FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007252917> ?p ?o ?g. }

• W2007252917 endingPage "578" @default.
• W2007252917 startingPage "568" @default.
• W2007252917 abstract "Background & Aims: Enteric nematode infection induces a smooth muscle hypercontractility that depends on interleukin (IL)-4 and IL-13 activation of the signal transducer and activator of transcription (STAT) 6. Serotonin (5-HT) is involved in the physiologic regulation of gut function. The present study investigated the contribution of 5-HT and its receptors in nematode-induced intestinal smooth muscle hypercontractility.Methods: Mice were infected with Nippostrongylus brasiliensis (N brasiliensis) or Heligmosomoides polygyrus (H polygyrus) or injected intravenously with IL-13. Segments of jejunum were suspended in organ baths, and smooth muscle responses to 5-HT were determined in the presence or absence of specific 5-HT antagonists. IL-4, IL-13, and 5-HT receptor messenger RNA expressions were determined by real-time quantitative polymerase chain reaction.Results: 5-HT evoked a modest contraction of smooth muscle in wild-type (WT) mice that was unaltered by the 5-HT2A antagonist ketanserin. N brasiliensis infection induced a smooth muscle hypercontractility to 5-HT that was abolished by 5-HT2A antagonists but not by other 5-HT antagonists. Infection-induced up-regulation of 5-HT2A expression was correlated with the smooth muscle hypercontractility to 5-HT. The infection-induced up-regulation of 5-HT2A in WT mice was observed also in IL-4−/− mice but was not seen in IL-13−/− or STAT6−/− mice. In addition, smooth muscle responses to 5-HT and 5-HT2A expression in WT mice were also enhanced by IL-13 or H polygyrus infection.Conclusions: These data show that 5-HT2A is one of the molecules downstream from STAT6 activation that mediates changes in smooth muscle function. 5-HT2A represents a novel therapeutic target for modulating immune-mediated effects on intestinal motility. Background & Aims: Enteric nematode infection induces a smooth muscle hypercontractility that depends on interleukin (IL)-4 and IL-13 activation of the signal transducer and activator of transcription (STAT) 6. Serotonin (5-HT) is involved in the physiologic regulation of gut function. The present study investigated the contribution of 5-HT and its receptors in nematode-induced intestinal smooth muscle hypercontractility. Methods: Mice were infected with Nippostrongylus brasiliensis (N brasiliensis) or Heligmosomoides polygyrus (H polygyrus) or injected intravenously with IL-13. Segments of jejunum were suspended in organ baths, and smooth muscle responses to 5-HT were determined in the presence or absence of specific 5-HT antagonists. IL-4, IL-13, and 5-HT receptor messenger RNA expressions were determined by real-time quantitative polymerase chain reaction. Results: 5-HT evoked a modest contraction of smooth muscle in wild-type (WT) mice that was unaltered by the 5-HT2A antagonist ketanserin. N brasiliensis infection induced a smooth muscle hypercontractility to 5-HT that was abolished by 5-HT2A antagonists but not by other 5-HT antagonists. Infection-induced up-regulation of 5-HT2A expression was correlated with the smooth muscle hypercontractility to 5-HT. The infection-induced up-regulation of 5-HT2A in WT mice was observed also in IL-4−/− mice but was not seen in IL-13−/− or STAT6−/− mice. In addition, smooth muscle responses to 5-HT and 5-HT2A expression in WT mice were also enhanced by IL-13 or H polygyrus infection. Conclusions: These data show that 5-HT2A is one of the molecules downstream from STAT6 activation that mediates changes in smooth muscle function. 5-HT2A represents a novel therapeutic target for modulating immune-mediated effects on intestinal motility. Host defense mechanisms have evolved to combat a multitude of pathogens, and the nature of the response can be characterized, in part, by the cytokine profile elicited. Type 2 cytokine responses, generated against extracellular parasites such as gastrointestinal nematodes, feature increased production of the type 2 T-helper cell (Th2) cytokines interleukin (IL)-4 and IL-13, which play a critical role in worm expulsion.1Finkelman F.D. Shea-Donohue T. Goldhill J. Sullivan C.A. Morris S.C. Madden K.B. Gause W.C. Urban Jr, J.F. Cytokine regulation of host defense against parasitic gastrointestinal nematodes lessons from studies with rodent models.Annu Rev Immunol. 