FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007287542> ?p ?o ?g. }

• W2007287542 endingPage "10112" @default.
• W2007287542 startingPage "10105" @default.
• W2007287542 abstract "This paper tests the hypothesis that DNA methyltransferase plays a causal role in cellular transformation induced by SV40 T antigen. We show that T antigen expression results in elevation of DNA methyltransferase (MeTase) mRNA, DNA MeTase protein levels, and global genomic DNA methylation. A T antigen mutant that has lost the ability to bind pRb does not induce DNA MeTase. This up-regulation of DNA MeTase by T antigen occurs mainly at the posttranscriptional level by altering mRNA stability. Inhibition of DNA MeTase by antisense oligonucleotide inhibitors results in inhibition of induction of cellular transformation by T antigen as determined by a transient transfection and soft agar assay. These results suggest that elevation of DNA MeTase is an essential component of the oncogenic program induced by T antigen. This paper tests the hypothesis that DNA methyltransferase plays a causal role in cellular transformation induced by SV40 T antigen. We show that T antigen expression results in elevation of DNA methyltransferase (MeTase) mRNA, DNA MeTase protein levels, and global genomic DNA methylation. A T antigen mutant that has lost the ability to bind pRb does not induce DNA MeTase. This up-regulation of DNA MeTase by T antigen occurs mainly at the posttranscriptional level by altering mRNA stability. Inhibition of DNA MeTase by antisense oligonucleotide inhibitors results in inhibition of induction of cellular transformation by T antigen as determined by a transient transfection and soft agar assay. These results suggest that elevation of DNA MeTase is an essential component of the oncogenic program induced by T antigen. DNA methyltransferase polymerase chain reaction In mammalian cells 60–80% of CpG dinucleotides are methylated, forming a pattern that correlates with gene expression (1Razin A. Riggs A.D. Science. 1980; 210: 604-610Crossref PubMed Scopus (1510) Google Scholar, 2Razin A. Szyf M. Biochim. Biophys. Acta. 1984; 782: 331-342Crossref PubMed Scopus (258) Google Scholar). The DNA 5-cytosine methyltransferase (DNA MeTase)1 is the enzyme responsible for the establishment of this pattern (3Adams R.L. McKay E.L. Craig L.M. Burdon R.H. Biochim. Biophys. Acta. 1979; 561: 345-357Crossref PubMed Scopus (73) Google Scholar). Several reports have demonstrated that cancer cells bear increased levels of DNA MeTase (4Kautiainen T.L. Jones P.A. J. Biol. Chem. 1986; 261: 1594-1598Abstract Full Text PDF PubMed Google Scholar), that increased DNA MeTase is an early event in tumor progression in an animal model of lung carcinogenesis (5Belinsky S.A. Nikula K.J. Baylin S.B. Issa J.P.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4045-4050Crossref PubMed Scopus (232) Google Scholar), and that regional hypermethylation is characteristic of tumor cells (6Merlo A. Herman J.G. Mao L. Lee D.J. Gabrielson E. Burger P. Baylin S.B. Sidransky D. Nat. Med. 1995; 1: 686-692Crossref PubMed Scopus (1877) Google Scholar, 7Nelkin B.D. Przepiorka D. Burke P.J. Thomas E.D. Baylin S.B. Blood. 1991; 77: 2431-2434Crossref PubMed Google Scholar). However, the extent to which DNA MeTase activity is elevated in cancer cellsin vivo is still debatable (8Lee P.J. Washer L.L. Law D.J. Boland C.R. Horon I.L. Feinberg A.P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10366-10370Crossref PubMed Scopus (119) Google Scholar). A basic question is whether an increase in DNA MeTase activity is a critical downstream component of oncogenic pathways (9Szyf M. Trends Pharmacol. Sci. 1994; 7: 233-238Abstract Full Text PDF Scopus (101) Google Scholar) or whether it is an aberrant consequence of the transformed state? One molecular link between DNA MeTase and an oncogenic pathway is the observation that its expression in mouse cells is up-regulated at the transcriptional level by the Ras signaling pathway (9Szyf M. Trends Pharmacol. Sci. 1994; 7: 233-238Abstract Full Text PDF Scopus (101) Google Scholar, 10MacLeod A.R. Rouleau J. Szyf M. J. Biol. Chem. 1995; 270: 11327-11337Crossref PubMed Scopus (177) Google Scholar, 11Rouleau J. MacLeod A.R. Szyf M. J. Biol. Chem. 1995; 270: 1595-1601Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). Several lines of evidence have suggested recently that elevated