FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007752441> ?p ?o ?g. }

• W2007752441 endingPage "5216" @default.
• W2007752441 startingPage "5208" @default.
• W2007752441 abstract "The essential bacterial membrane protein YidC facilitates insertion and assembly of proteins destined for integration into the inner membrane. It has homologues in both mitochondria and chloroplasts. Here we report the crystal structure of the Escherichia coli YidC major periplasmic domain (YidCECP1) at 2.5Å resolution. This domain is present in YidC from Gram-negative bacteria and is more than half the size of the full-length protein. The structure reveals that YidCECP1 is made up of a large twisted β-sandwich protein fold with a C-terminal α-helix that packs against one face of the β-sandwich. Our structure and sequence analysis reveals that the C-terminal α-helix and the β-sheet that it lays against are the most conserved regions of the domain. The region corresponding to the C-terminal α-helix was previously shown to be important for the protein insertase function of YidC and is conserved in other YidC-like proteins. The structure reveals that a region of YidC that was previously shown to be involved in binding to SecF maps to one edge of the β-sandwich. Electrostatic analysis of the molecular surface for this region of YidC reveals a predominantly charged surface and suggests that the SecF-YidC interaction may be electrostatic in nature. Interestingly, YidCECP1 has significant structural similarity to galactose mutarotase from Lactococcus lactis, suggesting that this domain may have another function besides its role in membrane protein assembly. The essential bacterial membrane protein YidC facilitates insertion and assembly of proteins destined for integration into the inner membrane. It has homologues in both mitochondria and chloroplasts. Here we report the crystal structure of the Escherichia coli YidC major periplasmic domain (YidCECP1) at 2.5Å resolution. This domain is present in YidC from Gram-negative bacteria and is more than half the size of the full-length protein. The structure reveals that YidCECP1 is made up of a large twisted β-sandwich protein fold with a C-terminal α-helix that packs against one face of the β-sandwich. Our structure and sequence analysis reveals that the C-terminal α-helix and the β-sheet that it lays against are the most conserved regions of the domain. The region corresponding to the C-terminal α-helix was previously shown to be important for the protein insertase function of YidC and is conserved in other YidC-like proteins. The structure reveals that a region of YidC that was previously shown to be involved in binding to SecF maps to one edge of the β-sandwich. Electrostatic analysis of the molecular surface for this region of YidC reveals a predominantly charged surface and suggests that the SecF-YidC interaction may be electrostatic in nature. Interestingly, YidCECP1 has significant structural similarity to galactose mutarotase from Lactococcus lactis, suggesting that this domain may have another function besides its role in membrane protein assembly. The biogenesis of membrane proteins is a fundamental aspect of cell biology that involves proteinacious factors. In Gram-negative bacteria, most proteins destined for the cell envelope are targeted to the inner membrane in a post-translational manner via the cytosolic chaperone SecB or in a co-translational manner via the ribonucleoprotein SRP and its inner membrane-bound receptor FtsY (1Driessen A.J. Manting E.H. van der Does C. Nat. Struct. Biol. 2001; 8: 492-498Crossref PubMed Scopus (177) Google Scholar). At the membrane, proteins endowed with a Sec-dependent N-terminal signal peptide are exported across, or into, the inner membrane via the Sec system. The Sec system consists of the proteins SecY, SecE, and SecG, which form a heterotrimeric protein-conducting channel in the inner membrane (2Van den Berg B. Clemons Jr., W.M. Collinson I. Modis Y. Hartmann E. Harrison S.C. Rapoport T.A. Nature. 