1997; 15: 505-533Crossref PubMed Scopus (579) Google Scholar, 2Finkelman F.D. Wynn T.A. Donaldson D.D. Urban J.F. The role of IL-13 in helminth-induced inflammation and protective immunity against nematode infections.Curr Opin Immunol. 1999; 11: 420-426Crossref PubMed Scopus (113) Google Scholar, 3Urban Jr, J.F. Noben-Trauth N. Donaldson D.D. Madden K.B. Morris S.C. Collins M. Finkelman F.D. IL-13, IL-4Rα, and Stat6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis.Immunity. 1998; 8: 255-264Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar Infection with gastrointestinal nematodes also exerts profound effects on the physiologic responses of the host. Helminth infection induces an increase in intraluminal fluid4Madden K.B. Whitman L. Sullivan C. Gause W.C. Urban Jr, J.F. Katona I.M. Finkelman F.D. Shea-Donohue T. Role of STAT6 and mast cells in IL-4- and IL-13-induced alterations in murine intestinal epithelial cell function.J Immunol. 2002; 169: 4417-4422Crossref PubMed Scopus (142) Google Scholar, 5Madden K.B. Yeung K.A. Zhao A. Gause W.C. Finkelman F.D. Katona I.M. Urban Jr, J.F. Shea-Donohue T. Enteric nematodes induce stereotypic STAT6-dependent alterations in intestinal epithelial cell function.J Immunol. 2004; 172: 5616-5621Crossref PubMed Scopus (78) Google Scholar and hypercontractility of intestinal smooth muscle,6Akiho H. Blennerhassett P. Deng Y. Collins S.M. Role of IL-4, IL-13, and STAT6 in inflammation-induced hypercontractility of murine smooth muscle cells.Am J Physiol Gastrointest Liver Physiol. 2002; 282: G226-G232PubMed Google Scholar, 7Zhao A. McDermott J. Urban Jr, J.F. Gause W. Madden K.B. Yeung K.A. Morris S.C. Finkelman F.D. Shea-Donohue T. Dependence of IL-4, IL-13, and nematode-induced alterations in murine small intestinal smooth muscle contractility on Stat6 and enteric nerves.J Immunol. 2003; 171: 948-954PubMed Google Scholar both of which depend on increased IL-4 and IL-13 production and receptor-mediated activation of the signal transducer and activator of transcription (STAT) 6-signaling pathway. We recently showed that nematode infection induces hyperresponsiveness to protease-activated receptor-1 (PAR-1), associated with STAT6-dependent up-regulation of PAR-1 expression.8Zhao A. Morimoto M. Dawson H. Elfrey J.E. Madden K.B. Gause W.C. Min B. Finkelman F.D. Urban Jr, J.F. Shea-Donohue T. Immune regulation of protease-activated receptor-1 expression in murine small intestine during Nippostrongylus brasiliensis infection.J Immunol. 2005; 175: 2563-2569Crossref PubMed Scopus (37) Google Scholar This observation raises the possibility that other molecules downstream of STAT6 activation, in addition to PAR-1, are involved in the functional response of the gut to infection.Serotonin (5-HT) is an important neurohumoral transmitter in both the central and peripheral nerve systems and impacts a number of central nervous system (CNS) functions including appetite, mood, and perception. The gut is the largest source of 5-HT and contains an abundance of 5-HT receptor subtypes, located on neurons, smooth muscle, and epithelial cells,9Gershon M.D. Review article serotonin receptors and transporters—roles in normal and abnormal gastrointestinal motility.Aliment Pharmacol Ther. 2004; 20: 3-14Crossref PubMed Scopus (435) Google Scholar, 10Gershon M.D. Serotonin and its implication for the management of irritable bowel syndrome.Rev Gastroenterol Disord. 2003; 3: S25-S34PubMed Google Scholar, 11Hansen M.B. Neurohumoral control of gastrointestinal motility.Physiol Res. 2003; 52: 1-30PubMed Google Scholar which are involved in the physiologic regulation of gut mucosal and smooth muscle function. Recent studies demonstrate alterations in 5-HT signaling in functional gastrointestinal disorders, such as irritable bowel syndrome (IBS), chronic constipation, diarrhea, and functional dyspepsia.12Spiller R.C. Jenkins D. Thornley J.P. Hebden J.M. Wright T. Skinner M. Neal K.R. Increased rectal mucosal enteroendocrine cells, T lymphocytes, and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome.Gut. 2000; 47: 804-811Crossref PubMed Scopus (996) Google Scholar For this reason, 5-HT has emerged as an important therapeutic target for a number of brain-gut