FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007211948> ?p ?o ?g. }

• W2007211948 endingPage "331" @default.
• W2007211948 startingPage "319" @default.
• W2007211948 abstract "MicroRNAs are short noncoding RNAs that are implicated in cell self- renewal and cancer development. We show that miR-378 is up-regulated in human cancers and found that tumor cells transfected with miR-378 acquired properties of tumor stem cells, including cell self-renewal. Overexpression of miR-378 enhanced cell survival and colony formation. Isolated from a single-cell colony, the miR-378-expressing cells formed tumors in nude mice at low cell densities. These cells expressed higher levels of miR-378 and formed more and larger spheres and colonies. We found that the miR-378-expressing cells contained a large number of side population cells and could undergo differentiation. Cells transfected with miR-378 expressed increased levels of Sox2. Expression of miR-378 and Sox2 was found correlated significantly in cancer cell lines and in cancer patient specimens. We also observed opposite levels of vimentin in the cancer cell lines and human breast carcinoma specimens. We further demonstrated that vimentin is a target of miR-378, and ectopic transfection of vimentin inhibited Sox2 expression, resulting in decreased cell survival. Silencing vimentin promoted Sox2 expression and cell survival. Our study demonstrates that miR-378 is a regulator of stem cell marker Sox2 by targeting vimentin, which may serve as a new tool in studying the role of stem cells in tumorigenesis. MicroRNAs are short noncoding RNAs that are implicated in cell self- renewal and cancer development. We show that miR-378 is up-regulated in human cancers and found that tumor cells transfected with miR-378 acquired properties of tumor stem cells, including cell self-renewal. Overexpression of miR-378 enhanced cell survival and colony formation. Isolated from a single-cell colony, the miR-378-expressing cells formed tumors in nude mice at low cell densities. These cells expressed higher levels of miR-378 and formed more and larger spheres and colonies. We found that the miR-378-expressing cells contained a large number of side population cells and could undergo differentiation. Cells transfected with miR-378 expressed increased levels of Sox2. Expression of miR-378 and Sox2 was found correlated significantly in cancer cell lines and in cancer patient specimens. We also observed opposite levels of vimentin in the cancer cell lines and human breast carcinoma specimens. We further demonstrated that vimentin is a target of miR-378, and ectopic transfection of vimentin inhibited Sox2 expression, resulting in decreased cell survival. Silencing vimentin promoted Sox2 expression and cell survival. Our study demonstrates that miR-378 is a regulator of stem cell marker Sox2 by targeting vimentin, which may serve as a new tool in studying the role of stem cells in tumorigenesis. The intermediate filament vimentin mediates microRNA miR-378 function in cellular self-renewal by regulating the expression of the Sox2 transcription factor.Journal of Biological ChemistryVol. 289Issue 16PreviewVOLUME 288 (2013) PAGES 319–331 Full-Text PDF Open Access Cancer frequently relapses after treatments due to the presence of small number of tumor stem cells in the malignant tumors. Tumor stem cells can undergo unlimited self-renewal, invade to new territory, and initiate new tumors as a result of deregulated expression of oncogenes and tumor suppressors (1Li C. Heidt D.G. Dalerba P. Burant C.F. Zhang L. Adsay V. Wicha M. Clarke M.F. Simeone D.M. Identification of pancreatic cancer stem cells.Cancer Res. 2007; 67: 1030-1037Crossref PubMed Scopus (2752) Google Scholar, 2Ricci-Vitiani L. Lombardi D.G. Pilozzi E. Biffoni M. Todaro M. Peschle C. De Maria R. Identification and expansion of human colon-cancer-initiating cells.Nature. 2007; 445: 111-115Crossref PubMed Scopus (3400) Google Scholar). Recent studies indicated that expression of these genes is largely modulated by a subset of RNAs named microRNAs (miRNAs) (3Volinia S. Calin G.A. Liu C.G. Ambs S. Cimmino A. Petrocca F. Visone R. Iorio M. Roldo C. Ferracin M. Prueitt R.L. Yanaihara N. Lanza G. Scarpa A. Vecchione A. Negrini M. Harris C.C. Croce C.M. A microRNA expression signature of human solid tumors defines cancer gene targets.Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 2257-2261Crossref PubMed Scopus (4941) Google Scholar, 4Eis P.S. Tam W. Sun L. Chadburn A. Li Z. Gomez M.F. Lund E. Dahlberg J.E. Accumulation of miR-155 and BIC RNA in human B cell lymphomas.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 3627-3632Crossref PubMed Scopus (1195) Google Scholar, 5Rutnam Z.J. Yang B.B. The involvement of microRNAs in malignant transformation.Histol. Histopathol. 2012; 27: 1263-1270PubMed Google Scholar, 6Yang W. Lee D.Y. Ben-David Y. The roles of microRNAs in tumorigenesis and angiogenesis.Int. J. Physiol. Pathophysiol. Pharmacol. 2011; 3: 140-155PubMed Google Scholar). Indeed, the microRNA let-7 has been found to regulate tumor cell self-renewal, proliferation, and tumorigenesis (7Yu F. Yao H. Zhu P. Zhang X. Pan Q. Gong C. Huang Y. Hu X. Su F. Lieberman J. Song E. let-7 regulates self renewal and tumorigenicity of breast cancer cells.Cell. 2007; 131: 1109-1123Abstract Full Text Full Text PDF PubMed Scopus (1643) Google Scholar, 8Yang X. Rutnam Z.J. Jiao C. Wei D. Xie Y. Du J. Zhong L. Yang B.B. An anti-let-7 sponge decoys and decays endogenous let-7 functions.Cell Cycle. 2012; 11: 3097-3108Crossref PubMed Scopus (42) Google Scholar). Over the past few years, miRNAs have emerged as a prominent class of gene regulators (9Bartel D.P. MicroRNAs: genomics, biogenesis, mechanism, and function.Cell. 2004; 116: 281-297Abstract Full Text Full Text PDF PubMed Scopus (29438) Google Scholar). miRNAs are single-stranded RNAs of 18–24 nucleotides in length and are generated by an RNase III-type enzyme from an endogenous transcript that contains a hairpin structure (10Hutvágner G. Zamore P.D. A microRNA in a multiple-turnover RNAi enzyme complex.Science. 2002; 297: 2056-2060Crossref PubMed Scopus (1636) Google Scholar, 11Lund E. Güttinger S. Calado A. Dahlberg J.E. Kutay U. Nuclear export of microRNA precursors.Science. 2004; 303: 95-98Crossref PubMed Scopus (2065) Google Scholar). In animals, miRNAs initially are transcribed from genomic DNA to produce long primary transcripts (pri-miRNAs), which are processed by the RNase III-type enzyme Drosha to produce precursor miRNAs (pre-miRNAs) 2The abbreviations used are: pre-miRNAprecursor microRNAmiRmicroRNASPside population. in the nucleus (12Lee Y. Ahn C. Han J. Choi H. Kim J. Yim J. Lee J. Provost P. Rådmark O. Kim S. Kim V.N. The nuclear RNase III Drosha initiates microRNA processing.Nature. 2003; 425: 415-419Crossref PubMed Scopus (3969) Google Scholar). Pre-miRNAs are then trans-located by exportin-5 to the cytoplasm (13Zeng Y. Cullen B.R. Structural requirements for pre-microRNA binding and nuclear export by Exportin 5.Nucleic Acids Res. 2004; 32: 4776-4785Crossref PubMed Scopus (360) Google Scholar). In the cytoplasm, pre-miRNAs are subjected to secondary processing by Dicer, a cytoplasmic RNase III-type enzyme (14Lee Y.S. Nakahara K. Pham J.W. Kim K. He Z. Sontheimer E.J. Carthew R.W. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways.Cell. 2004; 117: 69-81Abstract Full Text Full Text PDF PubMed Scopus (1005) Google Scholar, 15Mansfield J.H. Harfe B.D. Nissen R. Obenauer J. Srineel J. Chaudhuri A. Farzan-Kashani R. Zuker M. Pasquinelli A.E. Ruvkun G. Sharp P.A. Tabin C.J. McManus M.T. MicroRNA-responsive “sensor” transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression.Nat. Genet. 2004; 36: 1079-1083Crossref PubMed Scopus (368) Google Scholar), where miRNAs function as guide molecules in post-transcriptional gene silencing by partially pairing with the 3′-untranslated region (UTR) of the target mRNAs, resulting in translational repression (16Seitz H. Youngson N. Lin S.P. Dalbert S. Paulsen M. Bachellerie J.P. Ferguson-Smith A.C. Cavaillé J. Imprinted microRNA genes transcribed antisense to a reciprocally imprinted retrotransposon-like gene.Nat. Genet. 2003; 34: 261-262Crossref PubMed Scopus (288) Google Scholar). By silencing various target mRNAs, miRNAs have key roles in diverse regulatory pathways, including control of development (17Shan S.W. Lee D.Y. Deng Z. Shatseva T. Jeyapalan Z. Du W.W. Zhang Y. Xuan J.W. Yee S.P. Siragam V. Yang B.B. MicroRNA MiR-17 retards tissue growth and represses fibronectin expression.Nat. Cell Biol. 2009; 11: 1031-1038Crossref PubMed Scopus (182) Google Scholar), cell differentiation (18Kahai S. Lee S.C. Lee D.Y. Yang J. Li M. Wang C. Zhang Y. Peng C. Yang B.B. MicroRNA miR-378 regulates nephronectin expression modulating osteoblast differentiation by targeting GalNT7.PLoS ONE 4. 