2004; 427: 36-44Crossref PubMed Scopus (975) Google Scholar); SecA, a cytosolic ATPase motor protein that unfolds (3Nouwen N. Berrelkamp G. Driessen A.J. J. Mol. Biol. 2007; 372: 422-433Crossref PubMed Scopus (26) Google Scholar) and pushes polypeptide substrates through the SecYEG channel (4Vrontou E. Economou A. Biochim. Biophys. Acta. 2004; 1694: 67-80Crossref PubMed Scopus (101) Google Scholar); and the proteins SecD, SecF, and YajC, which form a heterotrimeric complex that interacts with SecYEG (5Duong F. Wickner W. EMBO J. 1997; 16: 2756-2768Crossref PubMed Scopus (229) Google Scholar). The SecDFYajC complex has been proposed to (i) promote the release of substrate proteins from the SecYEG translocase following translocation (6Matsuyama S. Fujita Y. Mizushima S. EMBO J. 1993; 12: 265-270Crossref PubMed Scopus (157) Google Scholar) and/or (ii) enhance protein translocation by regulating SecA membrane cycling (7Duong F. Wickner W. EMBO J. 1997; 16: 4871-4879Crossref PubMed Scopus (166) Google Scholar, 8Economou A. Pogliano J.A. Beckwith J. Oliver D.B. Wickner W. Cell. 1995; 83: 1171-1181Abstract Full Text PDF PubMed Scopus (271) Google Scholar). Proteins intended for integration into the inner membrane engage the essential protein YidC, which directly contacts transmembrane segments (9Urbanus M.L. Scotti P.A. Froderberg L. Saaf A. de Gier J.W. Brunner J. Samuelson J.C. Dalbey R.E. Oudega B. Luirink J. EMBO Rep. 2001; 2: 524-529Crossref PubMed Scopus (153) Google Scholar) and facilitates insertion (10Samuelson J.C. Chen M. Jiang F. Moller I. Wiedmann M. Kuhn A. Phillips G.J. Dalbey R.E. Nature. 2000; 406: 637-641Crossref PubMed Scopus (422) Google Scholar), folding (11Nagamori S. Smirnova I.N. Kaback H.R. J. Cell Biol. 2004; 165: 53-62Crossref PubMed Scopus (160) Google Scholar), and assembly (12van der Laan M. Urbanus M.L. Ten Hagen-Jongman C.M. Nouwen N. Oudega B. Harms N. Driessen A.J. Luirink J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5801-5806Crossref PubMed Scopus (126) Google Scholar, 13van der Laan M. Bechtluft P. Kol S. Nouwen N. Driessen A.J. J. Cell Biol. 2004; 165: 213-222Crossref PubMed Scopus (175) Google Scholar) of proteins into the inner membrane. Depending on the nature of the substrate, YidC can function in a Sec-dependent (SecYEG-YidC) (14Samuelson J.C. Jiang F. Yi L. Chen M. de Gier J.W. Kuhn A. Dalbey R.E. J. Biol. Chem. 2001; 276: 34847-34852Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 15Scotti P.A. Urbanus M.L. Brunner J. de Gier J.W. von Heijne G. van der Does C. Driessen A.J. Oudega B. Luirink J. EMBO J. 2000; 19: 542-549Crossref PubMed Scopus (300) Google Scholar) or Sec-independent (“YidC only”) manner (16Serek J. Bauer-Manz G. Struhalla G. van den Berg L. Kiefer D. Dalbey R. Kuhn A. EMBO J. 2004; 23: 294-301Crossref PubMed Scopus (169) Google Scholar). It is thought that for Sec-dependent substrates, large hydrophilic domains are first exported across the membrane into the periplasm via the SecYEG channel, followed by movement of the transmembrane regions from the channel into the lipid bilayer; the latter step may be facilitated by YidC (9Urbanus M.L. Scotti P.A. Froderberg L. Saaf A. de Gier J.W. Brunner J. Samuelson J.C. Dalbey R.E. Oudega B. Luirink J. EMBO Rep. 2001; 2: 524-529Crossref PubMed Scopus (153) Google Scholar). How YidC promotes membrane protein insertion in a Sec-independent manner is unknown. YidC has been shown to co-purify with components of the Sec translocase (15Scotti P.A. Urbanus M.L. Brunner J. de Gier J.W. von Heijne G. van der Does C. Driessen A.J. Oudega B. Luirink J. EMBO J. 2000; 19: 542-549Crossref PubMed Scopus (300) Google Scholar), and a direct interaction between YidC and the SecDFYajC complex has been demonstrated, specifically with SecD and SecF (17Nouwen N. Driessen A.J. Mol. Microbiol. 2002; 44: 1397-1405Crossref PubMed Scopus (135) Google Scholar, 18Xie K. Kiefer D. Nagler G. Dalbey R.E. Kuhn A. Biochemistry. 2006; 45: 13401-13408Crossref PubMed Scopus (60) Google Scholar). YidC also plays a role in the biogenesis of lipoproteins (19Froderberg L. Houben E.N. Baars L. Luirink J. de Gier J.W. J. Biol. Chem. 2004; 279: 31026-31032Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar), but its role in this process is not clear. Structurally, Escherichia coli YidC is a 548-amino acid polypeptide with a molecular mass of 61,526 Da and a predicted isoelectric point of 7.7. Saaf et al. (20Saaf A. Monne M. de Gier J.W. von Heijne G. J. Biol. Chem. 1998; 273: 30415-30418Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) have experimentally mapped the topology of YidC and shown that it consists of 6 transmembrane regions (TM) with a large ∼35-kDa periplasmic domain (residues 24-342) located between transmembrane regions 1 and 2 (Fig. 1A). Deletion analyses have revealed that YidC insertase function is located mainly in the C-terminal five transmembrane regions (18Xie K. Kiefer D. Nagler G. Dalbey R.E. Kuhn A. Biochemistry. 