pathologies, precipitating a tremendous interest in the role of 5-HT receptors in the regulation of gut function. Progress in this area, however, is complicated by the identification of at least 15 different receptors that are further classified into 7 receptor subtypes 5-HT1–5-HT7.11Hansen M.B. Neurohumoral control of gastrointestinal motility.Physiol Res. 2003; 52: 1-30PubMed Google Scholar With the exception of 5-HT3 receptors, which are ligand-gated ion channels, all belong to the superfamily of the G-protein-coupled receptors.11Hansen M.B. Neurohumoral control of gastrointestinal motility.Physiol Res. 2003; 52: 1-30PubMed Google Scholar 5-HT induces contraction or relaxation of smooth muscle depending on the receptor activated. 5-HT1, 5-HT2, 5-HT3, 5-HT4, and 5-HT7 are among the receptor subtypes implicated in the regulation of gut motility.Enteric nematode infection is characterized by smooth muscle hypercontractility.6Akiho H. Blennerhassett P. Deng Y. Collins S.M. Role of IL-4, IL-13, and STAT6 in inflammation-induced hypercontractility of murine smooth muscle cells.Am J Physiol Gastrointest Liver Physiol. 2002; 282: G226-G232PubMed Google Scholar, 7Zhao A. McDermott J. Urban Jr, J.F. Gause W. Madden K.B. Yeung K.A. Morris S.C. Finkelman F.D. Shea-Donohue T. Dependence of IL-4, IL-13, and nematode-induced alterations in murine small intestinal smooth muscle contractility on Stat6 and enteric nerves.J Immunol. 2003; 171: 948-954PubMed Google Scholar, 13Goldhill J. Morris S.C. Maliszewski C. Urban Jr, J.F. Funk C.D. Finkelman F.D. Shea-Donohue T. Interleukin-4 modulates cholinergic neural control of mouse small intestinal longitudinal muscle.Am J Physiol. 1997; 272: G1135-G1140PubMed Google Scholar We have hypothesized that serotonin and its receptors are involved in enteric nematode infection-induced intestinal smooth muscle hypercontractility and are among the molecules downstream from the Th2 cytokine-activated STAT6-signaling pathway cascade. To investigate this possibility, we evaluated (1) the effect of 5-HT on small intestinal smooth muscle contractility; (2) the effects of enteric nematode infection on 5-HT responses; (3) the contribution of 5-HT receptor subtypes in infection-induced alterations in 5-HT responses; and (4) the dependence of these responses on IL-4, IL-13, and STAT6. Results of these investigations demonstrate that infection-induced smooth muscle hypercontractility to 5-HT is associated with increased expression of 5-HT2A receptor messenger RNA (mRNA). These helminth-induced changes in 5-HT2A function and expression require IL-13-activation of the STAT6-signaling pathway.Materials and MethodsMiceBALB/c female wild-type (WT) mice were purchased from the Small Animal Division of the National Cancer Institute. STAT6-deficient (STAT6−/−) and IL-4-deficient (IL-4−/−) mice were obtained from the breeding colonies at the University of Cincinnati. IL-13-deficient (IL-13−/−) mice were obtained from the National Institutes of Health. These studies were conducted in accordance with principles set forth in the Guide for Care and Use of Laboratory Animals, Institute of Laboratory Animal Resources, National Research Council, Health and Human Services Publication (National Institutes of Health 85-23, revised 1996), and the Beltsville Animal Care and Use Committee, 2003.Administration of IL-13Mice (n = 5/group) were injected intravenously (IV) with 10 μg of saline or IL-13 daily for 7 days. The amount of cytokine administered was based on the observation that daily injection of immunocompetent BALB/c mice with this dose of IL-13 enhances worm expulsion.3Urban Jr, J.F. Noben-Trauth N. Donaldson D.D. Madden K.B. Morris S.C. Collins M. Finkelman F.D. IL-13, IL-4Rα, and Stat6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis.Immunity. 1998; 8: 255-264Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar All mice were studied 7 days after the initial injection.Nippostrongylus brasiliensis and Heligmosomoides polygyrus Infection and Worm ExpulsionEnteric nematode infections were described previously.7Zhao A. McDermott J. Urban Jr, J.F. Gause W. Madden K.B. Yeung K.A. Morris S.C. Finkelman F.D. Shea-Donohue T. Dependence of IL-4, IL-13, and nematode-induced alterations in murine small intestinal smooth muscle contractility on Stat6 and enteric nerves.J Immunol. 