2009; 10e7535 Crossref Scopus (144) Google Scholar, 19Wang C.H. Lee D.Y. Deng Z. Jeyapalan Z. Lee S.C. Kahai S. Lu W.Y. Zhang Y. Yang B.B. MicroRNA miR-328 regulates zonation morphogenesis by targeting CD44 expression.PLoS One. 2008; 3e2420 Crossref PubMed Scopus (88) Google Scholar), survival (20Fang L. Du W.W. Yang W. Rutnam Z.J. Peng C. Li H. O'Malley Y.Q. Askeland R.W. Sugg S. Liu M. Mehta T. Deng Z. Yang B.B. HYPERLINK enhances angiogenesis and metastasis by targeting LATS2.Cell Cycle. 2012; 30: 23Google Scholar, 21Chan J.A. Krichevsky A.M. Kosik K.S. MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells.Cancer Res. 2005; 65: 6029-6033Crossref PubMed Scopus (2228) Google Scholar), cell proliferation (22Shatseva T. Lee D.Y. Deng Z. Yang B.B. MicroRNA miR-199a-3p regulates cell proliferation and survival by targeting caveolin-2.J. Cell Sci. 2011; 124: 2826-2836Crossref PubMed Scopus (130) Google Scholar), division (23Croce C.M. Calin G.A. miRNAs, cancer, and stem cell division.Cell. 2005; 122: 6-7Abstract Full Text Full Text PDF PubMed Scopus (1214) Google Scholar), protein secretion (24Mello C.C. Czech M.P. Micromanaging insulin secretion.Nat. Med. 2004; 10: 1297-1298Crossref PubMed Scopus (21) Google Scholar), and viral infection (25Chellappan P. Vanitharani R. Fauquet C.M. MicroRNA-binding viral protein interferes with Arabidopsis development.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 10381-10386Crossref PubMed Scopus (176) Google Scholar). Most importantly, miRNAs have been known to play roles in cancer development (26Ye G. Fu G. Cui S. Zhao S. Bernaudo S. Bai Y. Ding Y. Zhang Y. Yang B.B. Peng C. MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J. Cell Sci. 2011; 124: 359-368Crossref PubMed Scopus (125) Google Scholar, 27Negrini M. Ferracin M. Sabbioni S. Croce C.M. MicroRNAs in human cancer: from research to therapy.J. Cell Sci. 2007; 120: 1833-1840Crossref PubMed Scopus (209) Google Scholar, 28Fang L. Deng Z. Shatseva T. Yang J. Peng C. Du W.W. Yee A.J. Ang L.C. He C. Shan S.W. Yang B.B. MicroRNA miR-93 promotes tumor growth and angiogenesis by targeting integrin-β8.Oncogene. 2011; 30: 806-821Crossref PubMed Scopus (259) Google Scholar). precursor microRNA microRNA side population. Sox2 is a transcription factor with fundamental importance in the maintenance of the early, pluripotent stem cells of the epiblast (29Avilion A.A. Nicolis S.K. Pevny L.H. Perez L. Vivian N. Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function.Genes Dev. 2003; 17: 126-140Crossref PubMed Scopus (1791) Google Scholar). It is highly expressed in neural stem cells, where it maintains the neural stem cell properties (30Suh H. Consiglio A. Ray J. Sawai T. D'Amour K.A. Gage F.H. In vivo fate analysis reveals the multipotent and self-renewal capacities of Sox2+ neural stem cells in the adult hippocampus.Cell Stem Cell. 2007; 1: 515-528Abstract Full Text Full Text PDF PubMed Scopus (621) Google Scholar, 31Graham V. Khudyakov J. Ellis P. Pevny L. SOX2 functions to maintain neural progenitor identity.Neuron. 2003; 39: 749-765Abstract Full Text Full Text PDF PubMed Scopus (996) Google Scholar). Sox2 is also required to maintain neural stem cells in the eyes and brain and facilitates neuronal differentiation (32Favaro E. Ramachandran A. McCormick R. Gee H. Blancher C. Crosby M. Devlin C. Blick C. Buffa F. Li J.L. Vojnovic B. Pires das Neves R. Glazer P. Iborra F. Ivan M. Ragoussis J. Harris A.L. MicroRNA-210 regulates mitochondrial free radical response to hypoxia and Krebs cycle in cancer cells by targeting iron-sulfur cluster protein ISCU.PLoS One. 2010; 5e10345 Crossref PubMed Scopus (263) Google Scholar). By acting together with other transcription factors, Sox2 can re-establish pluripotency in terminally differentiated cells, resulting in reprogramming them to become pluripotent stem cells for further differentiation (33Nakajima N. Takahashi T. Kitamura R. Isodono K. Asada S. Ueyama T. Matsubara H. Oh H. MicroRNA-1 facilitates skeletal myogenic differentiation without affecting osteoblastic and adipogenic differentiation.Biochem. Biophys. Res. Commun. 