30: 1243-1253Crossref PubMed Scopus (55) Google Scholar), and Streptococcus pneumoniae (20.Neeleman C. Geelen S.P. Aerts P.C. Daha M.R. Mollnes T.E. Roord J.J. Posthuma G. van Dijk H. Fleer A. Infect. Immun. 1999; 67: 4517-4524Crossref PubMed Google Scholar), resist complement-mediated killing by coating their surfaces with host-derived fluid phase negative complement regulators of the alternative pathway, factor H, and/or factor H-like protein 1 (FHL-1). 1The abbreviations used are: FHL-1, factor H-like protein 1; CRASPs, complement regulator-acquiring surface proteins; SCRs, short consensus repeats; GST, glutathione S-transferase; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay; NHS, Non-immune human serum; mAb, monoclonal antibody; BbCRASPs, complement-resistant B. burgdorferi; BaCRASPs, complement-resistant B. afzelii; aa, amino acids. Factor H and FHL-1 belong to a protein family that is structurally composed of individually folded protein domains, termed short consensus repeats (SCRs), or complement control protein modules (21.Zipfel P.F. Skerka C. Immunol. Today. 1994; 15: 121-126Abstract Full Text PDF PubMed Scopus (133) Google Scholar, 22.Zipfel P.F. Skerka C. Hellwage J. Jokiranta S.T. Meri S. Brade V. Kraiczy P. Noris M. Remuzzi G. Biochem. Soc. Trans. 2002; 30: 971-978Crossref PubMed Scopus (215) Google Scholar). Factor H consists of 20 SCR domains; and FHL-1, an alternatively spliced variant of the factor H gene, represents the first seven SCRs of factor H and includes an extension of four hydrophobic amino acids (SFTL) at its C terminus. Both plasma proteins control the alternative pathway of complement activation at the level of C3b by competing with factor B for binding to C3b. These regulators accelerate the decay of the C3 convertase, C3bBb (decay-accelerating activity), and act as cofactors for factor I-mediated degradation of C3b (23.Pangburn M. Schreiber R.D. Müller-Eberhard H.J. J. Exp. Med. 1977; 146: 257-270Crossref PubMed Scopus (526) Google Scholar, 24.Kühn S. Skerka C. Zipfel P.F. J. Immunol. 1995; 155: 5663-5670PubMed Google Scholar, 25.Whaley K. Ruddy S. J. Exp. Med. 1976; 144: 1147-1163Crossref PubMed Scopus (427) Google Scholar, 26.Zipfel P.F. Skerka C. Immunol. Today. 1999; 20: 135-140Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Several pathogenic microorganisms express surface proteins capable of interacting with factor H and FHL-1, such as the M- and the Fba protein of S. pyogenes (16.Horstmann R.D. Sievertsen H.J. Knobloch J. Fischetti V.A. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 1657-1661Crossref PubMed Scopus (348) Google Scholar, 27.Fischetti V.A. Horstmann R.D. Pancholi V. Infect. Immun. 1995; 63: 149-153Crossref PubMed Google Scholar, 28.Pandiripally V. Gregory E. Cue D. Infect. Immun. 2002; 70: 6206-6214Crossref PubMed Scopus (81) Google Scholar), PspC, Hic proteins of pneumococci (20.Neeleman C. Geelen S.P. Aerts P.C. Daha M.R. Mollnes T.E. Roord J.J. Posthuma G. van Dijk H. Fleer A. Infect. Immun. 1999; 67: 4517-4524Crossref PubMed Google Scholar, 29.Dave S. Brooks-Walter A. Pangburn M. McDaniel L.S. Infect. Immun. 2001; 69: 3435-3437Crossref PubMed Scopus (167) Google Scholar, 30.Janulczyk R. Iannelli F. Sjöholm A.G. Pozzi G. Björck L. J. Biol. Chem. 2000; 47: 37257-37263Abstract Full Text Full Text PDF Scopus (181) Google Scholar, 31.Jarva H. Janulzyk R. Hellwage J. Zipfel P.F. Björck L. Meri S. J. Immunol. 