2003; 171: 948-954PubMed Google Scholar Briefly, infective, third-stage larvae of N brasiliensis (L3) (specimens on file at the US National Parasite Collection, US National Helminthological Collection, Collection 81930, Beltsville, MD) were propagated and stored at room temperature in fecal/charcoal/peat moss culture plates until used. For N brasiliensis infection, groups of WT, STAT6−/−, IL-4−/−, or IL-13−/− mice were inoculated subcutaneously with 500 L3 and studied 9 days later. For H polygyrus infection, separate groups of WT mice were inoculated orally with 200 H polygyrus L3 using a ball-tipped feeding needle. A primary H polygyrus infection is chronic, and, therefore, mice were cured with the antihelminthic drug, pyrantel tartrate, 3 weeks after inoculation. A secondary infection with H polygyrus induces a memory response with elevated Th2 response and worm clearance. Cured mice, therefore, were reinfected orally with 200 H polygyrus L3 (day 0) 20 days after the antihelminthic treatment. All mice were studied 12 days after the second H polygyrus inoculation. The timing of the studies following infection with N brasiliensis or H polygyrus correlates with the time of the maximal effects on gut function and coincides with worm expulsion.7Zhao A. McDermott J. Urban Jr, J.F. Gause W. Madden K.B. Yeung K.A. Morris S.C. Finkelman F.D. Shea-Donohue T. Dependence of IL-4, IL-13, and nematode-induced alterations in murine small intestinal smooth muscle contractility on Stat6 and enteric nerves.J Immunol. 2003; 171: 948-954PubMed Google Scholar, 14Shea-Donohue T. Sullivan C. Finkelman F.D. Madden K.B. Morris S.C. Goldhill J. Pineiro-Carrero V. Urban Jr, J.F. The role of IL-4 in Heligmosomoides polygyrus-induced alterations in murine intestinal epithelial cell function.J Immunol. 2001; 167: 2234-2239Crossref PubMed Scopus (118) Google Scholar Appropriate age-matched controls were performed for each infection.To study the time course and the long-term effect of infection on 5-HT response, a total of 30 WT mice were infected with N brasiliensis, and groups of mice (n = 5) were killed at days 5, 7, 9, 14, 21, and 28 postinfection (PI). Previously, we showed that expression of IL-4 and IL-13 is elevated at day 5, peak at day 7, and begin to decline at day 9.8Zhao A. Morimoto M. Dawson H. Elfrey J.E. Madden K.B. Gause W.C. Min B. Finkelman F.D. Urban Jr, J.F. Shea-Donohue T. Immune regulation of protease-activated receptor-1 expression in murine small intestine during Nippostrongylus brasiliensis infection.J Immunol. 2005; 175: 2563-2569Crossref PubMed Scopus (37) Google Scholar Thus, peaking cytokine expression at day 7 precedes the maximal effects on function, which occur on day 9. Another separate group of mice (n = 5) was used as control for this study. Intestinal strips were prepared for studies on smooth muscle function, and tissue was collected for the measurement of the mRNA expression of IL-4, IL-13, and 5-HT2A.We also performed experiments to investigate the effects of the 5-HT2A antagonist ketanserin on worm expulsion. Two groups (n = 5) of WT mice were inoculated with 500 L3 N brasiliensis. One group of infected mice received 0.1 mL ketanserin (IV; 10 mg/kg, 5% DMSO in saline)15De Bie J.J. Henricks P.A. Cruikshank W.W. Hofman G. Jonker E.H. Nijkamp F.P. Van Oosterhout A.J. Modulation of airway hyperresponsiveness and eosinophilia by selective histamine and 5-HT receptor antagonists in a mouse model of allergic asthma.Br J Pharmacol. 1998; 124: 857-864Crossref PubMed Scopus (60) Google Scholar, 16Parmentier H.K. de Vries C. Ruitenberg E.J. van Loveren H. Involvement of serotonin in intestinal mastocytopoiesis and inflammation during a Trichinella spiralis infection in mice.Int Arch Allergy Appl Immunol. 1987; 83: 31-38Crossref PubMed Google Scholar, 17Michiels M. Monbaliu J. Meuldermans W. Hendriks R. Geerts R. Woestenborghs R. Heykants J. Pharmacokinetics and tissue distribution of ketanserin in rat, rabbit and dog.Arzneimittelforschung. 1988; 38: 775-784PubMed Google Scholar, 18Meuldermans W. Hendrickx J. Lauwers W. Swysen E. Hurkmans R. Knaeps F. Woestenborghs R. Heykants J. Excretion and biotransformation of ketanserin after oral and intravenous administration in rats and dogs.Drug Metab Dispos. 