DNA MeTase might play a causal role in cancer (12Szyf M. Pharmacol. Ther. 1996; 70: 1-37Crossref PubMed Scopus (78) Google Scholar). Inhibition of DNA MeTase in Y1 adrenal carcinoma cells by either expressing an antisense to DNA MeTase (13MacLeod A.R. Szyf M. J. Biol. Chem. 1995; 270: 8037-8043Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar) or by antisense oligonucleotides (14Ramchandani S. MacLeod A.R. Pinard M. von Hofe E. Szyf M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 684-689Crossref PubMed Scopus (168) Google Scholar) inhibits tumorigenesis ex vivo. Injection of DNA MeTase antisense oligonucleotides into mice harboring Y1 tumors inhibits tumor growth in vivo (14Ramchandani S. MacLeod A.R. Pinard M. von Hofe E. Szyf M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 684-689Crossref PubMed Scopus (168) Google Scholar), and reduction of DNA MeTase level by 5-azaCdR suppresses neoplasia in Minmice (15Laird P.W. Jacksongrusby L. Fazeli A. Dickinson S.L. Jung W.E. Li E.A. Weinberg R. Jaenisch R. Cell. 1995; 81: 197-205Abstract Full Text PDF PubMed Scopus (660) Google Scholar). If increased DNA MeTase is a necessary constituent of cellular transformation, it should be induced by diverse oncogenic pathways. SV40 T antigen is one of the most studied viral oncoproteins that can induce frequent tumors when expressed as a transgene in mice (16Brinster R.L. Chen H.Y. Messing A. van Dyke T. Levine A.J. Palmiter D. Cell. 1984; 37: 367-379Abstract Full Text PDF PubMed Scopus (366) Google Scholar), can immortalize primary cell lines (17Tevethia M.J. Virology. 1984; 137: 414-421Crossref PubMed Scopus (47) Google Scholar) or transform immortalized cells (18Aaronson S.A. Todaro G.J. Virology. 1968; 36: 254-261Crossref PubMed Scopus (72) Google Scholar), but transforms primary cells only when expressed in conjunction with Ras or other components of its signaling pathway (19Land H. Parada L.F. Weinberg R.A. Nature. 1983; 304: 596-602Crossref PubMed Scopus (1962) Google Scholar). Thus, T antigen induces a very effective transformation pathway that is complementary to, but different from, the one induced by Ras. Extensive studies have established that T antigen transformation is a consequence of its ability to physically interact with the tumor suppressors pRb (20De Caprio J.A. Ludlow J.W. Figge J. Shew J.Y. Huang C.M. Lee W.H. Marsilio E. Paucha E. Livingston D. Cell. 1988; 54: 275-283Abstract Full Text PDF PubMed Scopus (1106) Google Scholar) and p53(21) as well as yet non characterized functions. A recent observation has shown that two human SV40-transformed lines express higher levels of DNA MeTase protein than their nontransformed counterparts (22Chuang L.S.-H. Ian H.-I. Koh T.-W. Ng H.-H. Xu G. Li B.F.L. Science. 1997; 277: 1996-2000Crossref PubMed Scopus (787) Google Scholar). Is it possible that similar to the Ras signaling pathway, the T antigen-tumor suppressor pathway utilizes DNA MeTase as a downstream effector? This paper tests this hypothesis by determining whether expression of T antigen increases the levels of DNA MeTase mRNA and protein in the cell, defining the level of gene expression regulation at which T antigen acts, and testing whether DNA MeTase plays a causal role in T antigen triggered cellular transformation? Balb/c 3T3 cells (ATCC) were maintained as monolayers in Dulbecco's modified Eagle's medium medium which was supplemented with 10% heat-inactivated fetal calf serum (Immunocorp, Montreal). All other media and reagents for cell culture were obtained from Life Technologies, Inc. Cells (1 × 106) were plated on a 150-mm dish (Nunc) 15 h before transfection. The pZip U19 (ts A58)Tneo T antigen expressing vector (23Almazan G. McKay R. Brain Res. 1992; 579: 234-245Crossref PubMed Scopus (64) Google Scholar) (this plasmid expresses high levels of T antigen and is highly transforming in our experience at 37 °C, it was not temperature-sensitive in our experience) was introduced into Balb/c 3T3 cells with 1 μg of pUCSVneo as a selectable marker by DNA mediated gene transfer using the calcium phosphate protocol. Selection was initiated 48 h after transfection by adding 1 mg/ml G418 (Life Technologies, Inc.) to the medium. G418-resistant cells were cloned in selective medium. For analysis of growth in soft agar, 3 × 103 cells were seeded in triplicate onto a six well dish (Falcon) in 4 ml of complete medium containing 0.33% agar