2002; 168: 1886-1894Crossref PubMed Scopus (159) Google Scholar), Por1A protein of nonsialylated N. gonorrhoeae (32.Ram S. McQuillen D.P. Gulati S. Elkins C. Pangburn M.K. Rice P.A. J. Exp. Med. 1989; 188: 671-680Crossref Scopus (227) Google Scholar), and envelope proteins gp41 and gp120 of the human immunodeficiency virus (33.Stoiber H. Ebenbichler C. Schneider R. Janatova J. Dierich M.P. AIDS. 1995; 9: 19-26Crossref PubMed Scopus (65) Google Scholar). Our previous studies indicated that moderate or fully complement-resistant B. burgdorferi and Borrelia afzelii strains, but not complement-sensitive Borrelia garinii strains, express up to five factor H- and FHL-1-binding surface molecules termed complement regulator-acquiring surface proteins (CRASPs) (13.Kraiczy P. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Eur. J. Immunol. 2001; 31: 1674-1684Crossref PubMed Scopus (217) Google Scholar, 34.Kraiczy P. Skerka C. Brade V. Zipfel P.F. Infect. Immun. 2001; 69: 7800-7809Crossref PubMed Scopus (190) Google Scholar, 35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar). According to their ability to differentially bind factor H and FHL-1, CRASPs of complement-resistant B. burgdorferi (BbCRASPs) and B. afzelii (BaCRASPs) strains are divided into three groups: factor H- and FHL-1-binding proteins (BbCRASP-1, BaCRASP-1, BbCRASP-2, and BaCRASP-2), FHL-1-binding proteins (BaCRASP-3), and factor H-binding proteins (BbCRASP-3–5, BaCRASP-4, and BaCRASP-5) (34.Kraiczy P. Skerka C. Brade V. Zipfel P.F. Infect. Immun. 2001; 69: 7800-7809Crossref PubMed Scopus (190) Google Scholar, 36.Kraiczy P. Skerka C. Zipfel P.F. Brade V. Wien. Klin. Wochenschr. 2002; 114: 568-573PubMed Google Scholar). More recently, BbCRASP-3 has been characterized on a molecular level and identified as a novel member of the polymorphic Erp (OspE/F-related proteins) family (35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar). BbCRASP-3 and multiple homologous Erp proteins expressed by virulent B. burgdorferi strains were shown to bind factor H (12.Hellwage J. Meri T. Heikkila A. Panelius J. Lahdenne P. Seppälä I. Meri S. J. Biol. Chem. 2001; 276: 8427-8435Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar, 37.Alitalo A. Meri T. Lankinen H. Seppälä I. Lahdenne P. Hefty P.S. Akins D. Meri S. J. Immunol. 2002; 169: 3847-3853Crossref PubMed Scopus (139) Google Scholar, 38.McDowell J.V. Wolfgang J. Tran E. Metts M.S. Hamilton D. Marconi R.T. Infect. Immun. 2003; 71: 3597-3602Crossref PubMed Scopus (106) Google Scholar, 39.Metts M.S. McDowell J.V. Theisen M. Hansen P.R. Marconi R.T. Infect. Immun. 2003; 71: 3587-3596Crossref PubMed Scopus (100) Google Scholar, 40.Stevenson B. El-Hage N. Hines M.A. Miller J.C. Babb K. Infect. Immun. 2002; 70: 491-497Crossref PubMed Scopus (185) Google Scholar). In addition, we found that CRASPs comprise at least two different groups of outer surface proteins, one of which is represented by the Erp protein family (35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar). 2P. Kraiczy, unpublished data. The purpose of the present study was to identify and characterize BbCRASP-1, a novel outer surface protein of B. burgdorferi that is different from the Erp protein family and represents the predominant factor H- and FHL-1-binding protein. Bacterial Strains, Culture, and Materials—Intermediate complement-resistant B. burgdorferi strain ZS7 (tick isolate, Germany), infectious and pathogenic in mice, was grown at 33 °C for 5–6 days up to a cell density of 1 × 107/ml in modified Barbour-Stoenner-Kelly (BSK) medium as described previously (35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar). Cells were harvested by centrifugation at 5000 rpm for 30 min and resuspended in sterile phosphate-buffered saline (PBS) (140 mm NaCl, 2.7 mm KCl, 10 mm Na2HPO4, 1.8 mm KH2PO4, pH 7.3) containing 5 mm MgCl2 (PBS-Mg). The density of spirochetes was determined using dark-field microscopy and a Kova counting chamber (Hycor Biomedical, Garden Grove, CA). Escherichia coli MC1061, JM109, and DH5α were grown at 37 °C in LB or 2× YT medium. Preparation and Screening of a B. burgdorferi Expression Library—A B. burgdorferi ZS7 genomic DNA expression library was prepared and screened using recombinantly expressed FHL-1 and factor H deletion constructs as described previously (35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar, 41.Wallich R. Jahraus O. Stehle T. Tran T.T.T. Brenner C. Hofmann H. Gern L. Simon M.M. Eur. J. Immunol. 