FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007687079> ?p ?o ?g. }

• W2007687079 endingPage "8067" @default.
• W2007687079 startingPage "8061" @default.
• W2007687079 abstract "BRCA1, a breast and ovarian cancer susceptibility gene, has been implicated in gene regulation. Previous studies demonstrate that BRCA1 induces GADD45, a p53-regulated and stress-inducible gene that plays an important role in cellular response to DNA damage. However, the mechanism(s) by which BRCA1 regulates GADD45 remains unclear. In this report, we have shown that BRCA1 activation of the GADD45 promoter is mediated through the OCT-1 and CAAT motifs located at theGADD45 promoter region. Site-directed mutations of both OCT-1 and CAAT motifs abrogate induction of the GADD45promoter by BRCA1. Both OCT-1 and CAAT motifs are able to confer BRCA1 inducibility in a non-related minimal promoter. Physical associations of BRCA1 protein with transcription factors Oct-1 and NF-YA, which directly bind to the OCT-1 and CAAT motifs, are established by biotin-streptavidin pull-down and coimmunoprecipitation assays. Such protein interactions are required for interaction of BRCA1 with theGADD45 promoter because either immunodepletion of Oct-1 and NF-YA proteins or mutations in the OCT-1 and CAAT motifs disrupt BRCA1 binding to the GADD45 promoter. These findings indicate that BRCA1 can up-regulate its targeted genes through protein-protein interactions and provide a novel mechanism by which BRCA1 participates in transcriptional regulation. BRCA1, a breast and ovarian cancer susceptibility gene, has been implicated in gene regulation. Previous studies demonstrate that BRCA1 induces GADD45, a p53-regulated and stress-inducible gene that plays an important role in cellular response to DNA damage. However, the mechanism(s) by which BRCA1 regulates GADD45 remains unclear. In this report, we have shown that BRCA1 activation of the GADD45 promoter is mediated through the OCT-1 and CAAT motifs located at theGADD45 promoter region. Site-directed mutations of both OCT-1 and CAAT motifs abrogate induction of the GADD45promoter by BRCA1. Both OCT-1 and CAAT motifs are able to confer BRCA1 inducibility in a non-related minimal promoter. Physical associations of BRCA1 protein with transcription factors Oct-1 and NF-YA, which directly bind to the OCT-1 and CAAT motifs, are established by biotin-streptavidin pull-down and coimmunoprecipitation assays. Such protein interactions are required for interaction of BRCA1 with theGADD45 promoter because either immunodepletion of Oct-1 and NF-YA proteins or mutations in the OCT-1 and CAAT motifs disrupt BRCA1 binding to the GADD45 promoter. These findings indicate that BRCA1 can up-regulate its targeted genes through protein-protein interactions and provide a novel mechanism by which BRCA1 participates in transcriptional regulation. methyl methanesulfonate chloramphenicol acetyltransferase phosphate-buffered saline green fluorescence protein wild type mutant Mutations of the breast cancer susceptibility gene,BRCA1, are associated with more than half the cases of hereditary breast cancer (1Easton D.F. Ford D. Bishop D.T. Am. J. Hum. Genet. 1995; 56: 265-271Crossref PubMed Scopus (12) Google Scholar, 2Ford D. Easton D.F. Br. J. Cancer. 1995; 72: 805-812Crossref PubMed Scopus (228) Google Scholar, 3Miki Y. Swensen J. Shattuck-Eidens D. Futreal P.A. Harshman K. Tavtigian S. Liu Q. Cochran C. Bennett L.M. Ding W. et al.Science. 1994; 266: 66-71Crossref PubMed Scopus (5211) Google Scholar). The human BRCA1 gene encodes a nuclear protein of 1863 amino acids and is expressed in a variety of human tissues (3Miki Y. Swensen J. Shattuck-Eidens D. Futreal P.A. Harshman K. Tavtigian S. Liu Q. Cochran C. Bennett L.M. Ding W. et al.Science. 1994; 266: 66-71Crossref PubMed Scopus (5211) Google Scholar, 4Marquis S.T. Rajan J.V. Wynshaw-Boris A. Xu J. Yin G.Y. Abel K.J. Weber B.L. Chodosh L.A. Nat. Genet. 1995; 11: 17-26Crossref PubMed Scopus (329) Google Scholar). Neoplastic development inBRCA1 mutation carriers is generally accompanied by loss of the wild-type allele, suggesting BRCA1 protein may function as a tumor suppressor. A number of observations have implicated BRCA1in cellular response to DNA damage. BRCA1 associates and colocalizes with Rad51 protein and may be involved in DNA recombination. Following DNA damage, BRCA1 becomes hyperphosphorylated by ATM (5Cortez D. Wang Y. Qin J. Elledge S.J. Science. 