2006; 350: 1006-1012Crossref PubMed Scopus (65) Google Scholar). Sox2 is also highly expressed in brain tumors (34Lee J. Kotliarova S. Kotliarov Y. Li A. Su Q. Donin N.M. Pastorino S. Purow B.W. Christopher N. Zhang W. Park J.K. Fine H.A. Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum-cultured cell lines.Cancer Cell. 2006; 9: 391-403Abstract Full Text Full Text PDF PubMed Scopus (1782) Google Scholar). Silencing of Sox2 in human glioblastoma-derived cultures decreases their abilities in cell proliferation and tumor formation (35Gangemi R.M. Griffero F. Marubbi D. Perera M. Capra M.C. Malatesta P. Ravetti G.L. Zona G.L. Daga A. Corte G. SOX2 silencing in glioblastoma tumor-initiating cells causes stop of proliferation and loss of tumorigenicity.Stem Cells. 2009; 27: 40-48Crossref PubMed Scopus (449) Google Scholar). Previous studies have shown that miR-378 is expressed in a number of cancer cell lines (36Jiang J. Lee E.J. Gusev Y. Schmittgen T.D. Real-time expression profiling of microRNA precursors in human cancer cell lines.Nucleic Acids Res. 2005; 33: 5394-5403Crossref PubMed Scopus (451) Google Scholar), and it is involved in the expression of vascular endothelial growth factor (37Hua Z. Lv Q. Ye W. Wong C.K. Cai G. Gu D. Ji Y. Zhao C. Wang J. Yang B.B. Zhang Y. miRNA-directed regulation of VEGF and other angiogenic factors under hypoxia.PLoS ONE. 2006; 1: e116Crossref PubMed Scopus (548) Google Scholar). To understand the biological functions of miR-378, we have generated a miR-378 expression construct for functional studies. We demonstrated that tumor cell line U87, a human primary glioblastoma cell line, transfected with miR-378, formed larger tumors and blood vessels (38Lee D.Y. Deng Z. Wang C.H. Yang B.B. MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression.Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20350-20355Crossref PubMed Scopus (461) Google Scholar). In this study, we investigated the role of miR-378 in tumor cell self-renewal and chemoresistance. A miRNA construct expressing miR-378 was designed by our laboratory and generated as described previously (38Lee D.Y. Deng Z. Wang C.H. Yang B.B. MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression.Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20350-20355Crossref PubMed Scopus (461) Google Scholar). This plasmid has been used successfully in our laboratory. The control plasmid is the same except the pre-miR-378 sequence was replaced with a nonrelated sequence (atacagtactgtgataactgaagtttttggaaaagctttagttattaa), serving as a mock control. Cultured cells were fixed in 10% formalin and washed with distilled water for 10 min. The fixed cells were rinsed with 60% isopropyl alcohol and stained with freshly prepared Oil Red O solution for 15 min. After being rinsed with 60% isopropyl alcohol, the cells were briefly stained with aluminum hematoxylin and mounted in glycerine jelly. After being dried, the stained cells were examined under a light microscope. U87 cells transfected with miR-378, anti-miR-378, or mock were cultured in 96-well tissue culture plates to subconfluence. The medium was changed to serum-free DMEM, followed by treating the cells with 200 μl of oleic acid solution overnight. The medium was removed, and the cells were treated with 100 μl of fixative solution (10% formalin) at room temperature for 10 min, followed by microscopic examination. The cells were stained with Oil Red O as described above. After washing and drying completely, 100 μl of 100% isopropyl alcohol was added to each well. The cells were incubated at room temperature for 10 min to release Oil Red O from the staining. The extract solution was then transferred to another 96-well plate. The plate was subjected to absorbance measurement at a wavelength of 405 nm using a microplate reader (Bio-Tek Instruments Inc., Winooski, VT). The total RNA was extracted from ∼1 × 106 cells with the mirVana miRNA Isolation kit (Ambion) according to the manufacturer's instructions, followed by reverse transcription to synthesize cDNA using 1 μg of RNA. Successive PCR was performed by a QuantiMir-RT kit using 1 μl of cDNA as a template (Qiagen, miScript Reverse Transcription kit, catalog 218060; miScript Primer Assay, catalog 