2003; 33: 708-719Crossref PubMed Scopus (24) Google Scholar). Briefly, bacterial colonies were plated onto LB agar plates and transferred to nitrocellulose filters. Membranes were incubated with supernatant of Sf9 cells infected with FHL-1 or various recombinant deletion constructs of factor H (FH15–20, FH8–20, and FH19–20) for 12 h at 4 °C. After three washings with TBS containing 0.2% Tween 20, filters were incubated with antisera to SCR1–4 (24.Kühn S. Skerka C. Zipfel P.F. J. Immunol. 1995; 155: 5663-5670PubMed Google Scholar) and to SCR20 (VIG8) (42.Prodinger W. Hellwage J. Spruth M. Dierich M.P. Zipfel P.F. Biochem. J. 1998; 31: 41-47Crossref Scopus (85) Google Scholar), specific for factor H/FHL-1 and factor H, respectively, in the presence of 1% MC1061 cell lysate, followed by incubation with the appropriate peroxidase-conjugated secondary antibody. Construction of Expression Plasmids and Purification of Recombinant Borrelial Proteins—The bbCRASP-1 gene was subcloned by PCR using plasmid pUEX15, and the amplified DNA fragment, previously named zs7.a68, was ligated in-frame into vector pGEX-2T which includes the glutathione S-transferase gene at the N terminus of the expressed recombinant fusion protein (41.Wallich R. Jahraus O. Stehle T. Tran T.T.T. Brenner C. Hofmann H. Gern L. Simon M.M. Eur. J. Immunol. 2003; 33: 708-719Crossref PubMed Scopus (24) Google Scholar). Expression of the GST-BbCRASP-1 fusion protein in E. coli JM109, affinity purification on glutathione-Sepharose column, and endoproteinase thrombin cleavage of the glutathione S-transferase (GST) fusion protein was performed as recommended by the manufacturer (Amersham Biosciences). C-terminal deletion mutants of BbCRASP-1 were constructed by PCR using the pGEX sequencing primer in combination with oligonucleotides BbCRASP-1/313(–), BbCRASP-1/490(–), BbCRASP-1/637(–), BbCRASP-1/709(–), or BbCRASP-1/709b(–), respectively. Oligonucleotides used for PCR as listed in Table I were purchased from Sigma or Roth (Mannheim, Germany). The amplified DNA fragments were digested with BamHI and ligated in-frame with the glutathione S-transferase gene into the pGEX-2T vector (Amersham Biosciences) resulting in plasmids pGEX ZSA68/313, pGEX ZSA68/490, pGEX ZSA68/637, pGEX ZSA68/709, and pGEX ZSA68/730. Expression of the GST fusion proteins in E. coli DH5α and affinity purification were performed according to the instructions of the manufacturer (Amersham Biosciences). Expression and purity of all GST fusion proteins were confirmed by employing Tris/Tricine-SDS-PAGE (34.Kraiczy P. Skerka C. Brade V. Zipfel P.F. Infect. Immun. 2001; 69: 7800-7809Crossref PubMed Scopus (190) Google Scholar, 35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar), and protein concentrations were determined by a Bradford assay (Bio-Rad).Table IOligonucleotides used in the course of this studyOligonucleotidesSequence (5′ to 3′)aRestriction enzyme sites for BamHI and EcoRI in the primer sequences are indicated by italics, and inserted stop codon sequences are underlined.Use in this workZS7.A68BamHIACCGGATCCGCACCTTTTAGCSubcloning of bbCRASP-1ZS7.A68EcoRIATGAATTCTTAGTAAAAGGCAGGSubcloning of bbCRASP-1BbCRASP-1/313(-)CTTCATCAATAAGATCGTAGGATCCAACTTAAAAAGTGCTTAGConstruction of deletion mutants of BbCRASP-1-(26-108), intended target site 313-355 of