1999; 286: 1162-1166Crossref PubMed Scopus (864) Google Scholar) and hCds1/Chk2 (6Lee J.S. Collins K.M. Brown A.L. Lee C.H. Chung J.H. Nature. 2000; 404: 201-204Crossref PubMed Scopus (458) Google Scholar) and relocalizes to complexes containing proliferating cell nuclear antigen (7Scully R. Chen J. Plug A. Xiao Y. Weaver D. Feunteun J. Ashley T. Livingston D.M. Cell. 1997; 88: 265-275Abstract Full Text Full Text PDF PubMed Scopus (1313) Google Scholar). Additionally, BRCA1 plays an important role in the transcription-coupled repair (8Gowen L.C. Avrutskaya A.V. Latour A.M. Koller B.H. Leadon S.A. Science. 1998; 281: 1009-1012Crossref PubMed Scopus (449) Google Scholar) and in the control of cell cycle arrest following DNA damage (9Larson J.S. Tonkinson J.L. Lai M.T. Cancer Res. 1997; 57: 3351-3355PubMed Google Scholar, 10Somasundaram K. Zhang H. Zeng Y.X. Houvras Y. Peng Y. Wu G.S. Licht J.D. Weber B.L. El-Deiry W.S. Nature. 1997; 389: 187-190Crossref PubMed Scopus (470) Google Scholar). Recently, multiple reports (11Shao N. Chai Y.L. Shyam E. Reddy P. Rao V.N. Oncogene. 1996; 13: 1-7PubMed Google Scholar, 12Fan S. Wang J.A. Yuan R.Q. Ma Y.X. Meng Q. Erdos M.R. Brody L.C. Goldberg I.D. Rosen E.M. Oncogene. 1998; 16: 3069-3082Crossref PubMed Scopus (99) Google Scholar, 13Thangaraju M. Kaufmann S.H. Couch F.J. J. Biol. Chem. 2000; 275: 33487-33496Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar) have suggested that BRCA1 might also play a role in apoptosis. Therefore, through its functions in DNA repair process, apoptosis, and cell cycle arrest, BRCA1 plays an important role in the maintenance of genomic integrity. This is strongly supported by the demonstration that murine embryos carrying aBRCA1 null mutation exhibit hypersensitivity to DNA damage and chromosomal abnormalities, probably due to defective G2/M checkpoint control and improper centrosome duplication (14Shen S.X. Weaver Z. Xu X. Li C. Weinstein M. Chen L. Guan X.Y. Ried T. Deng C.X. Oncogene. 1998; 17: 3115-3124Crossref PubMed Scopus (293) Google Scholar). GADD45 is a DNA damage-responsive gene and is induced by a wide spectrum of genotoxic stress agents, including ionizing radiation, UV radiation, methyl methanesulfonate (MMS),1 and medium starvation (15Fornace Jr., A.J. Alamo Jr., I. Hollander M.C. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8800-8804Crossref PubMed Scopus (559) Google Scholar, 16Fornace Jr., A.J. Papathanasiou M.A. Tarone R.E. Wong M. Mitchell J. Hamer D.H. Prog. Clin. Biol. Res. 1990; 340A: 315-325PubMed Google Scholar, 17Papathanasiou M.A. Kerr N.C. Robbins J.H. McBride O.W. Alamo Jr., I. Barrett S.F. Hickson I.D. Fornace Jr., A.J. Mol. Cell. Biol. 1991; 11: 1009-1016Crossref PubMed Scopus (249) Google Scholar). It has been shown that induction of GADD45 after DNA damage is mediated via both p53-dependent (18Kastan M.B. Zhan Q. El-Deiry W.S. Carrier F. Jacks T. Walsh W.V. Plunkett B.S. Vogelstein B. Fornace Jr., A.J. Cell. 1992; 71: 587-597Abstract Full Text PDF PubMed Scopus (2922) Google Scholar, 19Zhan Q. Bae I. Kastan M.B. Fornace Jr., A.J. Cancer Res. 1994; 54: 2755-2760PubMed Google Scholar) and -independent pathways (20Zhan Q. Fan S. Smith M.L. Bae I. Yu K. Alamo Jr., I. O'Connor P.M. Fornace Jr., A.J. DNA Cell Biol. 1996; 15: 805-815Crossref PubMed Scopus (96) Google Scholar). Expression of Gadd45 protein suppresses cell growth (21Zhan Q. Lord K.A. Alamo Jr., I. Hollander M.C. Carrier F. Ron D. Kohn K.W. Hoffman B. Liebermann D.A. Fornace Jr., A.J. Mol. Cell. Biol. 1994; 14: 2361-2371Crossref PubMed Scopus (465) Google Scholar, 22Jin S. Antinore M.J. Lung F.D. Dong X. Zhao H. Fan F. Colchagie A.B. Blanck P. Roller P.P. Fornace Jr., A.J. Zhan Q. J. Biol. Chem. 2000; 275: 16602-16608Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). Gadd45 protein is able to associate with multiple important cellular proteins, including proliferating cell nuclear antigen (23Smith M.L. Chen I.T. Zhan Q. Bae I. Chen C.Y. Gilmer T.M. Kastan M.B. O'Connor P.M. Fornace Jr., A.J. Science. 1994; 266: 1376-1380Crossref PubMed Scopus (893) Google Scholar), p21 (24Kearsey J.M. Coates P.J. Prescott A.R. Warbrick E. Hall P.A. Oncogene. 