218411; miScript SYBR Green PCR kit, catalog 218073). The primers specific for mature miR-378 were purchased from Qiagen. The primers used as real-time PCR controls were human-U6RNAf and human-U6RNAr. Cells (1.5 × 105 cells/well or 2 × 105 cells/well) were seeded on 35-mm Petri dishes in DMEM containing 0–10% FBS and incubated for different time periods. The cell numbers were counted using trypan blue staining as described (39Sheng W. Wang G. Wang Y. Liang J. Wen J. Zheng P.S. Wu Y. Lee V. Slingerland J. Dumont D. Yang B.B. The roles of versican V1 and V2 isoforms in cell proliferation and apoptosis.Mol. Biol. Cell. 2005; 16: 1330-1340Crossref PubMed Scopus (132) Google Scholar). Cells were harvested from tissue culture dishes with trypsin and EDTA, washed, and suspended at a cell density of 1 × 106 cells/ml in DMEM containing 2% FCS. The cells were preincubated at 37 ºC for 10 min and then maintained at 37 ºC for 90 min with 2.5 μg/ml Hoechst 33342 dye, either alone or in combination with 50 μm verapamil. The number of SP cells were measured with flow cytometry by using a dual-wavelength for analysis (blue, 424–444 nm; red, 675 nm) after excitation with 350-nm UV light. Propidium iodide-positive (dead) cells, which were normally <15%, were excluded from the analysis. Colony formation was assessed using a method described previously (40Zheng P.S. Wen J. Ang L.C. Sheng W. Viloria-Petit A. Wang Y. Wu Y. Kerbel R.S. Yang B.B. Versican/PG-M G3 domain promotes tumor growth and angiogenesis.FASEB J. 2004; 18: 754-756Crossref PubMed Scopus (140) Google Scholar). In brief, 1 × 103 cells were mixed in 0.3% low melting agarose in DMEM supplemented with 10% FBS and plated on 0.66% agarose-coated 6-well tissue culture plates. Colony formation was monitored weekly. Four weeks after cell inoculation, colonies were examined and photographed. Six-week-old CD1 strain nude mice were injected with the miR-378- and mock-transfected U87 cell lines (1 × 106 cells/injection). Tumor growth was monitored weekly. Tumor volume (V) was estimated using a caliper by measuring the length (L) and width (W), where V = (L ×W2)/2. Tumors were removed for further analysis 40 days after the injection as described (40Zheng P.S. Wen J. Ang L.C. Sheng W. Viloria-Petit A. Wang Y. Wu Y. Kerbel R.S. Yang B.B. Versican/PG-M G3 domain promotes tumor growth and angiogenesis.FASEB J. 2004; 18: 754-756Crossref PubMed Scopus (140) Google Scholar). Human cancer specimens (n = 14) and paired noncancerous normal specimens (n = 14) were obtained from patients who had been subjected to the surgery for tumor removal at The Affiliated People's Hospital of Jiangsu University. All samples were immediately stored in liquid nitrogen until RNA extraction. We followed the guidelines of The Affiliated People's Hospital protocol including patient consent and specimen collection. Total RNA was isolated from the specimens with mirVana miRNA Isolation kit (Ambion) according to the manufacturer's instructions. The RNAs were subjected to first strand cDNA synthesis by reverse transcription using 1 μg of RNA. PCRs were then performed with QuantiMir-RT Kit using 2 μl of cDNA as template. To perform these experiments, other kits were also needed, including the miScript Reverse Transcription kit and miScript SYBR Green PCR kit. For real-time PCR of miR-378, the primer was specific for mature miR-378 (5′-ctcctgactccaggtcctgtgt). The primers for internal control U6 RNA were human-U6RNAf (5′-gtgctcgcttcggcagcacatatac) and human-U6RNAr (5′-aaaaatatggaacgcttcacgaatttg). The primers for Sox2 were Hom-Sox2–421F (5′-cgcccgcatgtacaacatgatgg) and Hom-Sox2–660R (5′-tcggcgcccaggcgcttgctgatc). The primers for internal control GAPDH were Hu-Gapdh421F (5′-aaggctggggctcatttgcag) and Hu-Gapdh720R (5′-gatgttctggagagccccgcg). The correlations between miR-378 and Sox2 (levels of miR-378 and Sox2 products) were assessed with Pearson's correlation coefficient using GraphPad Prism software. The results (mean values ±S.D.) of all experiments were subjected to statistical analysis by t test. The level of significance was set at p < 0.01 and p < 0.05. We have previously demonstrated that expression of miR-378 enhances tumor cell survival and promotes tumor growth and angiogenesis (38Lee D.Y. Deng Z. Wang C.H. Yang B.B. MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression.Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20350-20355Crossref PubMed Scopus (461) Google Scholar). In continuation of this study, we conducted analysis of miR-378 expression in 23 pairs of human cancer specimens and found that miR-378 levels were higher in the tumor areas than in the adjacent nontumor areas (Fig. 1a, left). We also isolated RNAs from the wax blocks of human breast carcinoma specimens and the adjacent tissues. Analysis of miR-378 levels indicated that the cancer tissues expressed significantly higher levels of miR-378 than the adjacent tissues (Fig. 1a, right). To understand how miR-378 affected cancer cell activities, we transfected miR-378 expression construct in U87 cells (Fig. 1b). The cells were cultured in Petri dishes and tissue culture plates without serum, and we observed that the miR-378-transfected cells could survive for a long period of time, characteristics of tumor stem cells (Fig. 1c). We have also tested whether the apoptosis-inducing agent C2-ceramide had any effect on miR-378-enhanced cell survival and observed that U87 cells transfected with miR-378 exhibited reduced cell death (Fig. 1d and supplemental Fig. S1a). To test the effect of endogenous miR-378, an antisense construct was developed which bound and arrested the functions of miR-378 (anti-miR-378). Expression of anti-miR-378 reduced cell survival significantly (Fig. 1e and supplemental Fig. S1b). In colony formation assays, we detected more colonies with larger sizes formed by the miR-378-expressing cells compared with the control (Fig. 1f). In single-cell culture, we found that the miR-378-transfected cells could formed larger colonies than the mock-transfected cells (Fig. 1g, upper). When the colonies obtained from the single-cell culture were passed to new wells, the miR-378-transfected cells could form large new colonies, but most of the mock-transfected cells died (Fig. 1g, lower). To examine whether or not the cells that formed colonies were those that expressed high levels of miR-378 and had tumor stem cell properties, we isolated cells from single colonies. Analysis of miRNA levels indicated that the cells isolated from the single colony expressed significantly higher levels of miR-378 compared with cells transfected with miR-378, but selected with flow cytometry thus containing a mix of cell population called miR-378 mix or miR-378M, or with a control vector (Fig. 2a). We tested whether there is a correlation between miR-378 expression and stem cell-associated properties. Cells expressing low and high levels of miR-378 were cultured in serum-free medium in Petri dishes for 6 days. Examination of cell survival indicated that the cells expressing higher levels of miR-378 showed higher rates of survival (Fig. 2b and supplemental Fig. 1c). When being cultured in tissue culture plates, the cells expressing higher levels of miR-378 also displayed higher rates of survival (supplemental Fig. 1d). The cells were also cultured in soft agar for colony formation assays. Cells expressing miR-378 formed significantly more colonies than the mock control (Fig. 2c). The cells expressing higher levels of miR-378 formed more colonies than the cells expressing lower levels of miR-378. The colonies in the groups expressing miR-378 were much larger than the ones in the control group. To further confirm the stem-like properties, we cultured the cells in sphere formation medium and found that the miR-378-expressing cells formed greater number of spheres with larger sizes than the mock control (Fig. 2d). The cell expressing higher levels of miR-378 (miR-378C) formed larger spheres than the cell expressing lower levels of miR-378 (miR-378M). After long term culture, the spheres were able to survive and continue to grow (Fig. 2e). This is a normal process of stem cell differentiation. After long term culture as a monolayer, these cells obtained less stem-like phenotype. Our results suggest that miR-378 has dose-dependent effect of the stemness of tumor stem cells. It has been reported that tumor stem cells have great capacity in tumor formation (1Li C. Heidt D.G. Dalerba P. Burant C.F. Zhang L. Adsay V. Wicha M. Clarke M.F. Simeone D.M. Identification of pancreatic cancer stem cells.Cancer Res. 2007; 67: 1030-1037Crossref PubMed Scopus (2752) Google Scholar, 2Ricci-Vitiani L. Lombardi D.G. Pilozzi E. Biffoni M. Todaro M. Peschle C. De Maria R. Identification and expansion of human colon-cancer-initiating cells.Nature. 