the bbCRASP-1 geneBbCRASP-1/490(-)CTAAATTTTGCTCTATTTGGAATTGGATCCCCCATTATATGTGATAConstruction of deletion mutants of BbCRASP-1-(26-166), intended target site 490-535 of the bbCRASP-1 geneBbCRASP-1/637(-)TATCTTGAGTATTTTGATTGGATCCTTTAAGAGTTTAGTTTAAGGTConstruction of deletion mutants of BbCRASP-1-(26-215), intended target site 637-682 of the bbCRASP-1 geneBbCRASP-1/709(-)GTAAAAGGCAGGTTTTAAAGGATCCAAATCTTAGTAATATTTATTConstruction of deletion mutants of BbCRASP-1-(26-240), intended target site 709-753 of the bbCRASP-1 geneBbCRASP-1/709b(-)GTAAAAGGCAGGTTTTAAAGGATCCAAATCTTTGTAATATTTATTConstruction of deletion mutants of BbCRASP-1-(26-244), intended target site 709-753 of the bbCRASP-1 genea Restriction enzyme sites for BamHI and EcoRI in the primer sequences are indicated by italics, and inserted stop codon sequences are underlined. Open table in a new tab Expression of Recombinant Proteins of Factor H and FHL-1—FHL-1 and deletions constructs of factor H (FH1–2, FH1–3, FH1–4, FH1–5, FH1–6, FH8–20, FH15–20, and FH19–20) were expressed in Sf9 insect cells infected with recombinant baculovirus. The cloning of various deletion constructs, expression, and purification have been described previously (24.Kühn S. Skerka C. Zipfel P.F. J. Immunol. 1995; 155: 5663-5670PubMed Google Scholar, 43.Kühn S. Zipfel P.F. Gene (Amst.). 1995; 162: 225-229Crossref PubMed Scopus (103) Google Scholar, 44.Hellwage J. Jokiranta T.S. Friese M.A. Wolk T.U. Kampen E. Zipfel P.F. Meri S. J. Immunol. 2002; 169: 6935-6944Crossref PubMed Scopus (101) Google Scholar). DNA Sequence Analysis—B. burgdorferi genomic DNA fragments cloned in pUEX1 or pGEX-2T plasmid derivatives were sequenced by using the BigDye Terminator Cycle sequencing kit (PE Applied Biosystems, Foster City, CA) in accordance with the manufacturers' recommendations. SDS-PAGE, Western Ligand Affinity Blots, and Western Blot—Cell lysates or purified recombinant proteins were subjected to Tris/Tricine-SDS-PAGE (reducing conditions), transferred to nitrocellulose, and probed with the corresponding antisera as described previously (34.Kraiczy P. Skerka C. Brade V. Zipfel P.F. Infect. Immun. 2001; 69: 7800-7809Crossref PubMed Scopus (190) Google Scholar, 35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar). Surface Plasmon Resonance Assays—Protein-protein interactions were analyzed by surface plasmon resonance technique using a Biacore 3000 instrument (Biacore AB, Uppsala, Sweden) as described earlier (35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar, 44.Hellwage J. Jokiranta T.S. Friese M.A. Wolk T.U. Kampen E. Zipfel P.F. Meri S. J. Immunol. 2002; 169: 6935-6944Crossref PubMed Scopus (101) Google Scholar). Briefly, borrelial recombinant proteins BbCRASP-1 or C-terminal deletion mutants (BbCRASP-1-(26–244), BbCRASP-1-(26–240), BbCRASP-1-(26–166), and BbCRASP-1-(26–108)) (20 μg/ml, dialyzed against 10 mm acetate buffer, pH 5.5) were coupled via a standard amine-coupling procedure to the flow cells of a sensor chip (CM5, Biacore AB) until a level of >4,000 resonance units was reached. A control flow cell was prepared in the same way but without injecting a protein. Factor H, FHL-1, and deletion construct FH1–6 were dialyzed against running buffer (75 mm phosphate buffered saline, pH 7.4). Each ligand (factor H, 333 nm; FHL-1 and FH1–6, 1 μm) was injected separately into the flow cell coupled with BbCRASP-1 or the deletion mutants and into a control flow cell using a flow rate of 5 μl/min at 25 °C. Each interaction was analyzed at least three times. The binding kinetics were determined using a lower density of the immobilized ligand (<1,000 resonance units) at 22 °C in 75 mm phosphate-buffered saline, pH 7.4, and employing a natural logarithmic Langmuir 1:1 