FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007169599> ?p ?o ?g. }

• W2007169599 endingPage "12729" @default.
• W2007169599 startingPage "12717" @default.
• W2007169599 abstract "Post-translational modification of proteins regulates many cellular processes. Some modifications, including N-linked glycosylation, serve multiple functions. For example, the attachment of N-linked glycans to nascent proteins in the endoplasmic reticulum facilitates proper folding, whereas retention of high mannose glycans on misfolded glycoproteins serves as a signal for retrotranslocation and ubiquitin-mediated proteasomal degradation. Here we examine the substrate specificity of the only family of ubiquitin ligase subunits thought to target glycoproteins through their attached glycans. The five proteins comprising this FBA family (FBXO2, FBXO6, FBXO17, FBXO27, and FBXO44) contain a conserved G domain that mediates substrate binding. Using a variety of complementary approaches, including glycan arrays, we show that each family member has differing specificity for glycosylated substrates. Collectively, the F-box proteins in the FBA family bind high mannose and sulfated glycoproteins, with one FBA protein, FBX044, failing to bind any glycans on the tested arrays. Site-directed mutagenesis of two aromatic amino acids in the G domain demonstrated that the hydrophobic pocket created by these amino acids is necessary for high affinity glycan binding. All FBA proteins co-precipitated components of the canonical SCF complex (Skp1, Cullin1, and Rbx1), yet FBXO2 bound very little Cullin1, suggesting that FBXO2 may exist primarily as a heterodimer with Skp1. Using subunit-specific antibodies, we further demonstrate marked divergence in tissue distribution and developmental expression. These differences in substrate recognition, SCF complex formation, and tissue distribution suggest that FBA proteins play diverse roles in glycoprotein quality control. Post-translational modification of proteins regulates many cellular processes. Some modifications, including N-linked glycosylation, serve multiple functions. For example, the attachment of N-linked glycans to nascent proteins in the endoplasmic reticulum facilitates proper folding, whereas retention of high mannose glycans on misfolded glycoproteins serves as a signal for retrotranslocation and ubiquitin-mediated proteasomal degradation. Here we examine the substrate specificity of the only family of ubiquitin ligase subunits thought to target glycoproteins through their attached glycans. The five proteins comprising this FBA family (FBXO2, FBXO6, FBXO17, FBXO27, and FBXO44) contain a conserved G domain that mediates substrate binding. Using a variety of complementary approaches, including glycan arrays, we show that each family member has differing specificity for glycosylated substrates. Collectively, the F-box proteins in the FBA family bind high mannose and sulfated glycoproteins, with one FBA protein, FBX044, failing to bind any glycans on the tested arrays. Site-directed mutagenesis of two aromatic amino acids in the G domain demonstrated that the hydrophobic pocket created by these amino acids is necessary for high affinity glycan binding. All FBA proteins co-precipitated components of the canonical SCF complex (Skp1, Cullin1, and Rbx1), yet FBXO2 bound very little Cullin1, suggesting that FBXO2 may exist primarily as a heterodimer with Skp1. Using subunit-specific antibodies, we further demonstrate marked divergence in tissue distribution and developmental expression. These differences in substrate recognition, SCF complex formation, and tissue distribution suggest that FBA proteins play diverse roles in glycoprotein quality control. Careful maintenance of properly folded glycoproteins is crucial for cellular homeostasis. Under physiological conditions, however, some glycoproteins fail to fold or assemble correctl and must be degraded (1Turner G.C. Varshavsky A. Science. 2000; 289: 2117-2120Crossref PubMed Scopus (199) Google Scholar, 2Schubert U. Anton L.C. Gibbs J. Norbury C.C. Yewdell J.W. Bennink J.R. Nature. 