solution at 37 °C (24Freedman V.H. Shin S. Cell. 1974; 3: 355-359Abstract Full Text PDF PubMed Scopus (722) Google Scholar). Cells were fed with 2 ml of medium every 2 days. Growth was scored as colonies containing >10 cells, 21 days after plating. Cells were plated on tissue culture grade 100-mm dishes at a density of 1 × 105/plate 24 h before treatment. Each treatment was performed in triplicate. The phosphorothioate oligodeoxynucleotides used in this study are HYB101584, which is antisense to a sequence encoding the second putative translation initiation site of DNA MeTase (5′-TCT ATT TGA GTC TGC CAT TT-3′) and the reverse sequence HYB101585 (5′-TTT ACC GTC TGA GTT TAT CT-3′) as described in Ref. 14Ramchandani S. MacLeod A.R. Pinard M. von Hofe E. Szyf M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 684-689Crossref PubMed Scopus (168) Google Scholar. To determine whether DNA MeTase antisense oligonucleotides inhibit transformation initiated by transient expression of T antigen, Balb/c 3T3 cells were plated at a density of 2.5 × 104/well in a six-well plate 24 h before initiation of oligonucleotide treatment. Oligonucleotides were mixed with 31 μl of Lipofectin (Life Technologies, Inc.) and 4 ml of Opti-MEM (Life Technologies, Inc.) were added to the mix. The cells were incubated in the Opti-MEM/oligonucleotide mix for 4 h, following which the mix was replaced with regular growth medium. The cells were treated with 100 nm amounts of either HYB101584, HYB101585, or with Lipofectin carrier alone. 48 h after plating, 2 μg of either pZip U19 (ts A58)Tneo, T ant Rb− or pUC SVneo plasmids were included in the transfection mix with oligonucleotides. The oligonucleotide treatment was then repeated a third time 72 h after plating with oligonucleotides but without plasmid. The cells were then harvested following the third treatment and counted. The viability was determined by trypan blue dye exclusion, and the cells were plated onto soft agar as described above. For RNase protection, methyltransferase activity assay and nearest neighbor analysis, RNA, nuclear extracts, and DNA were prepared from treated cells as described below. To verify equal efficiency of transfection and expression of T antigen under the different conditions, a sample of the transfected cells was plated on glass coverslips, fixed for immunostaining with methanol, and incubated with an SV40 T antigen mouse monoclonal antibody (Santa Cruz number sc-147) for 1 h in phosphate-buffered saline, 0.1% bovine serum albumin. The signal was detected using Texas Red-conjugated secondary anti-mouse monoclonal antibody (Vector number H0724) using standard techniques as recommended by the manufacturer. No difference in transfection efficiency and expression of T antigen was observed in oligonucleotide-treated transfectants. Nuclei were stained with 4′,6-diamidino-2-phenylindole dihydrochloride (ICN number 157574) (data not shown). For transient transfection of a human DNA MeTase expression plasmid bearing the entire coding sequence of DNA MeTase (codons 1–1616) under the direction of a cytomegalovirus promoter (pcDNA 3.1 His DNA MeTase), 10 μg of either pcDNA 3.1 His DNA MeTase or pcDNA His control were mixed with 4 μl of Lipofectin, and transfection was performed as described above. Expression of transfected constructs was verified by immunocytochemistry essentially as described above using the Xpress monoclonal antibody (Invitrogen number 46-0528) for detection of His-tagged proteins and Texas Red secondary monoclonal antibody. Nuclei were stained with 4′,6-diamidino-2-phenylindole dihydrochloride (data not shown). Cells were harvested for soft agar assay 48 h posttransfection. Genomic DNA was prepared from pelleted nuclei, and total cellular RNA was prepared from cytosolic fractions. To quantify the relative abundance of DNA MeTase and T antigen mRNA, total RNA (5 μg) was blotted onto Hybond N+ using the Bio-Rad slot blot apparatus. The filter-bound RNA was hybridized to a32P-labeled 0.6-kilobase pair cDNA probe encoding the 5′ sequences of the mouse DNA MeTase (1–600) (13MacLeod A.R. Szyf M. J. Biol. Chem. 1995; 270: 8037-8043Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar) and exposed to XAR film (Eastman Kodak Co.). The filter was rehybridized with a T antigen probe, and after removing this probe, the filter was hybridized to an 18 S RNA-specific 32P-labeled oligonucleotide (13MacLeod A.R. Szyf M. J. Biol. Chem. 1995; 270: 8037-8043Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar). The autoradiograms were scanned with a Scanalytics scanner (one D analysis), and the signal at each band was determined. The signal obtained at each point was normalized to the amount of total RNA at the same point. For Northern blot analysis, the RNA was transferred to an Hybond N+ membrane (Amersham Pharmacia Biotech). The Northern blots were hybridized to a 0.6-kilobase pair antisense fragment resulting from a single stranded PCR reaction with a DNA MeTase cDNA fragment (1–600) using the oligonucleotide (TCAATGACAGCTCTCTCTGGTGTGACG) as a 3′ primer and a single-stranded PCR amplification of c-fos(1440–1458) using the oligonucleotide (CCCAGCCCACAAAGGTCCAGAATC) as a 3′ primer as well as an oligonucleotide hybridizing to 18 S rRNA. The autoradiograms were quantified by densitometry (Scanalytics), and hybridization was plotted as DNA MeTase signal standardized to 18 S and compared with 0 h actinomycin D treatment. RNA was prepared from exponentially growing cells using standard protocols. RNase protection assays were performed as described in Ref. 11Rouleau J. MacLeod A.R. Szyf M. J. Biol. Chem. 1995; 270: 1595-1601Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar using a 0.7-kilobase pairHindIII-BamHI fragment as a riboprobe. This probe is a genomic fragment bearing exons 3 and 4 of the murine DNA MeTase probe. It therefore protects, as described in Ref. 11Rouleau J. MacLeod A.R. Szyf M. J. Biol. Chem. 1995; 270: 1595-1601Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, two major bands of 112 and 100 nucleotides corresponding to these exons as well as a number of minor alternatively spliced and alternate initiations as described previously (25Rouleau J. Tanigawa G. Szyf M. J. Biol. Chem. 1992; 267: 7368-7377Abstract Full Text PDF PubMed Google Scholar). To normalize the signal obtained for DNA MeTase with the amount of total RNA present in each sample and to verify equal loading, the RNA was simultaneously hybridized with a32P-labeled riboprobe complementary to 18 S RNA and subjected to RNase digestion and protection (Ambion). Nuclei were prepared from 3 × 106 exponentially growing 3T3 and T ant 10 transfectants and were incubated with [α-32P]UTP (800 Ci/mmol) as described previously (26Szyf M. Bozovic V. Tanigawa G. J. Biol. Chem. 1991; 266: 10027-10030Abstract Full Text PDF PubMed Google Scholar). An equal concentration of32P-labeled RNA samples (1 × 106dpm/sample) was hybridized in triplicate with Hybond-N+ filters bearing 20 μg of immobilized pSKMet5′ (containing a genomic fragment bearing exons 2–4 of the murine DNA MeTase gene) (31Sakamoto K. Howard T. Ogryzko V. Xu N.-Z. Corsico C.C. Jones D.H. Howard B. Oncogene. 1993; 8: 1887-1893PubMed Google Scholar) (indicated as Met in Fig. 3), pZip U19 (ts A58)Tneo (T ant), and pγ-actin (γ-actin) plasmids and subjected to autoradiography as described previously (26Szyf M. Bozovic V. Tanigawa G. J. Biol. Chem. 1991; 266: 10027-10030Abstract Full Text PDF PubMed Google Scholar). The intensity of the signals corresponding to32P-labeled RNA hybridizing to DNA MeTase transcribed in T antigen expressing transfectants and control cells was determined by scanning densitometry and normalized to the signal obtained for γ-actin. The ratio of DNA MeTase/actin signal in T antigen transfectants was compared with the value obtained for neotransfectants. Two μg of DNA were incubated at 37 °C for 15 min with 0.1 unit of DNase, 2.5 μl of [α-32P]dGTP (3000 Ci/mmol from Amersham Pharmacia Biotech), and 2 units of Kornberg DNA polymerase (Boehringer Mannheim) were then added and the reaction was incubated for an additional 15 min at 30 °C as described previously (10MacLeod A.R. Rouleau J. Szyf M. J. Biol. Chem. 1995; 270: 11327-11337Crossref PubMed Scopus (177) Google Scholar). The labeled DNA (8 μl) was digested to 3′ mononucleotides with 70 μg of micrococcal nuclease (Amersham Pharmacia Biotech) in the manufacturer's recommended buffer for 10 h at 37 °C, spleen phosphodiesterase (Boehringer Mannheim) was then added, and the reaction mixture was incubated for 3 additional h. Equal amounts of radioactivity were loaded on TLC phosphocellulose plates (Kodak), and the 3′ mononucleotides were separated by chromatography in one dimension (isobutyric acid:H2O:NH4OH in the ratio 66:33:1). The chromatograms