2006; 45: 13401-13408Crossref PubMed Scopus (60) Google Scholar, 21Jiang F. Chen M. Yi L. de Gier J.W. Kuhn A. Dalbey R.E. J. Biol. Chem. 2003; 278: 48965-48972Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Remarkably, up to 90% of the 35-kDa YidC periplasmic domain (residues 25-323) can be deleted without affecting inner membrane protein biogenesis or cell viability (18Xie K. Kiefer D. Nagler G. Dalbey R.E. Kuhn A. Biochemistry. 2006; 45: 13401-13408Crossref PubMed Scopus (60) Google Scholar, 21Jiang F. Chen M. Yi L. de Gier J.W. Kuhn A. Dalbey R.E. J. Biol. Chem. 2003; 278: 48965-48972Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). YidC is conserved in all three domains of life and is homologous to the well characterized proteins Oxa1 and ALB3 that are found in the inner membrane of mitochondria and the thylakoid membrane of chloroplasts, respectively (22Luirink J. Samuelsson T. de Gier J.W. FEBS Lett. 2001; 501: 1-5Crossref PubMed Scopus (121) Google Scholar). Consistent with functional mapping studies of insertase activity, amino acid sequence alignments reveal that the C-terminal ∼200 residues of YidC, corresponding to transmembrane regions 2-5, are conserved in prokaryotic and eukaryotic versions of the protein (22Luirink J. Samuelsson T. de Gier J.W. FEBS Lett. 2001; 501: 1-5Crossref PubMed Scopus (121) Google Scholar). Further, Oxa1 has been shown to complement YidC insertase activity when expressed in E. coli (23van Bloois E. Nagamori S. Koningstein G. Ullers R.S. Preuss M. Oudega B. Harms N. Kaback H.R. Herrmann J.M. Luirink J. J. Biol. Chem. 2005; 280: 12996-13003Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar), underscoring the functional significance of this region in catalyzing protein insertion. By comparison, the function of the YidC periplasmic domain remains largely unknown; nevertheless, the conservation of this domain in Gram-negative bacteria suggests that it performs a significant, but as yet unrecognized, role in the cell. To gain further insight into the structure and function of YidC, we sought to determine the structure of the YidC periplasmic domain. We report here the crystal structure of residues 57-346 of E. coli YidC to 2.5 Å resolution. Cloning and Mutagenesis–A 942-base pair DNA fragment, coding for residues 26-340 of E. coli YidC, was amplified from E. coli K-12 genomic DNA using the forward primer 5′-ATGCAAGCATATGGATAAAAACCCGCAACCTCAGG and the reverse primer 5′-ATGCCTACTCGAGGCTGCCGCGCGGCACCAGCAGCGGCTGAGAGATGAACC that contain the restriction sites NdeI and XhoI, respectively. The resulting PCR product was ligated into vector pET20b (Novagen). The YidCEC(26-340)His construct includes an N-terminal methionine and a C-terminal thrombin/hexahistidine affinity tag bearing the sequence LVPRGSLEHHHHHH. DNA sequencing (Macrogen) confirmed that the YidC insert matched the sequence reported in the Swiss-Prot data base (P25714). To facilitate crystallization, several residues within this construct were targeted for mutagenesis using the QuikChange method (Stratagene). The primer pair 5′-GTACTCCACGCCTGACGCGGCGTATGCGGCATACGCGTTCGATACCATTGCCG and 5′-CGGCAATGGTATCGAACGCGTATGCCGCATACGCCGCGTCAGGCGTGGAGTAC was used to construct a version of YidCEC(26-340)His that bears the mutations E228A, K229A, E231A, K232A, and K234A. This construct (referred to as pYidCECP1) yielded crystals suitable for structure determination. The expressed pYidCECP1 encodes 330 residues has a molecular mass of 35,702 Da and a theoretical pI of 5.3. Protein Expression and Purification–The expression plasmid pYidCECP1 was transformed into E. coli expression strain BL21(DE3) and used to inoculate (1:100 back dilution) 3 liters of Luria Bertani medium containing ampicillin (100 μg/ml). Cultures were grown at 37 °C to an A600 of 0.6 and induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside for 3 h. Cells were harvested by centrifugation and lysed using an Avestin Emulsiflex-3C cell homogenizer. The lysate was clarified by centrifugation (30,000 × g) for 30 min at 4 °C. The supernatant was applied to a 5-ml nickel-nitrilotriacetic acid column (Qiagen) that had been equilibrated with 20 mm Tris-HCl, pH 8.0, 100 mm NaCl (buffer A). The column was washed with 30 ml of buffer A containing 20 mm imidazole and eluted with a step gradient (100-500 mm imidazole in buffer A at 100-mm increments) in 5-ml volumes. The majority of the protein eluted from the column in fractions containing 100, 200, and 300 mm imidazole, which were pooled and concentrated using an Amicon ultra centrifugal filter device (Millipore). Concentrated protein was then applied to a Sephacryl S-100 HiPrep 26/60 size-exclusion chromatography column on anÁKTA Prime system (GE Health Care) running at 1 ml/min in buffer A. Fractions containing pure YidCECP1 were pooled and concentrated to 32 mg/ml and stored at -80 °C. Analytical size-exclusion chromatography in line with Multi-Angle Light Scattering analysis is consistent with YidCECP1 being a monodispersed monomer in solution (data not shown). Se-Met-incorporated YidCECP1 was prepared by growing an overnight culture of BL21(DE3) transformed with pYidCECP1 in M9 minimal medium supplemented with 100 μg/ml ampicillin. 30 ml of overnight culture was used to inoculate 3 × 1 liter of M9 minimal medium (100 μg/ml ampicillin) that was grown at 37 °C to an A600 of 0.6. Each 1-liter culture was then directly supplemented with a mixture of the following amino acids: 100 mg of lysine, phenylalanine, threonine; 50 mg of isoleucine, leucine, valine; 60 mg of selenomethionine. After 15 min, protein expression was induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside (final concentration) for 3 h at 37 °C. The purification procedure of Se-Met-incorporated YidCECP1 was the same as that used for the native protein. Crystallization–The crystals used for single wavelength anomalous diffraction data collection were grown by the hanging drop vapor diffusion method. The crystallization drops were prepared by mixing 1 μl of protein (32 mg/ml) with 1 μl of reservoir solution and then equilibrating the drop against 1 ml of reservoir solution. The YidCECP1 construct yielded crystals in the space group I4122 with unit cell dimensions 126.1 × 126.1 × 288.4 Å. The crystals have two molecules in the asymmetric unit with a Matthews coefficient of 4.01 Å3 Da-1 (69.36% solvent). The optimal crystallization reservoir condition was 0.1 m glycine, pH 3.1, 0.2 m (NH4)2SO4, and 13% polyethylene glycol 3350. Crystallization was performed at room temperature (∼22 °C). The cryo-solution condition contained 0.1 m glycine, pH 3.1, 0.2 m (NH4)2SO4, 15% polyethylene glycol 3350, and 20% glycerol. Crystals were incubated in cryo-solution for ∼5 min before being flash-cooled in liquid nitrogen. Data Collection–Diffraction data were collected on selenomethionine-incorporated crystals at beamline 8.2.2 of the Advance Light Source, Lawrence Berkeley Laboratory, University of California at Berkeley using a Quantum 315 ADSC area detector. The crystal-to-detector distance was 320 mm. Data were collected with 1° oscillations, and each image was exposed for 3 s. The diffraction data were processed with the program HKL2000 (24Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref Scopus (38440) Google Scholar). See Table 1 for data collection statistics.TABLE 1Data collection, phasing, and refinement statisticsCrystal ParametersSpace group14122a,b,c (Å)126.1, 126.1, 288.5Data Collection StatisticsWavelength (Å)0.979474Resolution (Å)50.0-2.5 (2.6-2.5)Total Reflections557,038Unique reflections40,327 (3687)Rmergea, where Ii(hkl) is the observed intensity, and I(hkl)¯ is the average intensity obtained from multiple observations of symmetry-related reflections after rejections.0.079 (0.379)Mean (I)/σ(I)44.7 (4.0)Completeness (%)99.1 (92.0)Redundancy13.8 (9.7)Phasing StatisticsNumber of Sites8 (out of a possible 10)Overall FOMbFOM = figure of merit = , where α is the phase angle and P(α) is the phase probability distribution. (50-2.5 Å)0.49Overall FOMbFOM = figure of merit = , where α is the phase angle and P(α) is the phase probability