2000; 404: 770-774Crossref PubMed Scopus (1) Google Scholar). Many secreted and membrane proteins are glycosylated in the endoplasmic reticulum (ER), 2The abbreviations used are: ER, endoplasmic reticulum; GST, glutathione S-transferase; PBS, phosphate-buffered saline; TBS, Tris-buffered saline; IP, immunoprecipitation; PNGase, peptide:N-glycosidase; RFU, relative fluorescent unit; GN, glycan number; ConA, concanavalin A; AGP, α1-acid glycoprotein. where correct biosynthesis of the nascent glycoprotein is aided by interactions with ER resident lectin-like proteins that bind glycan moieties on glycoproteins. ER resident lectins such as calnexin and calreticulin act as chaperones to ensure that nascent glycoproteins fold properly. Here we examine a novel group of lectin-like subunits of ubiquitin ligase complexes, the FBA family of F-box proteins, which have been proposed to target misfolded glycoproteins for degradation by the proteasome (3Yoshida Y. Chiba T. Tokunaga F. Kawasaki H. Iwai K. Suzuki T. Ito Y. Matsuoka K. Yoshida M. Tanaka K. Tai T. Nature. 2002; 418: 438-442Crossref PubMed Scopus (305) Google Scholar). In the ER lumen, N-linked glycans are attached to newly synthesized proteins to facilitate proper protein folding and assembly (4Helenius A. Aebi M. Science. 2001; 291: 2364-2369Crossref PubMed Scopus (1997) Google Scholar, 5Ellgaard L. Helenius A. Nat. Rev. Mol. Cell Biol. 2003; 4: 181-191Crossref PubMed Scopus (1681) Google Scholar, 6Helenius A. Aebi M. Annu. Rev. Biochem. 2004; 73: 1019-1049Crossref PubMed Scopus (1629) Google Scholar). Nascent glycoproteins undergo successive rounds of folding and glycan trimming, during which ER resident lectins monitor their folding state (4Helenius A. Aebi M. Science. 2001; 291: 2364-2369Crossref PubMed Scopus (1997) Google Scholar, 5Ellgaard L. Helenius A. Nat. Rev. Mol. Cell Biol. 2003; 4: 181-191Crossref PubMed Scopus (1681) Google Scholar, 7Moremen K.W. Molinari M. Curr. Opin. Struct. Biol. 2006; 16: 592-599Crossref PubMed Scopus (110) Google Scholar). The retention of high mannose glycans on misfolded or unassembled glycoproteins serves as a key signal for recognition by ER lectins such as EDEM (8Lederkremer G.Z. Glickman M.H. Trends Biochem. Sci. 2005; 30: 297-303Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) and subsequent retrotranslocation from the ER and proteasomal degradation. This process is known as glycoprotein ER-associated degradation or GERAD (9Cabral C.M. Liu Y. Moremen K.W. Sifers R.N. Mol. Biol. Cell. 2002; 13: 2639-2650Crossref PubMed Scopus (93) Google Scholar). The targeting of misfolded proteins to the proteasome is accomplished in part by ubiquitin ligases that recognize and ubiquitinate specific substrates (10Glickman M.H. Ciechanover A. Physiol. Rev. 2002; 82: 373-428Crossref PubMed Scopus (3375) Google Scholar). ER proteins marked for degradation by GERAD can be ubiquitinated through at least two pathways. One relies on the ER membrane-bound protein complex Hrd1/Der3 (11Bays N.W. Gardner R.G. Seelig L.P. Joazeiro C.A. Hampton R.Y. Nat. Cell Biol. 2001; 3: 24-29Crossref PubMed Scopus (381) Google Scholar, 12Gardner R.G. Swarbrick G.M. Bays N.W. Cronin S.R. Wilhovsky S. Seelig L. Kim C. Hampton R.Y. J. Cell Biol. 2000; 151: 69-82Crossref PubMed Scopus (249) Google Scholar), and the second relies on cytoplasmic ubiquitin ligases (13Werner E.D. Brodsky J.L. McCracken A.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13797-13801Crossref PubMed Scopus (394) Google Scholar), including members of the large class of cytoplasmic ubiquitin-protein isopeptide ligases known as Skp/Cullin/F-box (SCF) complexes (14Semple C.A. Group R.G. Members G.S.L. Genome Res. 2003; 13: 1389-1394Crossref PubMed Scopus (118) Google Scholar). SCF ubiquitin ligases contain three core components (Skp1, Cul, and Rbx1) and any one of dozens of F-box proteins (10Glickman M.H. Ciechanover A. Physiol. Rev. 2002; 82: 373-428Crossref PubMed Scopus (3375) Google Scholar, 15Deshaies R.J. Annu. Rev. Cell Dev. Biol. 1999; 15: 435-467Crossref PubMed Scopus (1083) Google Scholar, 16Ciechanover A. EMBO J. 1998; 17: 7151-7160Crossref PubMed Scopus (1200) Google Scholar). Through its substrate binding domain, the F-box protein confers substrate specificity onto the SCF complex in which it resides (15Deshaies R.J. Annu. Rev. Cell Dev. Biol. 1999; 15: 435-467Crossref PubMed Scopus (1083) Google Scholar, 17Bai C. Sen P. Hofmann K. Ma L. Goebl M. Harper J.W. Elledge S.J. Cell. 1996; 86: 263-274Abstract Full Text Full Text PDF PubMed Scopus (990) Google Scholar, 18Kipreos E.T. Pagano M. Genome Biol. 2000; 1: 1-7Crossref PubMed Google Scholar). Although the human genome may encode over 500 ubiquitin ligases (14Semple C.A. Group R.G. Members G.S.L. Genome Res. 2003; 13: 1389-1394Crossref PubMed Scopus (118) Google Scholar) and as many as 70 F-box proteins, only two F-box proteins have been shown to target glycoproteins in a lectin-like manner (3Yoshida Y. Chiba T. Tokunaga F. Kawasaki H. Iwai K. Suzuki T. Ito Y. Matsuoka K. Yoshida M. Tanaka K. Tai T. Nature. 