were exposed to XAR film (Kodak), and the autoradiograms were scanned by scanning laser densitometry (Scanalytics one D analysis). Spots corresponding to cytosine and 5-methylcytosine were quantified. To determine nuclear DNA MeTase levels, cells were harvested immediately posttransfection, and DNA MeTase activity was assayed as described previously (26Szyf M. Bozovic V. Tanigawa G. J. Biol. Chem. 1991; 266: 10027-10030Abstract Full Text PDF PubMed Google Scholar). Bisulfite mapping was performed as described previously with small modifications (27Clark S.J. Harrison J. Paul C.L. Frommer M. Nucleic Acids Res. 1994; 22: 2990-2997Crossref PubMed Scopus (1622) Google Scholar). Sodium bisulfite, catalog number S-8890, free weight = 104, was used. A 3.6 msolution of sodium bisulfite (ACS grade, Sigma) (pH 5) was prepared fresh each time, and a 20 mm stock of solution of hydroquinone was prepared and stored at −20 °C. 5 μg of DNA (digested with EcoRI) were incubated for 15 min at 37 °C with 54 μl of double distilled H2O, 6 μl of 3N NaOH. Following this incubation, 431 μl of a 3.6 m sodium bisulfite, 1 mm hydroquinone solution was added. 100 μl of mineral oil were added to overlay the solution, and the tube was heated at 55 °C for 12 h. The bisulfite reaction was recovered from beneath the mineral oil and desalted using the QIA Quick PCR Purification Kit (followed manufacturer's protocol). 6 μl of 3n NaOH were added to the desalted solution, and the tube was incubated for 15 min at 37 °C. Following ethanol precipitation (in the presence of 0.3 m NH4OAc) the DNA was resuspended in 100 μl in double distilled H2O. Approximately 50 ng of DNA were used in each of the PCR amplifications. PCR products were used as templates for subsequent PCR reactions utilizing nested primers. The PCR products of the second reaction were then subcloned using the Invitrogen TA Cloning Kit (we followed the manufacturer's protocol), and the clones were sequenced using the T7 Sequencing Kit (Amersham Pharmacia Biotech) (we followed the manufacturer's protocol, procedure C). The primers used for the MyoD first exon (GenBankTM accession M84918) were: MyoD5′1, 5′-atttaggaattgggatatgga-3′ (176–196); MyoD5′ (nested), 5′-ttttttttgtttttttgagat-3′ (245–265); MyoD3′1, 5′-ctcatttcacttactccaaaa-3′ (577–554); and MyoD3′ (nested), 5′-caaacaacacccaaacattc-3′ (488–469). The primers used for the DNA MeTase genomic region (GenBankTM accession M84387) were: MET5′1, 5′-ggattttggtttatagtattgt-3′; MET 5′ (nested), 5′-ggaattttaggtttttatatgtt-3′; MET3′1, 5′-ctcttcataaactaaatattataa-3′; and MET3′ (nested), 5′-tccaaaactcaacataaaaaaat-3′. To determine whether ectopic expression of T antigen alters the levels of DNA MeTase in the cell, we cotransfected immortalized but nontransformed Balb/c 3T3 cells with a T antigen expression vector pZipneoSV40U19tsA58 (23Almazan G. McKay R. Brain Res. 1992; 579: 234-245Crossref PubMed Scopus (64) Google Scholar), and G418-resistant clones were isolated. Quantification of the level of DNA MeTase mRNA as a function of T antigen expression in 24 independent T antigen transfectants by a slot blot analysis (Fig.1 A) shows a strong stimulation of DNA MeTase mRNA by increasing levels of T antigen expression, as assessed by quantifying the hybridization signals obtained with a DNA MeTase probe or T antigen probe and normalizing these signals to the signal observed following hybridization to an 18 S ribosomal RNA probe. Our data show a good correlation between T antigen and DNA MeTase expression. The levels of DNA MeTase mRNA in four independentneo clones expressing the selection marker but not T antigen remain significantly lower than the levels observed in the high T antigen expressers (Fig. 1 A). These data exclude the possibility that the dramatic increase in DNA MeTase observed in T antigen transfectants is a consequence of clonal variability in expression of this gene. Two independent clones were chosen to discount the possibility of clonal artifacts; T antigen 10 (high level of T antigen and DNA MeTase expression) and T antigen 22 (medium level of T antigen and DNA MeTase expression) were used for further characterization. T ant 10 was arbitrarily chosen as a representative clone in a category of high T antigen expressers. T ant 22 was also arbitrarily chosen as a representative clone in a category of significantly lower T antigen expressers. The Western blot presented in Fig. 1 Bdemonstrates a significant increase in DNA MeTase protein in these T antigen transfectants that corresponds with the differences observed in T antigen expression. This increase in DNA MeTase protein results in a 5–15-fold increase in DNA maintenance methylation activity as determined using a hemimethylated DNA substrate and [3H]S-adenosylmethionine (18Aaronson S.A. Todaro G.J. Virology. 