binding model and the simultaneous Ka/Kd fitting routine of the BIAevaluation 3.1 software (Biacore, AB). The equilibrium constants were calculated from the rate constants. Pepspot Analysis—A library of 72 peptides, representing the entire BbCRASP-1 protein, SCR7 of factor H/FHL-1, and SCR19–20 of factor H was synthesized and spotted on a cellulose membrane (Jerini Peptide Technologies, Berlin, Germany). Each peptide was 13 amino acids in length and differed from the next peptide in 3 amino acid residues. Therefore, each peptide overlapped with the next by 10 amino acids. Membranes were incubated with recombinant proteins, and binding was detected with specific antibodies directed against the N-terminal region of factor H/FHL-1 (αSCR1–4), against the C-terminal region of factor H (αSCR19–20), or against the BbCRASP-1 protein (RH1). In Situ Protease Treatment of Spirochetes—Whole cells of B. burgdorferi strain ZS7 were treated with proteases by modification of a method described previously (45.Bunikis J. Barbour A.G. Infect. Immun. 1999; 67: 2874-2883Crossref PubMed Google Scholar). Briefly, freshly harvested cells were washed twice with PBS-MgCl, and after centrifugation at 5000 rpm for 10 min, the sedimented spirochetes were resuspended in 100 μl of this buffer. To 1 × 107 intact borrelial cells (final volume of 0.5 ml), proteinase K in distilled water (Sigma) or trypsin in 0.001 n HCl (Sigma) were added to a final concentration of 12.5–100 μg/ml. Following incubation for 1 or 2 h at room temperature proteinase K was inhibited by adding 5 μl phenylmethylsulfonyl fluoride (Sigma) (50 mg/ml in isopropyl alcohol) and trypsin was inhibited by adding 5 μl phenylmethylsulfonyl fluoride (Sigma) and 5 μl of 4-(2-aminoethyl)-benzenesulfonyl fluoride (Sigma). The cells were then washed twice with PBS-Mg, resuspended in 20 μl of the same buffer, and lysed by sonication 5 times using a Branson B-12 sonifier (Heinemann, Schwäbisch Gmünd, Germany). Whole-cell protein preparations (10 μl) were separated using Tris/Tricine-SDS-PAGE via 4% stacking and 10% separating gels as described previously (34.Kraiczy P. Skerka C. Brade V. Zipfel P.F. Infect. Immun. 2001; 69: 7800-7809Crossref PubMed Scopus (190) Google Scholar, 35.Kraiczy P. Hellwage J. Skerka C. Kirschfink M. Brade V. Zipfel P.F. Wallich R. Eur. J. Immunol. 2003; 33: 697-707Crossref PubMed Scopus (113) Google Scholar). Functional Assay for Cofactor Activity of Factor H and FHL-1— Cofactor activity of factor H and FHL-1 was analyzed on immobilized recombinant BbCRASP-1 by measuring factor I-mediated conversion of C3b to iC3b. Briefly, recombinant BbCRASP-1 (20 μg/ml) immobilized on a microtiter plate was incubated with an excess of purified factor H, FHL-1, or of an unrelated protein (L1). After washing, bound complement regulators were incubated with a molar excess of purified C3b (Calbiochem) and purified factor I (Sigma) for 15 min at 37 °C. iC3b generation was quantified by ELISA applying a neoepitope-specific mouse monoclonal anti-iC3b IgG (Quidel, San Diego, CA) as capture antibody and biotinylated rabbit anti-C3c IgG (Dako, Hamburg, Germany) as detector antibody. The reaction was visualized by the addition of streptavidin-peroxidase, followed by o-phenylenediamine/H2O2 as substrate. Purified iC3b (Calbiochem) was taken as standard. Control experiments included buffer instead of BbCRASP-1 as well as soluble and immobilized factor H or FHL-1, respectively, in the identical system. Human Sera, Rabbit Sera, and Monoclonal Antibodies—Non-immune human serum (NHS) obtained from 20 healthy human blood donors without known history of spirochetal infections was used as source for factor H. Sera that proved negative for anti-Borrelia antibodies were combined to form the NHS pool. MAb RH1 directed against BbCRASP-1 and mAb N38 1.1 directed against BbCRASP-3 were generated by immunization of Balb/c mice with purified recombinant BbCRASP-1 or BbCRASP-3 protein, respectively. Generation of mAb LA3 against Hsp70, LA22.1 against flagellin, LA27 against OspA, and LA28.1 OspB were described elsewhere (46.Kramer M.D. Schaible U.E. Wallich R. Moter S.E. Petzhold D. Simon M.M. Immunobiology. 