1984; 12: 772-781PubMed Google Scholar daily from day 4 to day 10 PI. The second group of mice was given 0.1 mL of vehicle (5% DMSO in saline). In these 2 groups, mice were killed 11 days after inoculation, and adult worm numbers and egg production were determined as described previously.3Urban Jr, J.F. Noben-Trauth N. Donaldson D.D. Madden K.B. Morris S.C. Collins M. Finkelman F.D. IL-13, IL-4Rα, and Stat6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis.Immunity. 1998; 8: 255-264Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar Studies were performed on day 11 to determine whether kentanserin impaired worm clearance.In Vitro ContractilityOne-centimeter segments of jejunum were flushed of their intestinal contents, suspended longitudinally in individual 8 mL-organ baths, and maintained in oxygenated Kreb’s solution at 37°C. One end of the tissue was attached to an isometric tension transducer (Model FT03; Grass Medical Instruments, Quincy, MA) and the other to the bottom of the bath. Tissues were stretched to a load of 9.9 mN (2 g). Previous experiments showed that this load stretched tissues to their optimal length for active contraction.7Zhao A. McDermott J. Urban Jr, J.F. Gause W. Madden K.B. Yeung K.A. Morris S.C. Finkelman F.D. Shea-Donohue T. Dependence of IL-4, IL-13, and nematode-induced alterations in murine small intestinal smooth muscle contractility on Stat6 and enteric nerves.J Immunol. 2003; 171: 948-954PubMed Google Scholar Tissues were allowed to equilibrate for at least 30 minutes in Kreb’s buffer solution before study, and the bath solution was replaced every 10 minutes. Tension was recorded using a Grass model 79 polygraph (Grass Medical Instruments) and expressed as force per cross-sectional area.19Zhao A. Bossone C. Pineiro-Carrero V. Shea-Donohue T. Colitis-induced alterations in adrenergic control of circular smooth muscle in vitro in rats.J Pharmacol Exp Ther. 2001; 299: 768-774PubMed Google Scholar After equilibration, tissues from WT control or infected mice were challenged with 5-HT (100 nmol/L–1 mmol/L) to determine concentration-dependent responses. Because there is a rapid desensitization of responses to 5-HT, 5-HT was applied only once to each tissue preparation. To determine the effect of various inhibitors or 5-HT antagonists on intestinal smooth muscle responses to 5-HT, intestinal strips from WT mice were challenged a single time with 100 μmol/L of 5-HT, the concentration found to produce the maximum contraction, or 1 μmol/L of 5-HT, a concentration closer to the potential physiologic range, in the presence or absence of the neurotoxin tetrodotoxin (TTX, 1 μmol/L); the muscarinic receptor antagonist atropine (2 μmol/L); or the specific 5-HT receptor antagonists (1 μmol/L) SB-224289 (5-HT1B) or 5-HTP-DP (5-HT1P, 10 μmol/L, a generous gift from Dr Hadassah Tamir, Department of Psychiatry, New York State Psychiatric Institute, NY), ketanserin (5-HT2A), sarpogrelate (5-HT2A, Mitsubishi Pharma Co., Japan), SB-206553 (5-HT2C), ondansetron (5-HT3), SDZ-205557 (5-HT4), or SB-269970 (5-HT7). Tissues were incubated with inhibitors or antagonists for 30 minutes before the application of 5-HT. The amplitude of spontaneous contractions was measured over a 2-minute period immediately before and again 10 minutes after addition of ketanserin. In addition, intestinal smooth muscle responses to the specific 5-HT2A agonist α-methyl-5-HT were determined in WT control or N brasiliensis-infected mice. Contractions to acetylcholine (100 μmol/L) and substance P (1 μmol/L) were used as controls.RNA Extraction, cDNA Synthesis and Real-Time Quantitative Polymerase Chain ReactionTotal RNA was extracted with TRIzol reagent (Invitrogen, Grand Island, NY) as per the manufacturer’s instructions. RNA integrity, quantity, and genomic DNA contamination were assessed using the Agilent Bioanalyzer 2100 and RNA 6000 Labchip kit (Agilent Technologies, Palo Alto, CA). Only those RNA samples with 28S/18S ratios between 1.5 to 2 and no DNA contamination were studied further. RNA samples (2 μg) were reverse transcribed to complementary DNA (cDNA) using the First Strand cDNA Synthase Kit (MBI Fermentas, Hanover, MD) with random hexamer primer.Real-time quantitative PCR was performed on an iCycler detection system (Bio-Rad, Hercules, CA). Primer sequences were designed by using Beacon Designer 4.0 (Premier Biosoft International, Palo Alto, CA), and synthesized by the Biopolymer Laboratory of the University of Maryland. The primer sequences for IL-4 and IL-13 were described previously8Zhao A. Morimoto M. Dawson H. Elfrey J.E. Madden K.B. Gause W.C. Min B. Finkelman F.D. Urban Jr, J.F. Shea-Donohue T. Immune regulation of protease-activated receptor-1 expression in murine small intestine during Nippostrongylus brasiliensis infection.J Immunol. 