distribution. (after density modification)0.72Refinement StatisticsProtein molecules (chains) in A.U.2Residues558Water molecules80Total number of atoms4,371Rcrystc/Rfreed (%)21.2/24.9Average B-factor (Å2) (all atoms)33.9Rms deviation on angles (°)1.515Rms deviation on bonds (Å)0.015a , where Ii(hkl) is the observed intensity, and I(hkl)¯ is the average intensity obtained from multiple observations of symmetry-related reflections after rejections.b FOM = figure of merit = , where α is the phase angle and P(α) is the phase probability distribution. Open table in a new tab Structure Determination and Refinement–The YidCECP1 structure was solved by single wavelength anomalous dispersion using a data set collected at the peak wavelength (0.9794 Å), the program SHELX (25Schneider T.R. Sheldrick G.M. Acta Crystallogr. 2002; 58: 1772-1779Crossref PubMed Scopus (1575) Google Scholar) within ccp4i (26Collaborative Computational Project, No. 4 Acta Crystallogr. Sect. D Biol. Crystallogr. 50, 760-763Google Scholar), and Autosol within PHENIX version 1.3 (27Adams P.D. Grosse-Kunstleve R.W. Hung L.W. Ioerger T.R. McCoy A.J. Moriarty N.W. Read R.J. Sacchettini J.C. Sauter N.K. Terwilliger T.C. Acta Crystallogr. 2002; 58: 1948-1954Crossref PubMed Scopus (3594) Google Scholar). SHELXC found eight of the possible ten selenium sites. The program Autobuild within PHENIX version 1.3 (27Adams P.D. Grosse-Kunstleve R.W. Hung L.W. Ioerger T.R. McCoy A.J. Moriarty N.W. Read R.J. Sacchettini J.C. Sauter N.K. Terwilliger T.C. Acta Crystallogr. 2002; 58: 1948-1954Crossref PubMed Scopus (3594) Google Scholar) automatically constructed ∼90% of the polypeptide chain and performed density modification. The rest of the model was built using the program Coot (28Emsley P. Cowtan K. Acta Crystallogr. 2004; 60: 2126-2132Crossref PubMed Scopus (22994) Google Scholar). The structure was refined using the program Refmac5 (29Winn M.D. Isupov M.N. Murshudov G.N. Acta Crystallogr. 2001; 57: 122-133Google Scholar) and the program CNS (30Brunger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. 1998; 54: 905-921Crossref PubMed Scopus (16947) Google Scholar). The final models were obtained by restrained refinement in Refmac5 with Translation Liberation Screw Rotation (TLS) restraints obtained from the TLS motion determination server (31Painter J. Merritt E.A. Acta Crystallogr. 2006; 62: 439-450Google Scholar). The data collection, phasing, and refinement statistics are summarized in Table 1. Structural Analysis–Secondary structural analysis was performed with the programs DSSP (32Kabsch W. Sander E. Biopolymers. 1983; 22: 2577-2637Crossref PubMed Scopus (12173) Google Scholar), HERA (33Hutchinson E.G. Thornton J.M. Proteins. 1990; 8: 203-212Crossref PubMed Scopus (101) Google Scholar), and Promotif (34Hutchinson E.G. Thornton J.M. Protein Sci. 1996; 5: 212-220Crossref PubMed Scopus (994) Google Scholar). The programs SUPERIMPOSE (35Diederichs K. Proteins. 1995; 23: 187-195Crossref PubMed Scopus (57) Google Scholar) and SUPERPOSE (36Maiti R. Van Domselaar G.H. Zhang H. Wishart D.S. Nucleic Acids Res. 2004; 32 (Web Server issue): W590-W594Crossref PubMed Scopus (488) Google Scholar) were used to overlap coordinates for structural comparison. The program CONTACT within the program suite CCP4 (26Collaborative Computational Project, No. 4 Acta Crystallogr. Sect. D Biol. Crystallogr. 50, 760-763Google Scholar) was used to measure the hydrogen bonding and van der Waals contacts. The program CASTp (37Liang J. Edelsbrunner H. Woodward C. Protein Sci. 1998; 7: 1884-1897Crossref PubMed Scopus (861) Google Scholar) was used to analyze the molecular surface and search for potential substrate binding sites. The program SURFACE RACER 1.2 (38Tsodikov O.V. Record Jr., M.T. Sergeev Y.V. J. Comput. Chem. 2002; 23: 600-609Crossref PubMed Scopus (347) Google Scholar) was used to measure the solvent-accessible surface of the protein and individual atoms within the protein. A probe radius of 1.4 Å was used in the calculations. The Protein-Protein Interaction Server (39Jones S. Thornton J.M. Prog. Biophys. Mol. Biol. 1995; 63: 31-65Crossref PubMed Scopus (492) Google Scholar, 40Jones S. Thornton J.