1995; 11: 1675-1683PubMed Google Scholar, 25Zhao H. Jin S. Antinore M.J. Lung F.D. Fan F. Blanck P. Roller P. Fornace Jr., A.J. Zhan Q. Exp. Cell Res. 2000; 258: 92-100Crossref PubMed Scopus (55) Google Scholar), Cdc2 (26Zhan Q. Antinore M.J. Wang X.W. Carrier F. Smith M.L. Harris C.C. Fornace Jr., A.J. Oncogene. 1999; 18: 2892-2900Crossref PubMed Scopus (392) Google Scholar), core histone (27Carrier F. Georgel P.T. Pourquier P. Blake M. Kontny H.U. Antinore M.J. Gariboldi M. Myers T.G. Weinstein J.N. Pommier Y. Fornace Jr., A.J. Mol. Cell. Biol. 1999; 19: 1673-1685Crossref PubMed Scopus (244) Google Scholar), and MTK1/MEKK4 (28Takekawa M. Saito H. Cell. 1998; 95: 521-530Abstract Full Text Full Text PDF PubMed Scopus (644) Google Scholar). Recent findings suggest that GADD45is involved in the control of cell cycle checkpoint (29Wang X.W. Zhan Q. Coursen J.D. Khan M.A. Kontny H.U. Yu L. Hollander M.C. O'Connor P.M. Fornace Jr., A.J. Harris C.C. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3706-3711Crossref PubMed Scopus (531) Google Scholar) and apoptosis (28Takekawa M. Saito H. Cell. 1998; 95: 521-530Abstract Full Text Full Text PDF PubMed Scopus (644) Google Scholar, 30Harkin D.P. Bean J.M. Miklos D. Song Y.H. Truong V.B. Englert C. Christians F.C. Ellisen L.W. Maheswaran S. Oliner J.D. Haber D.A. Cell. 1999; 97: 575-586Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar). This argument is further supported by the finding thatGADD45-null mice exhibit significant genomic instability, which is exemplified by aneuploidy, chromosomal aberrations, and gene amplification, and increased carcinogenesis following treatment with DNA damage (31Hollander M.C. Sheikh M.S. Bulavin D.V. Lundgren K. Augeri-Henmueller L. Shehee R. Molinaro T.A. Kim K.E. Tolosa E. Ashwell J.D. Rosenberg M.P. Zhan Q. Fernandez-Salguero P.M. Morgan W.F. Deng C.X. Fornace Jr., A.J. Nat. Genet. 1999; 23: 176-184Crossref PubMed Scopus (437) Google Scholar). Therefore, GADD45 appears to be an important player in maintenance of genomic stability. Several lines of evidence support a role for BRCA1 in transcriptional regulation. BRCA1 has an N-terminal ring finger domain and a C-terminal transcription activation domain that activates transcription when fused to a DNA-binding domain (32Chapman M.S. Verma I.M. Nature. 1996; 382: 678-679Crossref PubMed Scopus (435) Google Scholar). It has been shown that BRCA1 interacts with transcriptional regulators, including p53 (33Ouchi T. Monteiro A.N. August A. Aaronson S.A. Hanafusa H. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2302-2306Crossref PubMed Scopus (333) Google Scholar, 34Zhang H. Somasundaram K. Peng Y. Tian H. Bi D. Weber B.L. El-Deiry W.S. Oncogene. 1998; 16: 1713-1721Crossref PubMed Scopus (422) Google Scholar), c-Myc (35Wang Q. Zhang H. Kajino K. Greene M.I. Oncogene. 1998; 17: 1939-1948Crossref PubMed Scopus (190) Google Scholar), STAT1 (36Ouchi T. Lee S.W. Ouchi M. Aaronson S.A. Horvath C.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5208-5213Crossref PubMed Scopus (186) Google Scholar), and estrogen receptor (37Fan S. Wang J. Yuan R. Ma Y. Meng Q. Erdos M.R. Pestell R.G. Yuan F. Auborn K.J. Goldberg I.D. Rosen E.M. Science. 1999; 284: 1354-1356Crossref PubMed Scopus (414) Google Scholar), and proteins involved in chromatin remodeling including p300/CBP (38Pao G.M. Janknecht R. Ruffner H. Hunter T. Verma I.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1020-1025Crossref PubMed Scopus (182) Google Scholar) and RBAP46/48-HDAC (39Chen G.C. Guan L.S. Yu J.H. Li G.C. Choi Kim H.R. Wang Z.Y. Biochem. Biophys. Res. Commun. 2001; 284: 507-514Crossref PubMed Scopus (30) Google Scholar). Expression of BRCA1 activates or suppresses expression of several important cellular proteins, such as p21waf1/CIP1 (10Somasundaram K. Zhang H. Zeng Y.X. Houvras Y. Peng Y. Wu G.S. Licht J.D. Weber B.L. El-Deiry W.S. Nature. 