1990; 181: 357-366Crossref PubMed Scopus (52) Google Scholar). Nucleotide Sequence Deposition—The bbCRASP-1 gene sequence reported in this paper has been deposited in the EMBL/GenBank™ data bases under the accession number AJ430845. Identification and Cloning of the Gene Encoding BbCRASP-1 of B. burgdorferi Strain ZS7—In order to identify B. burgdorferi CRASP-1, a genomic DNA expression library derived from B. burgdorferi strain ZS7 was screened for factor H and FHL-1-binding clones. From 15 clones initially identified, one was particularly reactive with both complement regulators, factor H and FHL-1. Sequence analysis of this clone revealed that the open reading frame was identical to the zs7.a68 gene described previously (41.Wallich R. Jahraus O. Stehle T. Tran T.T.T. Brenner C. Hofmann H. Gern L. Simon M.M. Eur. J. Immunol. 2003; 33: 708-719Crossref PubMed Scopus (24) Google Scholar). Comparative sequence analysis showed that the zs7.a68 gene was homologous to bba68 of strain B31 (47.Fraser C.M. Casjens S. Huang W.M. Sutton G.G. Clayton R. Lathigra R. White O. Ketchum K.A. Dodson R. Hickey E.K. Gwinn M. Dougherty B. Tomb J.-F. Fleischmann R.D. Richardson D. Peterson J. Kerlavage A.R. Quackenbush J. Salzberg S. Hanson M. van Vugt R. Palmer N. Adams M.D. Gocayne J. Weidman J. Utterback T. Watthey L. McDonald L. Artiach P. Bowman Ch. Garland S. Fujii C. Cotton M.D. Horst K. Roberst K. Hatch B. Smith H.O. Venter J.C. Nature. 1997; 390: 580-586Crossref PubMed Scopus (1742) Google Scholar). Pulsed field gel electrophoresis demonstrated that zs7.a68 is located together with ospA/B and dbpA/B on the 54-kb linear plasmid of B. burgdorferi ZS7 (41.Wallich R. Jahraus O. Stehle T. Tran T.T.T. Brenner C. Hofmann H. Gern L. Simon M.M. Eur. J. Immunol. 2003; 33: 708-719Crossref PubMed Scopus (24) Google Scholar). zs7.a68 encodes a unique protein with a calculated molecular mass of 28 kDa, and is hereafter termed BbCRASP-1. The predicted N terminus of BbCRASP-1 shows significant homology to the signal peptides of other bacterial lipoproteins. This motif includes three lysine residues near the N terminus, a hydrophobic region, and a sequence similar to the consensus signal peptidase II cleavage sequence LX(2–4)C. Subsequent lipidation at the cysteine residue 25 predicts BbCRASP-1 as an outer surface lipoprotein of B. burgdorferi (Fig. 1). Localization of the Factor H and FHL-1-binding Site within BbCRASP-1—In order to localize" @default.
• W2006662979 created "2016-06-24" @default.
• W2006662979 creator A5003597638 @default.
• W2006662979 creator A5008616910 @default.
• W2006662979 creator A5024773765 @default.
• W2006662979 creator A5066082357 @default.
• W2006662979 creator A5067373544 @default.
• W2006662979 creator A5067381987 @default.
• W2006662979 creator A5074386662 @default.
• W2006662979 creator A5074615051 @default.
• W2006662979 creator A5084238487 @default.
• W2006662979 date "2004-01-01" @default.
• W2006662979 modified "2023-10-16" @default.
• W2006662979 title "Complement Resistance of Borrelia burgdorferi Correlates with the Expression of BbCRASP-1, a Novel Linear Plasmid-encoded Surface Protein That Interacts with Human Factor H and FHL-1 and Is Unrelated to Erp Proteins" @default.
• W2006662979 cites W1512671399 @default.
• W2006662979 cites W1564844664 @default.