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13-20Crossref PubMed Scopus (2262) Google Scholar) was used to analyze the interactions between the molecules in the asymmetric unit. The stereochemistry of the structure was analyzed with the program PROCHECK (41Laskowski R.A. MacArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar). The DALI server was used to find proteins with similar protein folds (42Holm L. Sander C. Nucleic Acids Res. 1998; 26: 316-319Crossref PubMed Scopus (595) Google Scholar). Figure Preparation–Figures were prepared using PyMOL (43DeLano W.L. The PyMOL Molecular Graphics System. DeLano Scientific, San Carlos, CA2002Google Scholar). The alignment figure was prepared using the programs ClustalW (44Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (55389) Google Scholar) and ESPript (45Gouet P. Courcelle E. Stuart D.I. Metoz F. Bioinformatics. 1999; 15: 305-308Crossref PubMed Scopus (2513) Google Scholar). Structure of YidCECP1–We have produced a C-terminal His6-tagged soluble construct of the major periplasmic domain of E. coli YidC (YidCECP1) that spans residues Asp26-Leu340 (Fig. 1A). High resolution size-exclusion chromatography analysis and multiangle light scattering analysis of the YidCECP1 reveal that the protein is very soluble in the absence of detergents and is monomeric in nature (data not shown). YidCECP1 was crystallized, and the structure was solved by single wavelength anomalous diffraction and refined to 2.5 Å resolution. There are two molecules in the asymmetric unit, and the refined structure includes residues 57-340. In addition, there is electron density for 3 residues at the C terminus that corresponds to the affinity tag used to purify the protein. There is no visible electron density observed for a presumably mobile loop that spans residues 207-216. Additionally, no electron density is observed for the N-terminal residues 26-56. To facilitate crystallization and improve the diffraction quality of the crystals the following mutations were introduced into YidCECP1: E228A, K229A, E231A, K232A, and K234A. These lysine and glutamate residues were targeted for mutation to alanine in an attempt to reduce the degree of conformational entropy associated with longer side chains that may impede crystallization (46Derewenda Z.S. Vekilov P.G. Acta Crystallogr. 2006; 62: 116-124Crossref PubMed Scopus (195) Google Scholar, 47Longenecker K.L. Garrard S.M. Sheffield P.J. Derewenda Z.S. Acta Crystallogr. 2001; 57: 679-688Google Scholar). The mutant YidCECP1 protein behaves identically to the wild-type YidCECP1 with regard to its solubility, chromatographic behavior, and light-scattering properties. In addition, no difference was seen between the mutant and wild-type YidCECP1 proteins when analyzed by CD spectroscopy (data not shown). The YidCECP1 Protein Fold–YidCECP1 is a large distorted β-sandwich motif (super sandwich) constructed from 18 β-strands in two β-sheets and three α-helices (Fig. 1). Sheet 1 of YidCECP1 is a mixed β-sheet that contains β-strands 1-6, 10, 13, 16, and 17, and sheet 2 is completely antiparallel and contains strands 7-9, 11, 12, 14, 15, and 18. Strand 4 within sheet 1 is highly twisted in order to maintain anti-parallel interactions between strands 2 and 5. Helix 1 (residues 235-239, between β-strands 12 and 13) sits at the mid-point of the structure between β-sheet 1 and β-sheet 2 and packs against the edge of the β-sandwich. Helix 2 (314-317) and helix 3 (325-336) are positioned near the C terminus and pack against β-sheet 2. There are also two 310-helices spanning residues 123-125 and 156-158, respectively. YidCECP1 has the approximate dimensions of 38 × 60 × 45 Å with a significant groove formed along the face of the twisted β-sheet 1. The groove formed along the opposing β-sheet (sheet 2) of the sandwich is partially occupied by α-helix 3. Examination of surface electrostatics indicates that YidCECP1 does not appear to have any major hydrophobic surface that could accommodate interactions with the acyl chains of the membrane lipids but could possibly interact with the lipid head groups. This is consistent with the solubility of YidCECP1 in the absence of detergents. Protein-Protein Interactions Observed in the YidCECP1 Crystals–Superposition of the two molecules in the asymmetric unit shows that the only significant structural difference between molecule A