1997; 389: 187-190Crossref PubMed Scopus (470) Google Scholar) and cyclin B1 (40MacLachlan T.K. Somasundaram K. Sgagias M. Shifman Y. Muschel R.J. Cowan K.H. El-Deiry W.S. J. Biol. Chem. 2000; 275: 2777-2785Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). Most recently, studies from our group and others (30Harkin D.P. Bean J.M. Miklos D. Song Y.H. Truong V.B. Englert C. Christians F.C. Ellisen L.W. Maheswaran S. Oliner J.D. Haber D.A. Cell. 1999; 97: 575-586Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar, 40MacLachlan T.K. Somasundaram K. Sgagias M. Shifman Y. Muschel R.J. Cowan K.H. El-Deiry W.S. J. Biol. Chem. 2000; 275: 2777-2785Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 41Jin S. Zhao H. Fan F. Blanck P. Fan W. Colchagie A.B. Fornace Jr., A.J. Zhan Q. Oncogene. 2000; 19: 4050-4057Crossref PubMed Scopus (85) Google Scholar) have demonstrated that BRCA1 strongly activates GADD45 in a p53-independent manner. Activation of the GADD45 promoter requires normal transcription-activating function of BRCA1 because the tumor-derived BRCA1 mutants (1749R and Y1853insA), which lack transcription activity, are unable to activate the GADD45 promoter (41Jin S. Zhao H. Fan F. Blanck P. Fan W. Colchagie A.B. Fornace Jr., A.J. Zhan Q. Oncogene. 2000; 19: 4050-4057Crossref PubMed Scopus (85) Google Scholar). However, the molecular mechanism by which BRCA1 up-regulates GADD45is complex and may involve the regulatory elements located at either the third intron or the promoter region of GADD45. BRCA1 also represses GADD45 expression through its interaction with ZBRK1 transcription factor (42Zheng L. Pan H. Li S. Flesken-Nikitin A. Chen P.L. Boyer T.G. Lee W.H. Mol. Cell. 2000; 6: 757-768Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). Despite the discrepancy of the effect of BRCA1 on GADD45 transcription, it has been well accepted that GADD45 is one of the BRCA1 downstream effectors and probably mediates the role of BRCA1 in maintenance of genomic stability. The transcription factor Oct-1, a member of the POU homeodomain family, is ubiquitously expressed and binds to the AGTCAAAA consensus sequence through its DNA-binding POU domain (43Sturm R.A. Das G. Herr W. Genes Dev. 1988; 2: 1582-1599Crossref PubMed Scopus (474) Google Scholar). High affinity Oct-1-binding sites are found in a number of cellular promoters (44Fletcher C. Heintz N. Roeder R.G. Cell. 1987; 51: 773-781Abstract Full Text PDF PubMed Scopus (305) Google Scholar), and binding of Oct-1 factor to its consensus motif normally activates Oct-1-regulated genes (45LaBella F. Sive H.L. Roeder R.G. Heintz N. Genes Dev. 1988; 2: 32-39Crossref PubMed Scopus (147) Google Scholar, 46Murphy S. Pierani A. Scheidereit C. Melli M. Roeder R.G. Cell. 1989; 59: 1071-1080Abstract Full Text PDF PubMed Scopus (68) Google Scholar, 47Bergman Y. Rice D. Grosschedl R. Baltimore D. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 7041-7045Crossref PubMed Scopus (129) Google Scholar, 48Eraly S.A. Nelson S.B. Huang K.M. Mellon P.L. Mol. Endocrinol. 1998; 12: 469-481Crossref PubMed Scopus (62) Google Scholar, 49Fadel B.M. Boutet S.C. Quertermous T. J. Biol. Chem. 1999; 274: 20376-20383Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). NF-Y is also a ubiquitous transcription factor consisted of three subunits, A–C. NF-Y specifically binds CAAT box motifs, which are found in 30% of eukaryotic promoters (50Mantovani R. Gene (Amst.). 1999; 239: 15-27Crossref PubMed Scopus (673) Google Scholar, 51Matuoka K. Yu Chen K. Exp. Cell Res. 1999; 253: 365-371Crossref PubMed Scopus (53) Google Scholar). Recently, both Oct-1 and NF-YA, but not NF-YB and NF-YC, were found to be induced following treatment with genotoxic agents, indicating that these two transcription factors may participate in cellular response to DNA damage (52Zhao H. Jin S. Fan F. Fan W. Tong T. Zhan Q. Cancer Res. 2000; 60: 6276-6280PubMed Google Scholar, 53Jin S. Fan F. Fan W. Zhao H. Tong T. Blanck P. Alomo I. Rajasekaran B. Zhan Q. Oncogene. 2001; 20: 2683-2690Crossref PubMed Scopus (94) Google Scholar). In this article, we identify OCT-1 and CAAT as the BRCA1-regulatory elements required for BRCA1 activation of the GADD45promoter. Disruptions of the OCT-1 and CAAT motifs abolish activation of the GADD45 promoter by BRCA1. Moreover, BRCA1 physically associates with Oct-1 and NF-YA transcription factors. These results characterize an important molecular mechanism by which BRCA1 regulatesGADD45. The following GADD45 promoter reporter constructs were used: pHG45-CAT1, pHG45-CAT2, pHG45-CAT5, pHG45-CAT7, pHG45-CAT11, pHG-CAT12, and pHG45-CAT13 (53Jin S. Fan F. Fan W. Zhao H. Tong T. Blanck P. Alomo I. Rajasekaran B. Zhan Q. Oncogene. 