2002; 418: 438-442Crossref PubMed Scopus (305) Google Scholar, 19Yoshida Y. Tokunaga F. Chiba T. Iwai K. Tanaka K. Tai T. J. Biol. Chem. 2003; 278: 43877-43884Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). Both belong to the small family of F-box proteins known as the F-box associated (FBA) family. Intriguingly, FBA family members were recently shown to co-immunoprecipitate with Hrd1 from the ER membrane-bound protein complex, Hrd1/Der3 (20Groisman B. Avezov E. Lederkremer G.Z. Isr. J. Chem. 2006; 46: 189-196Crossref Scopus (12) Google Scholar). Hence, this FBA family of ubiquitin ligases may serve multiple roles in GERAD. The five F-box proteins comprising the FBA family are predicted to bind glycoprotein substrates through their conserved C-terminal domain, known as the FBA or G domain (21Ilyin G.P. Serandour A.L. Pigeon C. Rialland M. Glaise D. Guguen-Guillouzo C. Gene (Amst.). 2002; 296: 11-20Crossref PubMed Scopus (32) Google Scholar, 22Winston J.T. Koepp D.M. Zhu C. Elledge S.J. Harper J.W. Curr. Biol. 1999; 9: 1180-1182Abstract Full Text Full Text PDF PubMed Scopus (307) Google Scholar). This domain is structurally homologous to the glycan binding domains of two other mammalian lectins, galectin (23Mizushima T. Hirao T. Yoshida Y. Lee S.J. Chiba T. Iwai K. Yamaguchi Y. Kato K. Tsukihara T. Tanaka K. Nat. Struct. Mol. Biol. 2004; 11: 365-370Crossref PubMed Scopus (76) Google Scholar) and PNGase F (24Zhou X. Zhao G. Truglio J.J. Wang L. Li G. Lennarz W.J. Schindelin H. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 17214-17219Crossref PubMed Scopus (40) Google Scholar). The five FBA proteins, termed FBGs 1–5 by some researchers (19Yoshida Y. Tokunaga F. Chiba T. Iwai K. Tanaka K. Tai T. J. Biol. Chem. 2003; 278: 43877-43884Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 21Ilyin G.P. Serandour A.L. Pigeon C. Rialland M. Glaise D. Guguen-Guillouzo C. Gene (Amst.). 2002; 296: 11-20Crossref PubMed Scopus (32) Google Scholar), are formally designated by HUGO as FBXO2, FBXO6, FBXO44, FBXO17, and FBXO27, respectively (25Jin J. Cardozo T. Lovering R.C. Elledge S.J. Pagano M. Harper J.W. Genes Dev. 2004; 18: 2573-2580Crossref PubMed Scopus (548) Google Scholar). Two members of this FBA family, FBXO2 and FBXO6, have been shown to bind high mannose N-linked glycoproteins and function as ubiquitin ligase subunits (3Yoshida Y. Chiba T. Tokunaga F. Kawasaki H. Iwai K. Suzuki T. Ito Y. Matsuoka K. Yoshida M. Tanaka K. Tai T. Nature. 2002; 418: 438-442Crossref PubMed Scopus (305) Google Scholar, 19Yoshida Y. Tokunaga F. Chiba T. Iwai K. Tanaka K. Tai T. J. Biol. Chem. 2003; 278: 43877-43884Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 26Hagihara S. Totani K. Matsuo I. Ito Y. J. Med. Chem. 2005; 48: 3126-3129Crossref PubMed Scopus (36) Google Scholar, 27Nelson R.F. Glenn K.A. Miller V.M. Wen H. Paulson H.L. J. Biol. Chem. 2006; 281: 20242-20251Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 28Arias E.B. Kim J. Cartee G.D. Diabetes. 2004; 53: 921-930Crossref PubMed Scopus (111) Google Scholar, 29Yoshida Y. Adachi E. Fukiya K. Iwai K. Tanaka K. EMBO Rep. 2005; 6: 239-244Crossref PubMed Scopus (78) Google Scholar). Whether the other members of the family share this lectin-like ubiquitin ligase activity is unknown. The discovery that FBXO2 and FBXO6 recognize high mannose glycoproteins was an important advance in understanding the ubiquitin-proteasome components that mediate GERAD. But it is unknown whether the entire FBA family of F-box proteins participates in GERAD, or whether they all function as ubiquitin ligases. To answer these questions we examined the substrate