2005; 175: 2563-2569Crossref PubMed Scopus (37) Google Scholar and 5-HT receptor subtypes are listed in Table 1. PCR was performed in a 25-μL volume using SYBR green Supermix (Bio-Rad). Amplification conditions were 95°C for 3 minutes, 50 cycles of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 20 seconds. The fold changes in mRNA expression for IL-4, IL-13, or 5-HT receptor subtypes were relative to the respective vehicle groups of mice after normalization to 18S rRNA. The choice of an internal control to normalize the expression of the gene of interest is critical to the interpretation of experimental results. We selected 18S rRNA for the internal standard in our real-time PCR based on our preliminary studies showing that there were no significant differences in the 18S rRNA level among the different groups of samples (infected and uninfected). In addition, a search of the literature indicates that 18S rRNA is among the most common endogenous standards currently in use.20Aerts J.L. Gonzales M.I. Topalian S.L. Selection of appropriate control genes to assess expression of tumor antigens using real-time RT-PCR.Biotechniques. 2004; 36 (88, 90–91): 84-86Crossref PubMed Google ScholarTable 1Primer Sequences for Real-Time Quantitative PCRGenePrimer sequences (5′ to 3′)5-HT1AForward, TCGCTCACTTGGCTCATTGReverse, CGTGGTCCTTGCTGATGG5-HT1BForward, ACCTCTCACCAACCTCTCCReverse, GTCCGATACACCGTAGCG5-HT2AForward, ACCCCATTCACCATAGCCGReverse, CGAATCATCCTGTAGCCCG5-HT2BForward, TTCTCTTTTCAACTGCCTCCATCReverse, ATTAACCATACCACTGTAATCTTGATG5-HT2CForward, GAATAATACTACCTGCGTGCTCReverse, AGCGTTCTCTTCCTCATCAC5-HT3AForward, TCTGGGTCCCTGACATTCTCAReverse, ATGCACGTACACATAAGGAATGTTC5-HT3BForward, CTTCAGGGTCAACATGTCTGATGAReverse, TGGATTTGGATAAACTGAGAACCA5-HT4Forward, CCATGTTTATATCTTTTCTCCCCATAATReverse, TTAGAGTTGTGGCTGAATTTCCTTT5-HT7Forward, TGTCTGTGGCTGGGCTATGCReverse, GGAGTAGGCTACGATAGGTGGTC Open table in a new tab Solutions and DrugsKreb’s buffer contained (in mmol/L) 4.74 KCl, 2.54 CaCl2, 118.5 NaCl, 1.19 NaH2PO4, 1.19 MgSO4, 25.0 NaHCO3, and 11.0 glucose. All drugs were obtained from Sigma Chemical Co. (St. Louis, MO) unless indicated otherwise. On the day of the experiment, 5-HT was dissolved in water, and appropriate dilutions were made. Stock solutions were prepared as follows: ketanserin, SB-206553, ondansetron, SDZ-205557, and SB-269970 were dissolved in distilled water; SB-224289 and 5-HTP-DP were dissolved in 20% DMSO; and sarpogrelate was dissolved in DMSO and stored at −80°C in aliquots.Data AnalysisAgonist responses were fitted to sigmoid curves (Graphpad, San Diego, CA). Statistical analysis was performed using 1-way ANOVA followed by Tukey test to compare the responses and mRNA expression among the different treatment groups. Appropriate vehicle-, time-, and age-matched controls were performed for each group.ResultsNematode Infection Induced a Hypercontractility to 5-HT5-HT evoked a modest, concentration-dependent contraction (Figure 1A and 1C) in WT control mice with a maximal response at the concentration of 100 μmol/L. We found that the response to 5-HT undergoes a significant desensitization, especially at high concentrations (>10 μmol/L), with a second challenge of 100 μmol/L producing less than 50% of the response from previous challenging, even after 20 minutes. For these reasons, 5-HT was applied only once to each tissue preparation during these experiments.5-HT-evoked contraction was increased significantly by N brasiliensis infection (Figure 1B and C). When compared with controls, infection increased both the sensitivity (WT-VEH vs WT-Nb; EC50 = 5.0 μmol/L vs 1.8 μmol/L; P < .05) and the maximal amplitude of the response (WT-VEH vs WT-Nb; 5717 ± 410 vs 16,571 ± 1523 mN/cm2; P < .05) to 5-HT. The amplitude of the contraction to 100 μmol/L 5-HT in uninfected mice was ∼40% of the response induced by 100 μmol/L of acetylcholine (5-HT vs acetylcholine; 5717 ± 410 vs 13,053 ± 730 mN/cm2, respectively), a major