2001; 20: 2683-2690Crossref PubMed Scopus (94) Google Scholar, 54Zhan Q. Chen I.T. Antinore M.J. Fornace Jr., A.J. Mol. Cell. Biol. 1998; 18: 2768-2778Crossref PubMed Google Scholar).GADD45 promoter reporters that contain mutations in either Oct-1 or CATT box motifs (pHg45-CAT11 m1, pHg45-CAT11 m2, pHg45-CAT11 m3, pHg45-CAT11 m4, pHg45-CAT11 m5, pHg45-CAT11 m6, and pHg45-CAT11 m7) were constructed by PCR cloning as described previously (53Jin S. Fan F. Fan W. Zhao H. Tong T. Blanck P. Alomo I. Rajasekaran B. Zhan Q. Oncogene. 2001; 20: 2683-2690Crossref PubMed Scopus (94) Google Scholar). pCR3-BRCA1, a construct expressing wt human BRCA1 protein, was provided by B. Weber (see Ref. 10Somasundaram K. Zhang H. Zeng Y.X. Houvras Y. Peng Y. Wu G.S. Licht J.D. Weber B.L. El-Deiry W.S. Nature. 1997; 389: 187-190Crossref PubMed Scopus (470) Google Scholar). pC53-SN3, which expresses wild-type p53 protein, was provided by B. Vogelstein (see Ref. 55Kern S.E. Pietenpol J.A. Thiagalingam S. Seymour A. Kinzler K.W. Vogelstein B. Science. 1992; 256: 827-830Crossref PubMed Scopus (886) Google Scholar). PG-CAT−107/−57 was constructed by inserting the HindIII-PstI DNA fragment corresponding to −107 and −57 of the GADD45promoter upstream of a minimal polyomavirus early promoter linked to a CAT gene, which was derived from PG-13 CAT that was provided by Dr. B. Vogelstein. Similarly, PG-OCT-1wt or PG-OCT-1mut was constructed by cloning 5 direct repeats of the intact OCT-1 motif (TGATTTGCATAGCCCTGTGG) or mutated OCT-1 motif (TGGCCTGCATAGCCCTGTGG) upstream of a minimal polyomavirus early promoter linked to a CAT gene via HindIII- and PstI-cloning sites. In the case of PG-CAATwt or PG-CAATmut, 3 repeats of the intact CAAT motif (TTAACCAATCAC) or mutated CAAT box (TTAACGTATCAC) were cloned into the same reporter plasmids described above. The human breast carcinoma MCF-7 line, the human lung carcinoma line H1299, and the human colorectal carcinoma line HCT116 were grown in F-12 medium supplemented with 10% fetal bovine serum as described previously (18Kastan M.B. Zhan Q. El-Deiry W.S. Carrier F. Jacks T. Walsh W.V. Plunkett B.S. Vogelstein B. Fornace Jr., A.J. Cell. 1992; 71: 587-597Abstract Full Text PDF PubMed Scopus (2922) Google Scholar, 19Zhan Q. Bae I. Kastan M.B. Fornace Jr., A.J. Cancer Res. 1994; 54: 2755-2760PubMed Google Scholar). For MMS treatment, cells were exposed to medium containing MMS (Aldrich) at 100 μg/ml for 4 h, and then the medium was replaced with fresh medium. For UV radiation, cells in 100-mm dishes were rinsed with PBS and irradiated to a dose of 10 Jm−2. Cells treated with MMS and UV were collected 16 h posttreatment for the CAT assay (20Zhan Q. Fan S. Smith M.L. Bae I. Yu K. Alamo Jr., I. O'Connor P.M. Fornace Jr., A.J. DNA Cell Biol. 1996; 15: 805-815Crossref PubMed Scopus (96) Google Scholar, 54Zhan Q. Chen I.T. Antinore M.J. Fornace Jr., A.J. Mol. Cell. Biol. 1998; 18: 2768-2778Crossref PubMed Google Scholar). 4 μg of the GADD45promoter reporter constructs and 4 μg of indicated expression vectors were cotransfected into human cells by calcium phosphate precipitation. 40 h later, cells were collected for the CAT assay. In addition, 4 μg of pCMV-GFP plasmid (which expresses green fluorescence protein) was included in each experiment. After transfection, expression of GFP protein was detected by Western blotting assay to determine transfection efficiency. Measurement of CAT activity was carried out as described previously (56Zhan Q. Carrier F. Fornace Jr., A.J. Mol. Cell. Biol. 1993; 13: 4242-4250Crossref PubMed Scopus (441) Google Scholar). Cells were collected, resuspended in 0.25m Tris (pH 7.8), and disrupted by three freeze-thaw cycles. Equal amounts of protein were used for each CAT assay. The CAT reaction mixture was incubated at 37 °C overnight, and the CAT activity was determined by measuring the acetylation of 14C-labeled chloramphenicol using thin layer chromatography. Radioactivity was measured directed with Betascope analyzer. The specific CAT activity was calculated by determining the fraction of chloramphenicol that had been acetylated. The relative CAT activity was determined by normalizing the activity of the treated samples to that of the untreated sample. Each value represented the average of at least three