binding, the ability to form SCF complexes, and the tissue distribution of all five FBA proteins. Primers used in the construction of the human and mouse FBA clones are listed in Table 1.TABLE 1Primers used in cloning FBA family and generating Null mutantsGeneForward and reverse primersLocationExpected productkbhFBXO2F, GCTAAGCTTGATGGACGGAGACGGTGACCCAG75-970.9BC025233.1R, CTGAATTCAGGGTTCTACCCACACGCTGC966-944hFBXO6F, GGAGACAGCTTCAGGACACG76-951NM_018438.4R, GACCCAGACACAGGATGGAC1042-1023hFBXO44F, AATTGCGGCCGCAAAGAAGCCACAAGCCATGGCTG113-1330.8NM_033182.5R, CAACGGATCCTGTTTACCAGTCAGGGTTCAG936-916hFBXO17F, CGAATTCTCATGAAGCAAGGACTCTGG105-1230.9NM_148169.1R, GTCGGTACCCTAGGACAGACGGATCCTG968-951hFBXO27F, CGAATTCTCATGGGCGCCTCGGTCTCC81-1000.9BC014527.2R, GGTAGATCTGGACTAGGACAGACG939-922mFbxo2F, GCTAAGCTTGGATGGAGATGGTGATCCAGAGA24-470.9BC046586.1R, CTATCGATGGTACCGTCAGGGTTCCACCCAC916-900mFbxo44F, GCTAAGCTTGGCAGTAGGCAACATCAACGAGC168-1910.6BC028884.1R, CTATCGATGGTACCGCTACATGAGACCCTCCC803-786mFbxo27F, GCTAAGCTTGGGTGCCTGGATATCCAGGACCC102-1250.7BQ922154.1R, TCGATGGTACCGCTACTGCAGGTAGATATCATT786-804hFBXO2 NullF, CGGGGGGCAGGACTCCGTCGCCGCTAAGGGCTGGTTCGGGGCCCGGGTG812-8606.8R, CACCCGGGCCCCAACCAGCCCTTAGCGGCGACGGAGTCCTGCCCCCCG860-812hFBXO6 NullF, CAGCATGGGGGCAGGGACACCCAGGCCGCTGCAGGCTGGTATGGGCCCCGAGTC715-7686.8R, GACTCGGGGCCCATACCAGCCTGCAGCGGCCTGGGTGTCCCTGCCCCCATGCTG768-715hFBX044 NullF, GCACGGCGGCGTGGACACTCATGCCGCTGCCGGCTGGTACGGCCCGAGGGTC676-7276.8R, GACCCTCGGGCCGTACCAGCCGGCAGCGGCATGAGTGTCCACGCCGCCGTGC727-676hFBX017 NullF, CGGGAGAGACGTGAGTGCCGCGGTGGGGCACTACGGCGC752-7906.8R, GCGCCGTAGTGCCCCACCGCGGCACTCACGTCTCTCCCG790-752hFBX027 NullF, CGAACACCGGGGCCAGGACACACAGGCCGCGGCTGGCCACTATGGAGCCCGTG819-8716.8R, CACGGGCTCCATAGTGGCCAGCCGCGGCCTGTGTGTCCTGGCCCCGGTGTTCG871-819a All primers are presented 5′ to 3′. Open table in a new tab a All primers are presented 5′ to 3′. Human FBAs—FBXO2 was amplified from IMAGE clone 5090925 and FBXO27 from IMAGE clone 3841901. FBXO6, FBXO44, and FBXO17 were cloned from heart and brain cDNA libraries, a kind gift from Dr. Bento Soares (Northwestern University). All FBA clones were sequenced; any PCR mutations were corrected with QuikChange mutagenesis (Invitrogen) and the resultant cDNAs ligated into pFLAG-CMV-6b (Sigma). Mouse FBAs—mFbxo2 was cloned from IMAGE clone 6487759; mFbxo44 was cloned from IMAGE clone 4165174, and mFbxo27 was cloned from IMAGE clone 6468333. MFbxo6 and mFbxo17 in pCMV-FLAG were a kind gift from Dr. Yukiko Yoshida (Tokyo Institute of Medical Science). GST Fusions—Using primers in Table 1, human FLAG-FBA proteins were amplified and then subcloned into the polylinker of pET41C (Novagen, Madison, WI). FBXO2 was also cloned into pGEX-6P1 as described previously (27Nelson R.F. Glenn K.A. Miller V.M. Wen H. Paulson H.L. J. Biol. Chem. 2006; 281: 20242-20251Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar) to generate a cleavable GST fusion protein. All FBA clones were sequenced. Null Mutants—Using primers listed in Table 1, GST-FBA fusions were constructed to replace two critical amino acids in the G domain hydrophobic pocket with alanines (Fig. 1, A and B). QuikChange mutagenesis was used with complementary primers spanning the insertion substitution sites. COS-7 cells (American Type Tissue Collection (ATCC), Manassas, VA) were maintained in Dulbecco's modified Eagle's medium with 10% fetal bovine serum (Invitrogen). Cell lines were incubated at 37 °C, 5% CO2. For transient transfections, 80% confluent COS-7 cells were transfected with 6 μg of DNA/10-cm plate with Lipofectamine-Plus reagent (Invitrogen) in Opti-MEM (Invitrogen) according to the manufacturer's protocol for COS-7 cells. Co-transfections were performed as above with equimolar concentrations of DNA, and the total DNA did not exceed 6 μg of DNA/10-cm plate. For SCF complex isolation, equimolar amounts of FBXO and Skp1, Cul1, and Rbx1 were transfected as described previously (30Nelson R.F. Glenn K.A. Zhang Y. Wen H. Knutson T. Gouvion C.M. Robinson B.K. Zhou Z. Yang B. Smith R.J.H. Paulson H.L. J. Neurosci. 