and molecule B is a shift in the orientation of the C-terminal α-helix 3 (Fig. 2). The difference in the orientation of helix 3 is likely due to crystal-packing interactions. As mentioned earlier, to facilitate crystallization, five mutations were introduced into a region of YidCECP1 to replace a cluster of lysine and glutamate residues. The structure shows that these residues are located on or near β-strand 12. Molecule A makes a significant number of crystal contacts between its C terminus and the residues that were mutated in a symmetry-related molecule A. This type of interaction is not observed in molecule B, giving a possible explanation for the differences seen in the orientation for the C-terminal α-helix 3. Conserved Regions of YidCECP1–Amino acid sequence alignment of eight YidC variants from various Gram-negative bacterial species reveals a number of conserved residues located throughout YidECP1 (Fig. 3). Most notably, the region at the extreme C terminus of the construct corresponding to α-helix 3 is well conserved. PFAM (48Finn R.D. Mistry J. Schuster-Bockler B. Griffiths-Jones S. Hollich V. Lassmann T. Moxon S. Marshall M. Khanna A. Durbin R. Eddy S.R. Sonnhammer E.L. Bateman A. Nucleic Acids Res. 2006; 34 (Data base issue): D247-D251Crossref PubMed Scopus (1831) Google Scholar) analysis reveals that the residues 61-350 of YidC define a conserved domain PFAM-B_1222 that is remarkably consistent with the region of YidCECP1 observed in the electron density (residues 57-340). Sixty-one YidC variants were extracted from the domain PFAM-B_1222, aligned using ClustalW (44Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (55389) Google Scholar), and analyzed using the program CONSURF (49Glaser F. Pupko T. Paz I. Bell R.E. Bechor-Shental D. Martz E. Ben-Tal N. Bioinformatics. 2003; 19: 163-164Crossref PubMed Scopus (924) Google Scholar) that maps conserved residues onto a three-dimensional structure. As shown in Fig. 4, a significant number of conserved residues map to α-helix 3 and to β-strands 11, 12, 14, 15, 18 that cluster on the face of β-sheet 2 and pack against α-helix 3 (Fig. 4A). Closer inspection reveals that many of the conserved residues are involved in interactions between α-helix 3 and β-sheet 2 (Fig. 4B), suggesting that the interaction may be biologically significant.FIGURE 4Conserved amino acids within the large periplasmic domain of YidC in Gram-negative bacteria mapped onto the structure of YidCECP1. A, the regions that are most conserved are rendered in purple, the least conserved in blue. Significant conservation is seen in α-helix 3 and the end of β-sheet 2, which α-helix 3 packs against. B, a close-up view of the most conserved region, as seen from the end of α-helix 3. The side chains are shown as sticks, and the most conserved residues in this region are labeled.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Mapping Functional Regions–Previous studies of YidC have mapped two functional regions to the YidC periplasmic domain. First, deletion analysis of YidC has revealed that residues 323-346 of the first periplasmic domain are essential for cell viability and insertase activity (18Xie K. Kiefer D. Nagler G. Dalbey R.E. Kuhn A. Biochemistry. 2006; 45: 13401-13408Crossref PubMed Scopus (60) Google Scholar, 21Jiang F. Chen M. Yi L. de Gier J.W. Kuhn A. Dalbey R.E. J. Biol. Chem. 2003; 278: 48965-48972Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). This region corresponds to the conserved α-helix 3 at the C terminus of Yid-CECP1 (Fig. 5). Second, Xie et al. (18Xie K. Kiefer D. Nagler G. Dalbey R.E. Kuhn A. Biochemistry. 2006; 45: 13401-13408Crossref PubMed Scopus (60) Google Scholar) have shown that residues 215-265 of E. coli YidC are sufficient for" @default.
• W2007752441 created "2016-06-24" @default.
• W2007752441 creator A5013070266 @default.
• W2007752441 creator A5048104268 @default.
• W2007752441 date "2008-02-01" @default.
• W2007752441 modified "2023-10-13" @default.
• W2007752441 title "Crystal Structure of the Major Periplasmic Domain of the Bacterial Membrane Protein Assembly Facilitator YidC" @default.
• W2007752441 cites W1539796472 @default.
• W2007752441 cites W1546001194 @default.
• W2007752441 cites W1581713598 @default.
• W2007752441 cites W1895859721 @default.