separate determinations (54Zhan Q. Chen I.T. Antinore M.J. Fornace Jr., A.J. Mol. Cell. Biol. 1998; 18: 2768-2778Crossref PubMed Google Scholar, 56Zhan Q. Carrier F. Fornace Jr., A.J. Mol. Cell. Biol. 1993; 13: 4242-4250Crossref PubMed Scopus (441) Google Scholar). Antibodies against BRCA1, Oct-1, NF-YA, and Jun-D were commercially provided by Santa Cruz Biotechnology (Santa Cruz, CA). For preparation of nuclear protein, exponentially growing HCT116 cells were collected, rinsed with PBS, and resuspended in 200 μl of cold buffer A (10 mm Hepes (pH 7.9); 10 mm KCl; 0.1 mm EDTA; 0.1 mm EGTA; 1 mm dithiothreitol; 0.5 mm phenylmethylsulfonyl fluoride). Following vortexing, the samples were incubated on ice for 10 min, and Nonidet P-40 was added to a final concentration of 0.5%. After centrifugation, insoluble pellets were resuspended in 100 μl of ice-cold buffer C (20 mm Hepes (pH 7.9); 400 mmKCl; 1 mm EDTA; 1 mm EGTA; 1 mmdithiothreitol; 1 mm phenylmethylsulfonyl fluoride). The samples were placed on ice and subjected to vortexing for 15 s every 10 min, over a period of 40 min. Finally, the samples were centrifuged at 14,000 × g for 10 min, and the supernatant (nuclear extract) was collected for further analysis. For immunoprecipitation and immunoblotting analysis, 300 μg of nuclear protein was immunoprecipitated with anti-BRCA1, Oct-1, NF-YA, or Jun-D antibodies and protein A-agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) for 4 h at 4 °C. The immunoprecipitated protein complexes were washed three times with lysis buffer and loaded onto a SDS-PAGE gel. After electrophoresis, the proteins were transferred to Protran membranes. Membranes were blocked in 5% milk, washed with PBST (PBS with 0.1% Tween), and incubated with anti-Oct-1, NF-YA, and BRCA1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Following washing and incubation with horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody at 1:4000 in 5% milk, the membranes were washed, and bound horseradish peroxidase was detected by ECL (Amersham Biosciences) and exposure to x-ray film. Four oligonucleotides containing biotin on the 5′-nucleotide of the sense strand were used in the pull-down assays. The sequences of these oligonucleotides are as follows: 1) wt oligo, 5′-GCAGGCTGATTTGCATAGCCCAATGGCCAAGCTGCATGCAAATGAGGCGGA, which corresponds to positions −107 to −57 of the humanGADD45 promoter; 2) mut oligo1, 5′-GCAGGCTGATTTGCATAGCCtgATGGCCAAGCTGCATGCAAATGAGGCGGA, which corresponds to positions −107 to −57 of the humanGADD45 promoter with the CAAT box mutated; 3) mut oligo2, 5′-GCAGGCTGgccTGCATAGCCCAATGGCCAAGCTGCATGCAggcGAGGCGGA, which corresponds to positions −107 to −57 of the humanGADD45 promoter with two OCT-1 motifs mutated; and 4) mut oligo3, 5′-GCAGGCTGATTTGCATAGCCtgATGGCCAAGCTGCATGCAggcGAGGCGGA, which corresponds to positions −107 to −57 of the human GADD45 promoter with two OCT-1 sites and one CAAT box mutated. These oligonucleotides were annealed to their respective complementary oligonucleotides, and 51-bp double-stranded oligonucleotides were gel-purified and used. Nuclear protein was extracted as described earlier. One microgram of each double-stranded oligonucleotide was incubated with 300 μg of nuclear protein for 20 min at room temperature in binding buffer containing 12% glycerol, 12 mm Hepes (pH 7.9), 4 mm Tris (pH 7.9), 150 mm KCl, 1 mm EDTA, 1 mmdithiothreitol, and 10 μg of poly(dI-dC) competitor. Following the incubation, 30 μl of streptavidin-agarose (Sigma) was added to the reaction and incubated at 4 °C for 4 h. Prior to this step, 300 μl of the original streptavidin-agarose bead preparation was preabsorbed with 500 μl of bovine serum albumin, 50 μg of poly(dI-dC), and 50 μg of sheared salmon sperm DNA for 30 min at 25 °C. The streptavidin-agarose beads were washed three times and resuspended in 300 μl of the binding buffer. The protein-DNA-streptavidin-agarose complex was washed three times with binding buffer and loaded onto a SDS gel. Detection of BRCA1, Oct-1, and NF-YA proteins was performed as described above (54Zhan Q. Chen I.T. Antinore M.J. Fornace Jr., A.J. Mol. Cell. Biol. 1998; 18: 2768-2778Crossref PubMed Google Scholar). Our group recently demonstrated (41Jin S. Zhao H. Fan F. Blanck P. Fan W. Colchagie A.B. Fornace Jr., A.J. Zhan Q. Oncogene. 