2007; 27: 5163-5171Crossref PubMed Scopus (57) Google Scholar). Cells were harvested 48 h after transfection. Cells were rinsed with ice-cold PBS and harvested in Laemmli buffer (50 mm Tris, pH 6.8, 100 mm dithiothreitol, 2% SDS, 0.1% bromphenol blue, 10% glycerol). Cell lysates were then heated to 95 °C for 5 min, sonicated for 30 s, and centrifuged at 16,000 × g, 4 °C for 15 min to pellet debris. Nondenatured lysates were prepared by rinsing cells with PBS, incubating on ice with FLAG Lysis Buffer (FLB: 50 mm Tris, pH 7.4, 150 mm NaCl, 1 mm EDTA, 1% Triton X-100 containing EDTA-free protease inhibitors (Complete, Roche Applied Science) for 10 min, then scraping cells off the plate, and incubating cells on ice for a further 30 min, vortexing each 5 min. Lysates were cleared by centrifugation at 16,000 × g for 15 min. BL21(DE3)RP cells (Stratagene, La Jolla Ca) were transformed with the indicated GST fusion plasmids. Single colonies were grown overnight in LB broth with kanamycin (10 mg/liter) at 37 °C. The culture was diluted 1:50 in Terrific Broth-Kan, grown at 37 °C to an A600 nm = 0.6, and then induced for 2.5 h with 0.4 mm isopropyl 1-thio-β-d-galactopyranoside. The cells were pelleted and lysed for 30 min in 30 ml of BugBuster (Novagen)/500 ml of cell culture with protease inhibitors (Complete, Roche Applied Science), in accordance with the manufacturer's protocol. The supernatant was collected after centrifugation at 16,000 × g for 20 min at 4 °C. PBS-equilibrated glutathione-Sepharose 4B beads (1.0 ml slurry/500 ml cell culture) (Amersham Biosciences) were added, and the lysates were rocked for 30 min at room temperature. The beads were pelleted at 500 × g for 5 min and washed with 10 bed volumes of PBS. Purified GST fusion protein was eluted with 700 μl of reduced glutathione (10 mm) for 10 min at room temperature. Size filtration was used to concentrate the GST fusion proteins using a Microcon YM-100 filter (Millipore, Bedford, MA) and resuspended in TSM buffer (20 mm Tris-HCl, pH 7.4, 150 mm NaCl, 2 mm CaCl2, 2mm MgCl2, 0.05% Tween 20). Protein concentration was determined at an A280 nm, using absorbance of 1 = 0.5 mg/ml. Aliquots containing 25–100 mg of proteins were separated on SDS-polyacrylamide gels, transferred to polyvinylidene difluoride membranes, and stained with 0.8 mg/ml Direct Blue 71 (Sigma) in 40% EtOH, 10% acetic acid as described by Hong et al. (31Hong H.Y. Yoo G.S. Choi J.K. Electrophoresis. 2000; 21: 841-845Crossref PubMed Scopus (43) Google Scholar). 600 μg of purified GST-FBA protein was shipped on dry ice for analysis by the glycan array. Although multiple bands were observed on Direct Blue staining (supplemental Fig. 2A), the absence of any significant glycan binding to either GST alone or GST fusion null mutations demonstrates that the presence of truncated fusion proteins does not confound interpretation of the glycan array or pulldown results. Because of variation in protein expression, we needed 1.0 liter of cell culture for FBXO2, 10 liters for FBXO6, FBXO27, and FBXO44, and 15 liters for FBXO17 for analysis by the Consortium for Functional Glycomics sponsored glycan array (32Blixt O. Head S. Mondala T. Scanlan C. Huflejt M.E. Alvarez R. Bryan M.C. Fazio F. Calarese D. Stevens J. Razi N. Stevens D.J. Skehel J.J. van Die I. Burton D.R. Wilson I.A. Cummings R. Bovin N. Wong C.-H. Paulson J.C. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 17033-17038Crossref PubMed Scopus (970) Google Scholar). Details of glycan array procedures and full data sets for all glycan array studies are available at the Consortium for Functional Glycomics web site. Purified proteins were added to the arrays at 30 μg/ml in TSM buffer. FBXO2 cleaved from GST (27Nelson R.F. Glenn K.A. Miller V.M. Wen H. Paulson H.L. J. Biol. Chem. 2006; 281: 20242-20251Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar) was applied to printed array version 1 (PA _v1). Rabbit anti-FBXO2 was used at 100 μg/ml followed by goat anti-rabbit IgG-Alexa 488 antibody at 25 μg/ml. GST-FBXO2, GST, and all other GST fusion proteins used goat anti-GST fluorescein isothiocyanate at 20 μg/ml. GST alone was analyzed on plate array version 3.5. GST-FBXO2 was analyzed with PA_v1. FBXO6 and FBXO17 were analyzed with PA_v2.1. FBXO27 was analyzed with PA_v2. Finally, FBXO44 was analyzed in both PA_v1 and PA_v2.1. Image intensities were detected with a ScanArray confocal scanner. After consulting with the consortium, and viewing previously generated data (available on the consortium web site), we set cutoff values to establish significance of binding. These values were set at 1,700 relative fluorescent units (RFUs) for the array used with FBXO2, and 15,000 RFUs for the later generation arrays used to assess FBXO6, FBXO44, FBXO17, and FBXO27 binding. RNase B (R7884), AGP (G9885), lactoferrin (L9507), heparin sulfate (H4784), and chondroitin sulfate B (C3788) were purchased from Sigma. 