1968; 36: 254-261Crossref PubMed Scopus (72) Google Scholar) (data not shown). The general level of methylation of CpG dinucleotides in the genome of the T antigen transfectants and the control cells was determined by a nearest neighbor analysis (10MacLeod A.R. Rouleau J. Szyf M. J. Biol. Chem. 1995; 270: 11327-11337Crossref PubMed Scopus (177) Google Scholar). As shown in Fig.2 A there is a 1.5 (T ant 22)- to 2-fold (T ant 10) reduction in the population of nonmethylated CpG dinucleotides in T antigen-transfected cells, suggesting that increased DNA MeTase activity results in a detectable increase in genomic DNA methylation.Figure 2State of DNA methylation in T antigen transfectants. A, nearest neighbor analysis of methylation at CpG dinucleotides. DNA from 3T3 cells and the T antigen transfectant clones T ant 10 and 22 was subjected to nearest neighbor analysis as described under “Experimental Procedures.” The relative abundance of nonmethylated and methylated cytosines was quantified (Scanalytics), and the results are plotted as the percentage of nonmethylated cytosines from the total population of cytosines residing in the dinucleotide sequence CpG. B, bisulfite mapping of the MyoD locus in T antigen and neo transfectants. DNA was extracted from T ant 10 transfectants (T ant 10) as well as 3T3 neo controls (NEO). The first line is a physical map of the MyoD genomic region (exons are indicated byfilled boxes, intronic sequence is indicated by aline). A blowup of the region amplified is shown under the physical map; the different CpG sites in the fragment are presented asovals. The percentage of methylated cytosines per site in the 16–18 clones analyzed per treatment were determined and are presented as different shadings of the circlesrepresenting each of the sites as indicated. Fully methylated sites (>75%) are represented as filled ovals, mainly methylated sites (50–75%) are indicated as ovals with acheckerboard pattern, partially methylated sites are indicated as shaded ovals, and nonmethylated sites (0–24%) are indicated as open ovals. Sites that were hypermethylated in T antigen transfectants are indicated by arrows. The numbering is according to GenBankTM accession numberM84918. The average methylation of all CpG sites in all sequenced clones for T antigen (T ant 10) and neo(NEO) transfectants is presented in the lower panel as the percentage of unmethylated cytosines. The difference between methylation status of the Myo D locus for T ant 10 andneo transfectants was determined to be statistically significant (t test, p < 0.05).C, bisulfite mapping of the dnmt 1 locus in T antigen and neo transfectants. DNA was extracted from T ant 10 transfectants (T ant 10) as well as neocontrols (NEO). The first line is a physical map of thednmt 1 genomic region residing upstream to the second exon (exons are indicated by filled boxes, intronic sequence is indicated by a line). Similarly to the MyoD region inB, a blowup of the region amplified is shown under the physical map, with the 7 CpG sites in the fragment presented asovals. The percentage of methylated cytosines per site in the 9–17 clones analyzed per treatment were determined and are presented as different shadings of the circles representing each of the sites as indicated as described above. The numbering is according to GenBankTM accession number M84387. The average methylation of all CpG sites in all sequenced clones for T antigen (T ant 10) and neo (NEO) transfectants is presented in the lower panel as the percentage of unmethylated cytosines. The difference between methylation status of the dnmt 1 locus for T ant 10 and neotransfectants was not determined to be statistically significant (t test, p = 0.14). D, representative bisulfite mapping sequencing films of T antigen (T Ant 10) and neo (NEO) clones at the MyoD anddnmt 1 loci. One representative sequencing film of bisulfite-treated DNA is presented per clone for each locus. Lollipops indicate the specific CpG sites by their position, shaded as described