excitatory neurotransmitter in the gut, and ∼50% of that induced by 1 μmol/L of substance P (5-HT vs substance P; 5717 ± 410 vs 11,589 ± 1017 mN/cm2, respectively), a major nonadrenergic/noncholinergic excitatory neurotransmitter. In contrast, in infected mice, the response to 5-HT was 56% of the response to acetylcholine and 88% of the response to substance P, indicating an augmented role for 5-HT in infection-induced hypercontractility.Neural Control of the Intestinal Smooth Muscle Responses to 5-HTIn WT control mice, the contraction of intestinal smooth muscle in response to 5-HT was unaffected by atropine (vehicle vs atropine; 5717 ± 410 vs 6026 ± 835 mN/cm2). To determine whether neuronal components are involved in mediating 5-HT-evoked contraction, responses to 5-HT were compared in the presence or absence of a neurotoxin. In WT control mice, TTX did not modify the 1 μmol/L of 5-HT-evoked smooth muscle contraction, but significantly inhibited the 100 μmol/L of 5-HT-induced contraction by 57% (Figure 2). In WT N brasiliensis-infected mice, TTX had no effect on the response to 1 μmol/L of 5-HT but reduced the response to 100 μmol/L of 5-HT by 24% (Figure 2). The N brasiliensis-induced hypercontractility was evident even in the presence of TTX, indicating that the enteric nervous system is not required for the nematode-induced hypercontractility to 5-HT. In fact, at a higher concentration of 5-HT, the enteric nerves contribute less to the response in infected mice when compared with uninfected controls. In addition, responses in infected mice remained unaffected by atropine (vehicle vs atropine; 16,571 ± 1523 vs 15,788 ± 2769 mN/cm2), further supporting a direct effect of 5-HT on smooth muscle.Figure 2Neural control of the intestinal smooth muscle responses to 5-HT. WT mice were infected with N brasiliensis (Nb) as described and studied 9 days later. Intestinal strips were taken from the mice and suspended longitudinally in organ baths for in vitro contractility studies in response to 5-HT in the presence or absence of TTX (1 μmol/L). øP < .05 compared with the respective 5-HT; *P < .05 compared with the respective WT-VEH (n ≥ 4 for each group).View Large Image Figure ViewerDownload (PPT)Nematode Infection Up-Regulated the Expression of Specific 5-HT ReceptorsThe biologic effects of 5-HT depend on 5-HT receptor subtypes. To investigate which of these receptor subtypes is responsible for infection-induced intestinal smooth muscle hypercontractility to 5-HT, real-time quantitative PCR was used to measure the changes of 5-HT receptor mRNA expressions after infection. Of the nine 5-HT receptor subtypes measured, N brasiliensis infection induced a moderate up-regulation of 5-HT1B (∼3-fold), 5-HT2C (∼4-fold), and 5-HT7 (∼2-fold) mRNA expression and a pronounced elevation in 5-HT2A (∼8-fold) expression. The expression of other 5-HT receptors, including 5-HT3 and 5-HT4, were unchanged (Figure 3).Figure 35-HT receptor mRNA expression by real-time quantitative PCR. WT mice were infected with N brasiliensis (Nb) as described and studied 9 days later. Intestinal strips were taken from the mice for total RNA extraction. Real-time quantitative PCR was performed to measure receptor subtype mRNA expression. The fold increases were relative to the individual vehicle groups after normalization to 18S rRNA. *P < .05, **P < .01 compared with the respective WT-VEH (n ≥ 4 for each group).View Large Image Figure ViewerDownload (PPT)Effect of 5-HT Antagonists on Intestinal Smooth Muscle Responses to 5-HTTo id" @default.
• W2007252917 created "2016-06-24" @default.
• W2007252917 creator A5012025808 @default.
• W2007252917 creator A5016656665 @default.
• W2007252917 creator A5027087027 @default.
• W2007252917 creator A5036242673 @default.
• W2007252917 creator A5036569483 @default.
• W2007252917 creator A5042622786 @default.
• W2007252917 creator A5046243234 @default.
• W2007252917 date "2006-08-01" @default.
• W2007252917 modified "2023-09-30" @default.
• W2007252917 title "Contribution of 5-HT2A Receptor in Nematode Infection-Induced Murine Intestinal Smooth Muscle Hypercontractility" @default.
• W2007252917 cites W1543204600 @default.
• W2007252917 cites W1648195341 @default.
• W2007252917 cites W1775935655 @default.
• W2007252917 cites W1828221682 @default.
• W2007252917 cites W1963678188 @default.