10 mg of each glycoprotein was conjugated to 1 ml of Affi-Gel 10 (Bio-Rad). Denatured glycoprotein-conjugated beads were prepared by the addition of a 1:1 ratio of 6 m guanidine HCl and were rotated end over end at 4 °C for 2 h. Beads were subsequently washed five times with 10 bed volumes of TBS + 0.5% Nonidet P-40. 10 μg of recombinant GST fusion protein was applied to 30 μl of the different glycoprotein-conjugated beads. Samples were rotated at room temperature for 30 min, and beads were then transferred to a Handee Micro-Spin column (Pierce) and washed by spin filtration twice with 200 μl of TBS + 0.5% Nonidet P-40. Bound GST fusion proteins were eluted with Laemmli buffer and incubated at room temperature for 15 min. Unless otherwise specified, adult tissues were obtained from male and female mice at least 8 weeks old. Embryonic tissues at day 7 and 15 were processed from eight embryos. The animals were anesthetized with Xylocaine/procaine and perfused with cold PBS plus protease inhibitors. The organs were quickly removed, placed on ice, dissociated with a Dounce homogenizer on ice in 2 μl of RIPA buffer/mg of dry weight with protease inhibitors. Denaturation of lysates was achieved by adding an equal volume of 2× Laemmli buffer, heating the samples to 95 °C for 5 min, and pelleting debris by centrifugation at 16,000 × g, 4 °C for 15 min. Mouse tissue preparations from a commercial supplier (BioChain, Hayward, CA) produced similar results. Nondenatured lysates from 10-cm plates were incubated with 50 μl of equilibrated FLAG-conjugated agarose beads (Sigma) for 1 h at 4 °C. The beads were pelleted by centrifugation for 30 s at 8,200 × g and washed four times with FLB. After the final wash, bound proteins were eluted from beads with Laemmli buffer without dithiothreitol. Beads were pelleted, and the supernatant containing the eluted proteins was resolved in 4–15% gradient SDS-PAGE (Bio-Rad). For GST fusion IPs, recombinant GST-FBXO fusion proteins were purified from OverExpress C41 cells (Lucigen, Middleton, WI), an Escherichia coli strain selected for tolerance to toxic proteins, grown in MagicMedia (Invitrogen), and harvested as described above. Nondenatured lysates prepared from COS-7 cells were incubated with 50 μg of purified GST fusion proteins and 15 μl of glutathione-Sepharose beads for 30 min at room temperature. The beads were then transferred to Handee Micro-Spin columns, washed four times with 200 μl of FLAG lysis buffer, and eluted with 30 μl of Laemmli buffer at room temperature for 15 min. FBA-specific antibodies were generated (Sigma Genosys) by inoculating New Zealand White rabbits with the following keyhole limpet hemocyanin-conjugated peptides. An underlined C indicates cysteine added for conjugation. Numbers in parentheses indicate amino acid position of the peptide in the mouse sequence. While this work was in progress a rabbit polyclonal antibody to FBXO2 was generated (29Yoshida Y. Adachi E. Fukiya K. Iwai K. Tanaka K. EMBO Rep. 2005; 6: 239-244Crossref PubMed Scopus (78) Google Scholar) using a sequence similar to that described below. The following peptides were used: Fbxo2 (1–19), MDGDGDPESVSHPEEASPEC; Fbxo6 (103–119), CKVETLPGSCGTSFPDNK; Fbxo44 (185–202), CHAPLGTFQPDPVMIQQKS; Fbxo17 (88–106) DADADGNRHDEFPFCALAR; and Fbxo27 (8–25), TRVPTPEPDPQEVLDLSR. For affinity purification, immune serum was incubated overnight at 4 °C with the appropriate peptide conjugated to agarose beads. Beads were then pelleted and washed with TBS (25 mm Tris, pH 7.4, 2.7 mm KCl, 14 mm NaCl) until the A280 nm returned to base line. The purified antibody was eluted with four successive bead volumes of glycine, pH 2, and aliquots containing antibody were pooled. FBXO2 (1:5,000), FBXO6 (1:200), FBXO44 (1:500), FBXO17 (1:100), and FBXO27 (1:100) antibodies, pre-immune and pre-adsorbed