• W2007752441 cites W1919647973 @default.
• W2007752441 cites W1973904153 @default.
• W2007752441 cites W1975753413 @default.
• W2007752441 cites W1975843918 @default.
• W2007752441 cites W1977966298 @default.
• W2007752441 cites W1980910728 @default.
• W2007752441 cites W1985629904 @default.
• W2007752441 cites W1985798656 @default.
• W2007752441 cites W1986191025 @default.
• W2007752441 cites W1989729631 @default.
• W2007752441 cites W1990580956 @default.
• W2007752441 cites W2001103063 @default.
• W2007752441 cites W2001641653 @default.
• W2007752441 cites W2007451197 @default.
• W2007752441 cites W2008708467 @default.
• W2007752441 cites W2010250752 @default.
• W2007752441 cites W2011488277 @default.
• W2007752441 cites W2024809975 @default.
• W2007752441 cites W2028123014 @default.
• W2007752441 cites W2031772330 @default.
• W2007752441 cites W2033534477 @default.
• W2007752441 cites W2048052250 @default.
• W2007752441 cites W2049749552 @default.
• W2007752441 cites W2063643225 @default.
• W2007752441 cites W2064656060 @default.
• W2007752441 cites W2073726493 @default.
• W2007752441 cites W2083478956 @default.
• W2007752441 cites W2087347863 @default.
• W2007752441 cites W2098042241 @default.
• W2007752441 cites W2105902442 @default.
• W2007752441 cites W2106357210 @default.
• W2007752441 cites W2106882534 @default.
• W2007752441 cites W2107521254 @default.
• W2007752441 cites W2115121494 @default.
• W2007752441 cites W2115558294 @default.
• W2007752441 cites W2115592403 @default.
• W2007752441 cites W2121293808 @default.
• W2007752441 cites W2126106174 @default.
• W2007752441 cites W2129786506 @default.
• W2007752441 cites W2136280642 @default.
• W2007752441 cites W2142529984 @default.
• W2007752441 cites W2150444353 @default.
• W2007752441 cites W2151687360 @default.
• W2007752441 cites W2155479906 @default.
• W2007752441 cites W2166161543 @default.
• W2007752441 cites W247603372 @default.
• W2007752441 doi "https://doi.org/10.1074/jbc.m708936200" @default.
• W2007752441 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18093969" @default.
• W2007752441 hasPublicationYear "2008" @default.
• W2007752441 type Work @default.
• W2007752441 sameAs 2007752441 @default.
• W2007752441 citedByCount "56" @default.
• W2007752441 countsByYear W20077524412012 @default.
• W2007752441 countsByYear W20077524412013 @default.
• W2007752441 countsByYear W20077524412014 @default.
• W2007752441 countsByYear W20077524412015 @default.
• W2007752441 countsByYear W20077524412016 @default.
• W2007752441 countsByYear W20077524412017 @default.
• W2007752441 countsByYear W20077524412018 @default.
• W2007752441 countsByYear W20077524412019 @default.
• W2007752441 countsByYear W20077524412020 @default.
• W2007752441 countsByYear W20077524412021 @default.
• W2007752441 countsByYear W20077524412022 @default.
• W2007752441 countsByYear W20077524412023 @default.
• W2007752441 crossrefType "journal-article" @default.
• W2007752441 hasAuthorship W2007752441A5013070266 @default.
• W2007752441 hasAuthorship W2007752441A5048104268 @default.
• W2007752441 hasBestOaLocation W20077524411 @default.
• W2007752441 hasConcept C104317684 @default.
• W2007752441 hasConcept C12554922 @default.
• W2007752441 hasConcept C134306372 @default.
• W2007752441 hasConcept C144647389 @default.
• W2007752441 hasConcept C149011108 @default.
• W2007752441 hasConcept C17744445 @default.
• W2007752441 hasConcept C185592680 @default.
• W2007752441 hasConcept C199539241 @default.
• W2007752441 hasConcept C201663137 @default.
• W2007752441 hasConcept C2776831358 @default.
• W2007752441 hasConcept C2993175405 @default.
• W2007752441 hasConcept C33923547 @default.
• W2007752441 hasConcept C36503486 @default.
• W2007752441 hasConcept C41625074 @default.
• W2007752441 hasConcept C547475151 @default.
• W2007752441 hasConcept C55493867 @default.
• W2007752441 hasConcept C62465871 @default.
• W2007752441 hasConcept C70721500 @default.
• W2007752441 hasConcept C8010536 @default.

• next