above. The numbering is according to GenBankTM accession number M84918for the MyoD locus and M84387 for the dnmt 1 locus. (Not shown in the films are the sixth and seventh CpG sites (sites number 290 and 303), which are demethylated in both T ant 10 andneo clones as indicated in the map). The DNA was subjected to bisulfite treatment as described in the methods. The genomic region bearing 18 CpG sites in the first exon of the MyoD gene and the genomic region bearing 7 CpG sites upstream to the second exon of thednmt 1 gene was amplified by PCR using the primers indicated under “Experimental Procedures” and sequenced. Unmethylated cytosines are converted to thymidines by this protocol, whereas methylated cytosines are protected and are visualized as cytosines.View Large Image Figure ViewerDownload (PPT) It is hard to determine whether this hypermethylation indicates complete hypermethylation of a limited set of specific sites or whether it reflects a limited increase in the frequency of methylation of all sites. Comparing the state of methylation of specific sites in different transfectants is an arduous task because of the tendency of cells in culture to exhibit fluctuations in the state of methylation of CpG sites. A previous report has shown, however, that increased ectopic expression of DNA MeTase leads to hypermethylation of CpG islands (28Vertino P.M. Yen R.W. Gao J. Baylin S.B. Mol. Cell. Biol. 1996; 16: 4555-4565Crossref PubMed Scopus (246) Google Scholar). We therefore studied by bisulfite mapping the state of methylation of the CG-rich region in the first exon of the MyoD gene (GenBankTM accession number M84918) in the higher expressing T antigen clone, T ant 10. CpG islands in general and MyoD in particular have been shown to undergo hypermethylation upon cellular transformation (29Jones P.A. Wolkowicz M.J. Rideout W.M. Gonzales F.A. Marziasz C.M. Coetzee G.A. Tapscott S.J. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6117-6121Crossref PubMed Scopus (203) Google Scholar). The bisulfite method enables one to look at a large number of copies of the studied gene, thus enabling a representative picture of the state of methylation of each specific site in the population of cells (27Clark S.J. Harrison J. Paul C.L. Frommer M. Nucleic Acids Res. 1994; 22: 2990-2997Crossref PubMed Scopus (1622) Google Scholar). As observed in Fig. 2,B and D, the MyoD region analyzed in our study is hypermethylated in T antigen transfectants relative to neocontrols. Of the 18 CpG sites analyzed, a total of 9 sites were found to be hypermethylated in the T ant 10 stable line relative toneo controls (Fig. 2 B). When the results for all of the CpG sites in this region in all the sequenced clones (18 forneo, 16 for T ant 10) were pooled and averaged for comparative analysis, the average methylation of CpG sites was found to be 39% for neo transfectants and 71% for T ant 10 transfectants. In order to determine whether this genomic hypermethylation extends to CG sites not contained in CG-rich areas, we chose to map the region upstream to the second exon of the DNA Methyltransferase (dnmt 1) locus. As shown in Fig. 2,C and D, the methylation status of the dnmt 1 locus does not change substantially with T antigen overexpression. Of the seven CpG sites analyzed in this region, only one site (CpG 101) was shown to be partially hypermethylated in the T ant 10 stable line relative to the neo control line. Interestingly, another site (CpG 157) was actual" @default.
• W2007287542 created "2016-06-24" @default.
• W2007287542 creator A5001879820 @default.
• W2007287542 creator A5007458839 @default.
• W2007287542 creator A5008151186 @default.
• W2007287542 creator A5081838401 @default.
• W2007287542 date "1999-04-01" @default.
• W2007287542 modified "2023-09-28" @default.
• W2007287542 title "DNA Methyltransferase Is a Downstream Effector of Cellular Transformation Triggered by Simian Virus 40 Large T Antigen" @default.
• W2007287542 cites W1522569372 @default.
• W2007287542 cites W1548506428 @default.
• W2007287542 cites W1576611598 @default.
• W2007287542 cites W1968263601 @default.
• W2007287542 cites W1977706798 @default.
• W2007287542 cites W1978365813 @default.
• W2007287542 cites W1980711489 @default.
• W2007287542 cites W1989009382 @default.
• W2007287542 cites W2012795333 @default.
• W2007287542 cites W2024109518 @default.
• W2007287542 cites W2024855079 @default.