serum (both used at 1:1,000) were diluted in 5% nonfat dry milk, and antibody specificity was confirmed with Western analysis (supplemental Fig. 3). FLAG M5 (1:1,000), mouse α-tubulin (1:2,000), antibodies, and peroxidase-conjugated ConA (6 μg/30 ml) were purchased from Sigma. Skp1 mouse monoclonal antibody (BD Transduction Laboratories, catalog number 610530) was used at 1:5000. Rbx1 used at 1:100 (NeoMarkers, catalog number RB-9287), and Cullin1 was used at 1:250 (Zymed Laboratories Inc., catalog number 71-8700). Samples were resolved by SDS-PAGE and transferred to polyvinylidene difluoride membranes. Samples were blocked 1 h with 5% nonfat dry milk, and primary antibody was applied for 1 h at room temperature or overnight at 4 °C. The blots were washed four times with TBS containing 0.1% Triton X-100 and incubated with peroxidase-conjugated secondary antibody (goat anti-rabbit or goat anti-mouse, catalog number 1:15,000, both from Jackson ImmunoResearch, West Grove, PA) for 1 h at room temperature followed by four more washes as above. Divergent Binding of High Mannose Glycans—Previous studies have shown that FBXO2 and FBXO6 bind glycoproteins containing N-linked high mannose glycans (3Yoshida Y. Chiba T. Tokunaga F. Kawasaki H. Iwai K. Suzuki T. Ito Y. Matsuoka K. Yoshida M. Tanaka K. Tai T. Nature. 2002; 418: 438-442Crossref PubMed Scopus (305) Google Scholar, 23Mizushima T. Hirao T. Yoshida Y. Lee S.J. Chiba T. Iwai K. Yamaguchi Y. Kato K. Tsukihara T. Tanaka K. Nat. Struct. Mol. Biol. 2004; 11: 365-370Crossref PubMed Scopus (76) Google Scholar, 26Hagihara S. Totani K. Matsuo I. Ito Y. J. Med. Chem. 2005; 48: 3126-3129Crossref PubMed Scopus (36) Google Scholar, 29Yoshida Y. Adachi E. Fukiya K. Iwai K. Tanaka K. EMBO Rep. 2005; 6: 239-244Crossref PubMed Scopus (78) Google Scholar, 33Mizushima T. Yoshida Y. Kumanomidou T. Hasegawa Y. Suzuki A. Yamane T. Tanaka K. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 5777-5781Crossref PubMed Scopus (73) Google Scholar, 34Yamaguchi Y. Hirao T. Sakata E. Kamiya Y. Kurimoto E. Yoshida Y. Suzuki T. Tanaka K. Kato K. Biochem. Biophys. Res. Commun. 2007; 362: 712-716Crossref PubMed Scopus (19) Google Scholar). This raises the following important question. Do all five FBA family members bind similar substrate proteins and thus, like FBXO2 and FBXO6, have the capacity to participate in GERAD? To begin addressing this question, we first tested the ability of all five full-length FBA proteins to co-immunoprecipitate high mannose containing glycoproteins. As anticipated, proteins co-precipitating with FBXO2 stained robustly with ConA, a lectin that specifically recognizes high mannose glycans (Fig. 1A). Thus, many if not all proteins bound by FBXO2 are high mannose glycoproteins. As shown in Fig. 1A, FBXO2 is also expressed at higher levels than other FBA proteins, consistent with our previous report (27Nelson R.F. Glenn K.A. Miller V.M. Wen H. Paulson H.L. J. Biol. Chem. 2006; 281: 20242-20251Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). Both FBXO6 and FBXO27 displayed much more modest co-precipitation of ConA-staining proteins. In contrast, FBXO44 and FBXO17 displayed little if any binding to high mannose glycoproteins, validating earlier work performed with full-length FBXO44 and a truncated form of FBXO17 (19Yoshida Y. Tokunaga F. Chiba T. Iwai K. Tanaka K. Tai T. J. Biol. Chem. 2003; 278: 43877-43884Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). Similar results were also obtained when immunoprecipitations were performed in the presence of either the proteasome inhibitor lactacystin or benzyloxycarbonyl-VAD-fluoromethyl ketone, an inhibitor of the cytosolic glycosidase PNGase F (data not shown) (35Misaghi S. Pacold M.E. Blom D. Ploegh H.L. Korbel G.A. Chem. Biol. 2004; 11: 1677-1687Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Thus, the absence of robust high mannose glycoprotein binding by some FBA family members is not because of rapid proteasomal degradation of substrates or the removal of ConA-binding sites by PNGase F. To further characterize the binding of FBXO2, FBXO6, and FBXO27 to high mannose-containing glycoproteins, we created GST fusion proteins of these three FBA family members. After large scale purification from a" @default.