2000; 19: 4050-4057Crossref PubMed Scopus (85) Google Scholar) that BRCA1 induces expression of GADD45 mRNA and activates theGADD45 promoter. As shown in Fig.1 A, when pHG45-CAT2, aGADD45 promoter reporter construct that spans −909 to +144 of the GADD45 promoter region, was cotransfected with either pCMV.neo (Neo) or pCR3.BRCA1 (BRCA1) into the human breast carcinoma MCF-7 cell line (wt p53), human colorectal carcinoma HCT116 cell line (wt p53), or HCT116 p53−/− cell line (where p53 alleles were deleted via homologue recombination), the GADD45 promoter reporter was strongly activated in all cell lines regardless of p53 status. To determine transfection efficiency, GFP expression vector was cotransfected with each tested plasmid. The expression of GFP protein detected by immunoblotting analysis indicated that transfection efficiency was similar among different samples with variations less than 20%. To map the BRCA1-responsive elements in theGADD45 promoter, a series of the GADD45 CAT reporters that spanned the different regions of the humanGADD45 promoter were constructed. Following cotransfection of these GADD45 promoter reporter plasmids with the BRCA1 expression vector into human colorectal carcinoma HCT116 and HCT116 p53−/− cells, CAT assays were conducted, and the CAT activities were analyzed. As illustrated in Fig. 1 B, most of theGADD45 CAT reporters were strongly activated following expression of BRCA1 protein. With progressive 5′-deletion, pHG45-CAT13 that extended 5′ only to −62 relative to the transcription start site exhibited little induction following expression of BRCA1. These observations indicate that the region between −107 and −62 contains the regulatory elements required for the responsiveness of theGADD45 promoter to BRCA1 expression. To confirm if the region from −107 to −62 is responsible for activation of the GADD45 promoter by BRCA1, we constructed a reporter plasmid designated as PG-CAT−107/−57, where a DNA fragment corresponding to the GADD45 promoter region between −107 and −57 was cloned upstream of a minimal polyomavirus promoter linked to a CAT reporter gene. This minimal polyomavirus promoter itself is unable to respond to BRCA1 expression or DNA-damaging agents (data not shown). When cotransfected with pCR3.BRCA1 (BRCA1) into HCT116 cells, PG-CAT−107/−57 exhibited induction (Fig. 1 C). In contrast, both pCMV.neo (Neo) and pC53-SN3 (p53) had no effect on this reporter, indicating that the region between −107 and −57 is capable of conferring the BRCA1 inducibility to a non-related promoter reporter. Interestingly, PG-CAT−107/−57 was also shown to be strongly induced by UV radiation and MMS, suggesting that activation of theGADD45 promoter by BRCA1 and DNA damage might share some common regulatory elements. Inspection of DNA sequence exhibits two OCT-1 motifs and one CAAT box located at this region of the humanGADD45 promoter (Fig. 1 D). To determine whether the OCT-1 and CAAT box motifs play roles in activating the GADD45 promoter following expression of BRCA1, we mutated the OCT-1 or CAAT motifs inGADD45 promoter CAT reporter constructs (53Jin S. Fan F. Fan W. Zhao H. Tong T. Blanck P. Alomo I. Rajasekaran B. Zhan Q. Oncogene. 2001; 20: 2683-2690Crossref PubMed Scopus (94) Google Scholar). It should be noted here that our previous work (54Zhan Q. Chen I.T. Antinore M.J. Fornace Jr., A.J. Mol. Cell. Biol. 1998; 18: 2768-2778Crossref PubMed Google Scholar) has demonstrated that there are certain regulatory elements located more upstream of theGADD45 promoter, such as EGR1/WT1. Therefore, to exclude the influence of such responsive elements, we choose pHG45-CAT11, which only contains the region from −121 to +144 of the GADD45promoter. Following cotransfection of these mutants of theGADD45 promoter reporters into both HCT116 (wt p53) and H1299 cells, where the p53 gene is deleted, induction of CAT activity was determined. As shown in Fig. 2, pHG45-CAT11 exhibited the strongest activation by BRCA1. Single mutation in either OCT-1 or CAAT1 motifs (pHG45-CAT11 m1, pHG45-CAT11 m2, and pHG45-CAT11 m3) had little effect on BRCA1-induced activation of the GADD45 promoter. However, dou" @default.
• W2007687079 created "2016-06-24" @default.
• W2007687079 creator A5031817044 @default.
• W2007687079 creator A5034122724 @default.