• W2007287542 cites W2028563156 @default.
• W2007287542 cites W2031129569 @default.
• W2007287542 cites W2036042116 @default.
• W2007287542 cites W2036837272 @default.
• W2007287542 cites W2037364555 @default.
• W2007287542 cites W2039074795 @default.
• W2007287542 cites W2044474149 @default.
• W2007287542 cites W2049662309 @default.
• W2007287542 cites W2055171335 @default.
• W2007287542 cites W2080336014 @default.
• W2007287542 cites W2080821826 @default.
• W2007287542 cites W2090582597 @default.
• W2007287542 cites W2091602444 @default.
• W2007287542 cites W2095161101 @default.
• W2007287542 cites W2122116522 @default.
• W2007287542 cites W2134202806 @default.
• W2007287542 cites W2149078121 @default.
• W2007287542 cites W2151836161 @default.
• W2007287542 cites W2155009866 @default.
• W2007287542 cites W2166514374 @default.
• W2007287542 cites W2396892382 @default.
• W2007287542 doi "https://doi.org/10.1074/jbc.274.15.10105" @default.
• W2007287542 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10187792" @default.
• W2007287542 hasPublicationYear "1999" @default.
• W2007287542 type Work @default.
• W2007287542 sameAs 2007287542 @default.
• W2007287542 citedByCount "88" @default.
• W2007287542 countsByYear W20072875422012 @default.
• W2007287542 countsByYear W20072875422013 @default.
• W2007287542 countsByYear W20072875422014 @default.
• W2007287542 countsByYear W20072875422015 @default.
• W2007287542 countsByYear W20072875422016 @default.
• W2007287542 countsByYear W20072875422017 @default.
• W2007287542 countsByYear W20072875422018 @default.
• W2007287542 countsByYear W20072875422021 @default.
• W2007287542 countsByYear W20072875422022 @default.
• W2007287542 crossrefType "journal-article" @default.
• W2007287542 hasAuthorship W2007287542A5001879820 @default.
• W2007287542 hasAuthorship W2007287542A5007458839 @default.
• W2007287542 hasAuthorship W2007287542A5008151186 @default.
• W2007287542 hasAuthorship W2007287542A5081838401 @default.
• W2007287542 hasBestOaLocation W20072875421 @default.
• W2007287542 hasConcept C104317684 @default.
• W2007287542 hasConcept C147483822 @default.
• W2007287542 hasConcept C153911025 @default.
• W2007287542 hasConcept C159047783 @default.
• W2007287542 hasConcept C162324750 @default.
• W2007287542 hasConcept C185592680 @default.
• W2007287542 hasConcept C204241405 @default.
• W2007287542 hasConcept C21547014 @default.
• W2007287542 hasConcept C2522874641 @default.
• W2007287542 hasConcept C2776207758 @default.
• W2007287542 hasConcept C2776488936 @default.
• W2007287542 hasConcept C2779979206 @default.
• W2007287542 hasConcept C33288867 @default.
• W2007287542 hasConcept C51785407 @default.
• W2007287542 hasConcept C54355233 @default.
• W2007287542 hasConcept C552990157 @default.
• W2007287542 hasConcept C86803240 @default.
• W2007287542 hasConcept C91965660 @default.
• W2007287542 hasConcept C95444343 @default.
• W2007287542 hasConceptScore W2007287542C104317684 @default.
• W2007287542 hasConceptScore W2007287542C147483822 @default.
• W2007287542 hasConceptScore W2007287542C153911025 @default.
• W2007287542 hasConceptScore W2007287542C159047783 @default.
• W2007287542 hasConceptScore W2007287542C162324750 @default.
• W2007287542 hasConceptScore W2007287542C185592680 @default.
• W2007287542 hasConceptScore W2007287542C204241405 @default.
• W2007287542 hasConceptScore W2007287542C21547014 @default.
• W2007287542 hasConceptScore W2007287542C2522874641 @default.
• W2007287542 hasConceptScore W2007287542C2776207758 @default.
• W2007287542 hasConceptScore W2007287542C2776488936 @default.
• W2007287542 hasConceptScore W2007287542C2779979206 @default.
• W2007287542 hasConceptScore W2007287542C33288867 @default.
• W2007287542 hasConceptScore W2007287542C51785407 @default.
• W2007287542 hasConceptScore W2007287542C54355233 @default.
• W2007287542 hasConceptScore W2007287542C552990157 @default.
• W2007287542 hasConceptScore W2007287542C86803240 @default.

• next