• W2007169599 created "2016-06-24" @default.
• W2007169599 creator A5053954475 @default.
• W2007169599 creator A5055180300 @default.
• W2007169599 creator A5067562997 @default.
• W2007169599 creator A5073541530 @default.
• W2007169599 creator A5084327404 @default.
• W2007169599 date "2008-05-01" @default.
• W2007169599 modified "2023-10-05" @default.
• W2007169599 title "Diversity in Tissue Expression, Substrate Binding, and SCF Complex Formation for a Lectin Family of Ubiquitin Ligases" @default.
• W2007169599 cites W1481278428 @default.
• W2007169599 cites W1500503853 @default.
• W2007169599 cites W1578118950 @default.
• W2007169599 cites W1596938063 @default.
• W2007169599 cites W1613447210 @default.
• W2007169599 cites W1765288636 @default.
• W2007169599 cites W1782287000 @default.
• W2007169599 cites W1852163795 @default.
• W2007169599 cites W1968862813 @default.
• W2007169599 cites W1974131115 @default.
• W2007169599 cites W1976509561 @default.
• W2007169599 cites W1977216626 @default.
• W2007169599 cites W1977498240 @default.
• W2007169599 cites W1979582828 @default.
• W2007169599 cites W1984826365 @default.
• W2007169599 cites W1985499036 @default.
• W2007169599 cites W1986487128 @default.
• W2007169599 cites W1987464684 @default.
• W2007169599 cites W1994861828 @default.
• W2007169599 cites W1997173534 @default.
• W2007169599 cites W2003696769 @default.
• W2007169599 cites W2005175785 @default.
• W2007169599 cites W2007064158 @default.
• W2007169599 cites W2013317474 @default.
• W2007169599 cites W2016209860 @default.
• W2007169599 cites W2016604429 @default.
• W2007169599 cites W2019518783 @default.
• W2007169599 cites W2023397454 @default.
• W2007169599 cites W2025226894 @default.
• W2007169599 cites W2026186036 @default.
• W2007169599 cites W2026790196 @default.
• W2007169599 cites W2028062152 @default.
• W2007169599 cites W2030513162 @default.
• W2007169599 cites W2031280438 @default.
• W2007169599 cites W2040250810 @default.
• W2007169599 cites W2045736180 @default.
• W2007169599 cites W2063070658 @default.
• W2007169599 cites W2065793590 @default.
• W2007169599 cites W2071847586 @default.
• W2007169599 cites W2072813224 @default.
• W2007169599 cites W2075124527 @default.
• W2007169599 cites W2076391844 @default.
• W2007169599 cites W2078163971 @default.
• W2007169599 cites W2078369440 @default.
• W2007169599 cites W2079374851 @default.
• W2007169599 cites W2079760361 @default.
• W2007169599 cites W2081261090 @default.
• W2007169599 cites W2082204132 @default.
• W2007169599 cites W2082698485 @default.
• W2007169599 cites W2087477609 @default.
• W2007169599 cites W2088506747 @default.
• W2007169599 cites W2089865526 @default.
• W2007169599 cites W2105010192 @default.
• W2007169599 cites W2107903949 @default.
• W2007169599 cites W2119560646 @default.
• W2007169599 cites W2121077625 @default.
• W2007169599 cites W2131492616 @default.
• W2007169599 cites W2134025840 @default.
• W2007169599 cites W2135656900 @default.
• W2007169599 cites W2138605813 @default.
• W2007169599 cites W2139577310 @default.
• W2007169599 cites W2146276688 @default.
• W2007169599 cites W2149369491 @default.
• W2007169599 cites W2150123812 @default.
• W2007169599 cites W2150851354 @default.
• W2007169599 cites W2155368705 @default.
• W2007169599 cites W2166217930 @default.
• W2007169599 cites W2168009511 @default.
• W2007169599 cites W2168224198 @default.
• W2007169599 cites W2169531684 @default.
• W2007169599 cites W2170634115 @default.
• W2007169599 cites W4366731939 @default.
• W2007169599 doi "https://doi.org/10.1074/jbc.m709508200" @default.
• W2007169599 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2442310" @default.
• W2007169599 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18203720" @default.
• W2007169599 hasPublicationYear "2008" @default.
• W2007169599 type Work @default.
• W2007169599 sameAs 2007169599 @default.
• W2007169599 citedByCount "68" @default.
• W2007169599 countsByYear W20071695992012 @default.
• W2007169599 countsByYear W20071695992013 @default.
• W2007169599 countsByYear W20071695992014 @default.
• W2007169599 countsByYear W20071695992015 @default.
• W2007169599 countsByYear W20071695992016 @default.
• W2007169599 countsByYear W20071695992017 @default.
• W2007169599 countsByYear W20071695992018 @default.
• W2007169599 countsByYear W20071695992019 @default.
• W2007169599 countsByYear W20071695992020 @default.

• next