• W2006662979 cites W1569686393 @default.
• W2006662979 cites W1703676865 @default.
• W2006662979 cites W1827417957 @default.
• W2006662979 cites W1921635691 @default.
• W2006662979 cites W1926303070 @default.
• W2006662979 cites W1928157229 @default.
• W2006662979 cites W1970214880 @default.
• W2006662979 cites W1971954117 @default.
• W2006662979 cites W1987927636 @default.
• W2006662979 cites W1993249060 @default.
• W2006662979 cites W2007896776 @default.
• W2006662979 cites W2011323677 @default.
• W2006662979 cites W2012760052 @default.
• W2006662979 cites W2018133348 @default.
• W2006662979 cites W2018662284 @default.
• W2006662979 cites W2022013307 @default.
• W2006662979 cites W2027669213 @default.
• W2006662979 cites W2027682917 @default.
• W2006662979 cites W2027708577 @default.
• W2006662979 cites W2028247608 @default.
• W2006662979 cites W2051237620 @default.
• W2006662979 cites W2052759282 @default.
• W2006662979 cites W2059726023 @default.
• W2006662979 cites W2061501964 @default.
• W2006662979 cites W2071337207 @default.
• W2006662979 cites W2071842931 @default.
• W2006662979 cites W2073745575 @default.
• W2006662979 cites W2075021230 @default.
• W2006662979 cites W2080583506 @default.
• W2006662979 cites W2081176438 @default.
• W2006662979 cites W2090273752 @default.
• W2006662979 cites W2094083548 @default.
• W2006662979 cites W2099118431 @default.
• W2006662979 cites W2099528191 @default.
• W2006662979 cites W2104373250 @default.
• W2006662979 cites W2106200480 @default.
• W2006662979 cites W2121072694 @default.
• W2006662979 cites W2124479213 @default.
• W2006662979 cites W2126297561 @default.
• W2006662979 cites W2132993876 @default.
• W2006662979 cites W2138474762 @default.
• W2006662979 cites W2144471192 @default.
• W2006662979 cites W2152200583 @default.
• W2006662979 cites W2155580358 @default.
• W2006662979 cites W2155785635 @default.
• W2006662979 cites W2158820430 @default.
• W2006662979 cites W2161469264 @default.
• W2006662979 cites W2164395407 @default.
• W2006662979 cites W2166910228 @default.
• W2006662979 cites W2168786380 @default.
• W2006662979 cites W2338016371 @default.
• W2006662979 cites W2346909892 @default.
• W2006662979 cites W315197452 @default.
• W2006662979 cites W4232462786 @default.
• W2006662979 doi "https://doi.org/10.1074/jbc.m308343200" @default.
• W2006662979 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14607842" @default.
• W2006662979 hasPublicationYear "2004" @default.
• W2006662979 type Work @default.
• W2006662979 sameAs 2006662979 @default.
• W2006662979 citedByCount "221" @default.
• W2006662979 countsByYear W20066629792012 @default.
• W2006662979 countsByYear W20066629792013 @default.
• W2006662979 countsByYear W20066629792014 @default.
• W2006662979 countsByYear W20066629792015 @default.
• W2006662979 countsByYear W20066629792016 @default.
• W2006662979 countsByYear W20066629792017 @default.
• W2006662979 countsByYear W20066629792018 @default.
• W2006662979 countsByYear W20066629792019 @default.
• W2006662979 countsByYear W20066629792020 @default.
• W2006662979 countsByYear W20066629792021 @default.
• W2006662979 countsByYear W20066629792022 @default.
• W2006662979 countsByYear W20066629792023 @default.
• W2006662979 crossrefType "journal-article" @default.
• W2006662979 hasAuthorship W2006662979A5003597638 @default.
• W2006662979 hasAuthorship W2006662979A5008616910 @default.
• W2006662979 hasAuthorship W2006662979A5024773765 @default.
• W2006662979 hasAuthorship W2006662979A5066082357 @default.
• W2006662979 hasAuthorship W2006662979A5067373544 @default.
• W2006662979 hasAuthorship W2006662979A5067381987 @default.
• W2006662979 hasAuthorship W2006662979A5074386662 @default.
• W2006662979 hasAuthorship W2006662979A5074615051 @default.
• W2006662979 hasAuthorship W2006662979A5084238487 @default.

• next