• W2007687079 creator A5037753129 @default.
• W2007687079 creator A5043459440 @default.
• W2007687079 creator A5051639526 @default.
• W2007687079 creator A5053331679 @default.
• W2007687079 creator A5061657652 @default.
• W2007687079 creator A5071593501 @default.
• W2007687079 creator A5091250034 @default.
• W2007687079 date "2002-03-01" @default.
• W2007687079 modified "2023-10-12" @default.
• W2007687079 title "BRCA1 Regulates GADD45 through Its Interactions with the OCT-1 and CAAT Motifs" @default.
• W2007687079 cites W1596182601 @default.
• W2007687079 cites W1611268078 @default.
• W2007687079 cites W1918117223 @default.
• W2007687079 cites W1966519001 @default.
• W2007687079 cites W1969795460 @default.
• W2007687079 cites W1971322560 @default.
• W2007687079 cites W1972710550 @default.
• W2007687079 cites W1974098305 @default.
• W2007687079 cites W1977035912 @default.
• W2007687079 cites W1984998883 @default.
• W2007687079 cites W1986179131 @default.
• W2007687079 cites W1988848776 @default.
• W2007687079 cites W1993797093 @default.
• W2007687079 cites W2002495914 @default.
• W2007687079 cites W2007558412 @default.
• W2007687079 cites W2011658104 @default.
• W2007687079 cites W2012300945 @default.
• W2007687079 cites W2014178540 @default.
• W2007687079 cites W2017490900 @default.
• W2007687079 cites W2019431776 @default.
• W2007687079 cites W2029884468 @default.
• W2007687079 cites W2031584190 @default.
• W2007687079 cites W2033836307 @default.
• W2007687079 cites W2033988020 @default.
• W2007687079 cites W2034317592 @default.
• W2007687079 cites W2034434851 @default.
• W2007687079 cites W2036367876 @default.
• W2007687079 cites W2048738841 @default.
• W2007687079 cites W2056403356 @default.
• W2007687079 cites W2057949133 @default.
• W2007687079 cites W2062674518 @default.
• W2007687079 cites W2068942949 @default.
• W2007687079 cites W2070676467 @default.
• W2007687079 cites W2072489106 @default.
• W2007687079 cites W2072901268 @default.
• W2007687079 cites W2080622240 @default.
• W2007687079 cites W2084491471 @default.
• W2007687079 cites W2085390184 @default.
• W2007687079 cites W2085871516 @default.
• W2007687079 cites W2086199722 @default.
• W2007687079 cites W2101791074 @default.
• W2007687079 cites W2109465247 @default.
• W2007687079 cites W2125792044 @default.
• W2007687079 cites W2128761168 @default.
• W2007687079 cites W2138024602 @default.
• W2007687079 cites W2140798038 @default.
• W2007687079 cites W2151639225 @default.
• W2007687079 cites W2164678989 @default.
• W2007687079 cites W2326537533 @default.
• W2007687079 cites W4230595181 @default.
• W2007687079 doi "https://doi.org/10.1074/jbc.m110225200" @default.
• W2007687079 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11777930" @default.
• W2007687079 hasPublicationYear "2002" @default.
• W2007687079 type Work @default.
• W2007687079 sameAs 2007687079 @default.
• W2007687079 citedByCount "119" @default.
• W2007687079 countsByYear W20076870792012 @default.
• W2007687079 countsByYear W20076870792013 @default.
• W2007687079 countsByYear W20076870792014 @default.
• W2007687079 countsByYear W20076870792015 @default.
• W2007687079 countsByYear W20076870792016 @default.
• W2007687079 countsByYear W20076870792017 @default.
• W2007687079 countsByYear W20076870792018 @default.
• W2007687079 countsByYear W20076870792020 @default.
• W2007687079 countsByYear W20076870792021 @default.
• W2007687079 countsByYear W20076870792023 @default.
• W2007687079 crossrefType "journal-article" @default.
• W2007687079 hasAuthorship W2007687079A5031817044 @default.
• W2007687079 hasAuthorship W2007687079A5034122724 @default.
• W2007687079 hasAuthorship W2007687079A5037753129 @default.
• W2007687079 hasAuthorship W2007687079A5043459440 @default.
• W2007687079 hasAuthorship W2007687079A5051639526 @default.
• W2007687079 hasAuthorship W2007687079A5053331679 @default.
• W2007687079 hasAuthorship W2007687079A5061657652 @default.
• W2007687079 hasAuthorship W2007687079A5071593501 @default.
• W2007687079 hasAuthorship W2007687079A5091250034 @default.
• W2007687079 hasBestOaLocation W20076870791 @default.
• W2007687079 hasConcept C185592680 @default.
• W2007687079 hasConceptScore W2007687079C185592680 @default.
• W2007687079 hasIssue "10" @default.
• W2007687079 hasLocation W20076870791 @default.
• W2007687079 hasOpenAccess W2007687079 @default.
• W2007687079 hasPrimaryLocation W20076870791 @default.
• W2007687079 hasRelatedWork W1531601525 @default.

• next