2007; 445: 111-115Crossref PubMed Scopus (3400) Google Scholar, 7Yu F. Yao H. Zhu P. Zhang X. Pan Q. Gong C. Huang Y. Hu X. Su F. Lieberman J. Song E. let-7 regulates self renewal and tumorigenicity of breast cancer cells.Cell. 2007; 131: 1109-1123Abstract Full Text Full Text PDF PubMed Scopus (1643) Google Scholar, 41Collins R.E. Cheng X. Structural domains in RNAi.FEBS Lett. 2005; 579: 5841-5849Crossref PubMed Scopus (52) Google Scholar, 42Laguette M.J. Abrahams Y. Prince S. Collins M. Sequence variants within the 3′-UTR of the COL5A1 gene alters mRNA stability: implications for musculoskeletal soft tissue injuries.Matrix Biol. 2011; 30: 338-345Crossref PubMed Scopus (67) Google Scholar). To test whether or not the colony derived from the single cell could form bigger tumors, we tested tumorigenic capacity of the three types of cells including miR-378M, miR-378C, and mock by injecting the cells into nude mice subcutaneously. Tumor incidence was examined 40 days after the injection. Due to injection of low cell number, the mock-transfected cells did not form visible tumors, whereas the miR-378M cells formed tumors with medium sizes and the miR-378C cells formed large tumors (Fig. 3a). Because the parental U87 cells form tumors slowly, it normally takes 4–5 weeks to form small tumors by injecting 1 × 107 cells/mouse. It is expected that 1 × 106 cells would not form visible sizes of tumors. This is in agreement with our previous report that miR-378 expression promotes tumor growth (38Lee D.Y. Deng Z. Wang C.H. Yang B.B. MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression.Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20350-20355Crossref PubMed Scopus (461) Google Scholar). To further understand the effect of miR-378 on tumor stem cell behaviors, we isolated miR-378-transfected cells from the tumors formed in the nude mice by digesting the miR-378C-formed tumor tissues with collagenase and maintaining in medium containing G418. Sensitivities of these cells along with miR-378M, miR-378C, and mock cells to clinical chemodrugs docetaxel and epirubicin were tested. The cells isolated from the tumor tissues exhibited highest activity of resistance to both drugs (Fig. 3b). This is in agreement with the above results and previous report that tumor stem cells are more resistant to chemodrug treatment (7Yu F. Yao H. Zhu P. Zhang X. Pan Q. Gong C. Huang Y. Hu X. Su F. Lieberman J. Song E. let-7 regulates self renewal and tumorigenicity of breast cancer cells.Cell. 2007; 131: 1109-1123Abstract Full Text Full Text PDF PubMed Scopus (1643) Google Scholar). We then analyzed the levels of CD133, a marker of stem cells, and found that expression of miR-378 dramatically up-regulated CD133 levels (Fig. 4a, left). The experiments were repeated three times for statistical analysis and we observed a significant up-regulation of CD133 in the miR-378-transfected cells (Fig. 4a, right). Analysis of SP fraction with Hoechst 33342 dye-based technique has been used to isolate stem cells. To investigate the prevalence of SP cells, we stained the miR-378- and mock-transfected cells with Hoechst 33342 dye and identified the SP fractions by its characteristic fluorescent profile in dual-wavelength analysis. The miR-378-transfected cells contained higher percentage of SP cells than the mock-transfected cells (Fig. 4b, left). The experiments were repeated three times for statistical analysis. A significant difference was seen (Fig. 4b, right). All of our results above suggest that cells transfe" @default.
• W2007211948 created "2016-06-24" @default.
• W2007211948 creator A5006418581 @default.
• W2007211948 creator A5008516074 @default.
• W2007211948 creator A5014048532 @default.
• W2007211948 creator A5020923032 @default.
• W2007211948 creator A5028932344 @default.
• W2007211948 creator A5033584401 @default.
• W2007211948 creator A5035153981 @default.
• W2007211948 creator A5055726321 @default.
• W2007211948 creator A5061351930 @default.
• W2007211948 creator A5084645019 @default.
• W2007211948 date "2013-01-01" @default.
• W2007211948 modified "2023-10-12" @default.