• W2007252917 cites W1970178265 @default.
• W2007252917 cites W1974267427 @default.
• W2007252917 cites W1983852365 @default.
• W2007252917 cites W2004862250 @default.
• W2007252917 cites W2007028999 @default.
• W2007252917 cites W2007859342 @default.
• W2007252917 cites W2014814979 @default.
• W2007252917 cites W2016516315 @default.
• W2007252917 cites W2019870550 @default.
• W2007252917 cites W2030563683 @default.
• W2007252917 cites W2031835913 @default.
• W2007252917 cites W2057355956 @default.
• W2007252917 cites W2078697077 @default.
• W2007252917 cites W2085409841 @default.
• W2007252917 cites W2086356138 @default.
• W2007252917 cites W2095127706 @default.
• W2007252917 cites W2101768152 @default.
• W2007252917 cites W2110015632 @default.
• W2007252917 cites W2121904232 @default.
• W2007252917 cites W2132403618 @default.
• W2007252917 cites W2145496597 @default.
• W2007252917 cites W2146064625 @default.
• W2007252917 cites W2146465651 @default.
• W2007252917 cites W2148064137 @default.
• W2007252917 cites W2165658685 @default.
• W2007252917 cites W2167900561 @default.
• W2007252917 cites W2170314111 @default.
• W2007252917 cites W2171661751 @default.
• W2007252917 cites W3022011172 @default.
• W2007252917 doi "https://doi.org/10.1053/j.gastro.2006.05.013" @default.
• W2007252917 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16890609" @default.
• W2007252917 hasPublicationYear "2006" @default.
• W2007252917 type Work @default.
• W2007252917 sameAs 2007252917 @default.
• W2007252917 citedByCount "39" @default.
• W2007252917 countsByYear W20072529172012 @default.
• W2007252917 countsByYear W20072529172013 @default.
• W2007252917 countsByYear W20072529172014 @default.
• W2007252917 countsByYear W20072529172015 @default.
• W2007252917 countsByYear W20072529172016 @default.
• W2007252917 countsByYear W20072529172018 @default.
• W2007252917 countsByYear W20072529172020 @default.
• W2007252917 countsByYear W20072529172021 @default.
• W2007252917 countsByYear W20072529172022 @default.
• W2007252917 countsByYear W20072529172023 @default.
• W2007252917 crossrefType "journal-article" @default.
• W2007252917 hasAuthorship W2007252917A5012025808 @default.
• W2007252917 hasAuthorship W2007252917A5016656665 @default.
• W2007252917 hasAuthorship W2007252917A5027087027 @default.
• W2007252917 hasAuthorship W2007252917A5036242673 @default.
• W2007252917 hasAuthorship W2007252917A5036569483 @default.
• W2007252917 hasAuthorship W2007252917A5042622786 @default.
• W2007252917 hasAuthorship W2007252917A5046243234 @default.
• W2007252917 hasConcept C126322002 @default.
• W2007252917 hasConcept C134018914 @default.
• W2007252917 hasConcept C170493617 @default.
• W2007252917 hasConcept C185592680 @default.
• W2007252917 hasConcept C18903297 @default.
• W2007252917 hasConcept C2778830712 @default.
• W2007252917 hasConcept C2992686903 @default.
• W2007252917 hasConcept C71924100 @default.
• W2007252917 hasConcept C86803240 @default.
• W2007252917 hasConcept C89423630 @default.
• W2007252917 hasConceptScore W2007252917C126322002 @default.
• W2007252917 hasConceptScore W2007252917C134018914 @default.
• W2007252917 hasConceptScore W2007252917C170493617 @default.
• W2007252917 hasConceptScore W2007252917C185592680 @default.
• W2007252917 hasConceptScore W2007252917C18903297 @default.
• W2007252917 hasConceptScore W2007252917C2778830712 @default.
• W2007252917 hasConceptScore W2007252917C2992686903 @default.
• W2007252917 hasConceptScore W2007252917C71924100 @default.
• W2007252917 hasConceptScore W2007252917C86803240 @default.
• W2007252917 hasConceptScore W2007252917C89423630 @default.
• W2007252917 hasIssue "2" @default.
• W2007252917 hasLocation W20072529171 @default.
• W2007252917 hasLocation W20072529172 @default.
• W2007252917 hasOpenAccess W2007252917 @default.
• W2007252917 hasPrimaryLocation W20072529171 @default.
• W2007252917 hasRelatedWork W1963873932 @default.
• W2007252917 hasRelatedWork W1979254701 @default.
• W2007252917 hasRelatedWork W1982625019 @default.

• next