• W2007211948 title "The Intermediate Filament Vimentin Mediates MicroRNA miR-378 Function in Cellular Self-renewal by Regulating the Expression of the Sox2 Transcription Factor" @default.
• W2007211948 cites W144423133 @default.
• W2007211948 cites W1967007963 @default.
• W2007211948 cites W1973492715 @default.
• W2007211948 cites W1977734166 @default.
• W2007211948 cites W1980269624 @default.
• W2007211948 cites W1981643394 @default.
• W2007211948 cites W1990373054 @default.
• W2007211948 cites W1999553354 @default.
• W2007211948 cites W2004453166 @default.
• W2007211948 cites W2006788460 @default.
• W2007211948 cites W2018671779 @default.
• W2007211948 cites W2019264784 @default.
• W2007211948 cites W2020458486 @default.
• W2007211948 cites W2020458511 @default.
• W2007211948 cites W2025635382 @default.
• W2007211948 cites W2029231546 @default.
• W2007211948 cites W2031482209 @default.
• W2007211948 cites W2035222904 @default.
• W2007211948 cites W2042066381 @default.
• W2007211948 cites W2044291869 @default.
• W2007211948 cites W2050066317 @default.
• W2007211948 cites W2050935187 @default.
• W2007211948 cites W2051883611 @default.
• W2007211948 cites W2053702192 @default.
• W2007211948 cites W2054608914 @default.
• W2007211948 cites W2059359776 @default.
• W2007211948 cites W2065977014 @default.
• W2007211948 cites W2069759108 @default.
• W2007211948 cites W2081620485 @default.
• W2007211948 cites W2084951237 @default.
• W2007211948 cites W2095834286 @default.
• W2007211948 cites W2099436279 @default.
• W2007211948 cites W2104610341 @default.
• W2007211948 cites W2105788966 @default.
• W2007211948 cites W2111783800 @default.
• W2007211948 cites W2112485709 @default.
• W2007211948 cites W2120785986 @default.
• W2007211948 cites W2124821475 @default.
• W2007211948 cites W2131596261 @default.
• W2007211948 cites W2135810600 @default.
• W2007211948 cites W2138708625 @default.
• W2007211948 cites W2149291473 @default.
• W2007211948 cites W2149385948 @default.
• W2007211948 cites W2153541828 @default.
• W2007211948 cites W2156121797 @default.
• W2007211948 cites W2169332120 @default.
• W2007211948 cites W2169529166 @default.
• W2007211948 cites W2302039093 @default.
• W2007211948 doi "https://doi.org/10.1074/jbc.m112.418830" @default.
• W2007211948 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4036292" @default.
• W2007211948 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/23135265" @default.
• W2007211948 hasPublicationYear "2013" @default.
• W2007211948 type Work @default.
• W2007211948 sameAs 2007211948 @default.
• W2007211948 citedByCount "45" @default.
• W2007211948 countsByYear W20072119482013 @default.
• W2007211948 countsByYear W20072119482014 @default.
• W2007211948 countsByYear W20072119482015 @default.
• W2007211948 countsByYear W20072119482016 @default.
• W2007211948 countsByYear W20072119482017 @default.
• W2007211948 countsByYear W20072119482018 @default.
• W2007211948 countsByYear W20072119482019 @default.
• W2007211948 countsByYear W20072119482020 @default.
• W2007211948 countsByYear W20072119482021 @default.
• W2007211948 countsByYear W20072119482022 @default.
• W2007211948 crossrefType "journal-article" @default.
• W2007211948 hasAuthorship W2007211948A5006418581 @default.
• W2007211948 hasAuthorship W2007211948A5008516074 @default.
• W2007211948 hasAuthorship W2007211948A5014048532 @default.
• W2007211948 hasAuthorship W2007211948A5020923032 @default.
• W2007211948 hasAuthorship W2007211948A5028932344 @default.
• W2007211948 hasAuthorship W2007211948A5033584401 @default.
• W2007211948 hasAuthorship W2007211948A5035153981 @default.
• W2007211948 hasAuthorship W2007211948A5055726321 @default.
• W2007211948 hasAuthorship W2007211948A5061351930 @default.
• W2007211948 hasAuthorship W2007211948A5084645019 @default.
• W2007211948 hasBestOaLocation W20072119481 @default.
• W2007211948 hasConcept C104317684 @default.
• W2007211948 hasConcept C14036430 @default.
• W2007211948 hasConcept C14228908 @default.
• W2007211948 hasConcept C142669718 @default.
• W2007211948 hasConcept C145059251 @default.
• W2007211948 hasConcept C147447768 @default.

• next