FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007803500> ?p ?o ?g. }

• W2007803500 endingPage "32237" @default.
• W2007803500 startingPage "32230" @default.
• W2007803500 abstract "Epidermal growth factor (EGF) in corneal epithelial cells stimulates proliferation by inducing capacitative calcium entry (CCE). However, neither the identity nor the mechanism of activation of the plasma membrane influx pathway that mediates CCE is known. Accordingly, we determined, in human corneal epithelial cells, whether or not (i) CCE is dependent upon stimulation of storeoperated channel (SOC) activity, (ii) the canonical transient receptor potential (TRP) protein isoform TRPC4 is a component of such channels, and (iii) suppression of TRPC4 protein expression decreases EGF-induced stimulation of SOC activity and proliferation. The whole cell patch-clamp technique was used to monitor TRPC4-mediated stimulation of SOC activity following intracellular calcium store depletion and induction of CCE. TRPC4 small interfering RNA transfection suppressed TRPC4 protein expression. Reverse transcription-PCR and Western blot analysis were used to assess knockdown efficiency of mRNA and protein expression. [3H]Thymidine incorporation was used to evaluate EGF-in-duced mitogenesis. Ca2+ transients were measured by single-cell fluorescence imaging. TRPC4 knockdown decreased mRNA and protein expression by 89 and 87%, respectively. In these cells, EGF-induced SOC activation elicited by intracellular calcium store depletion was obviated; 2) EGF-induced CCE fell by 76%; 3) EGF-induced stimulation of SOC activity was eliminated; and 4) EGF-induced increases in proliferation fell by 54%. Thus, TRPC4 is a component of SOC in human corneal epithelial cells whose activation by EGF is requisite for an optimum mitogenic response to this growth factor. Epidermal growth factor (EGF) in corneal epithelial cells stimulates proliferation by inducing capacitative calcium entry (CCE). However, neither the identity nor the mechanism of activation of the plasma membrane influx pathway that mediates CCE is known. Accordingly, we determined, in human corneal epithelial cells, whether or not (i) CCE is dependent upon stimulation of storeoperated channel (SOC) activity, (ii) the canonical transient receptor potential (TRP) protein isoform TRPC4 is a component of such channels, and (iii) suppression of TRPC4 protein expression decreases EGF-induced stimulation of SOC activity and proliferation. The whole cell patch-clamp technique was used to monitor TRPC4-mediated stimulation of SOC activity following intracellular calcium store depletion and induction of CCE. TRPC4 small interfering RNA transfection suppressed TRPC4 protein expression. Reverse transcription-PCR and Western blot analysis were used to assess knockdown efficiency of mRNA and protein expression. [3H]Thymidine incorporation was used to evaluate EGF-in-duced mitogenesis. Ca2+ transients were measured by single-cell fluorescence imaging. TRPC4 knockdown decreased mRNA and protein expression by 89 and 87%, respectively. In these cells, EGF-induced SOC activation elicited by intracellular calcium store depletion was obviated; 2) EGF-induced CCE fell by 76%; 3) EGF-induced stimulation of SOC activity was eliminated; and 4) EGF-induced increases in proliferation fell by 54%. Thus, TRPC4 is a component of SOC in human corneal epithelial cells whose activation by EGF is requisite for an optimum mitogenic response to this growth factor. Maintenance of the optical attributes and transparency of the cornea is essential for normal vision. These properties are partially dependent upon the ability of the outer corneal epithelial layer to elicit fluid flow from the stromal layer into the tear film layer. These flows are not as great as those mediated by the inner endothelial layer, but are essential to the maintenance of ocular surface health (1Klyce S.D. Investig. Ophthalmol. Vis. Sci. 1977; 16: 968-973PubMed Google Scholar). Another epithelial property required for normal vision is that this layer provides a barrier function against noxious agents and toxins (2Lu L. Reinach P.S. Kao W.W. Exp. Biol. Med. 2001; 226: 653-664Crossref PubMed Scopus (341) Google Scholar). Barrier properties are maintained by the tight junctional integrity that exists between neighboring epithelial cells. They depend upon continuous proliferation of basal layer cells to replace the differentiating superficial cell layers that are ultimately sloughed off into the tears. Therefore, corneal epithelial function is sustained provided the basal cells proliferate at a rate adequate for replacing the dying cells in the superficial layers. Corneal epithelial basal cell proliferation is controlled by a host of cytokines, e.g. epidermal growth factor (EGF), 2The abbreviations used are: EGF, epidermal growth factor; CCE, capacitative calcium entry; ICS, intracellular calcium store(s); IP3, inositol 1,4,5-trisphosphate; SOC, store-operated channel(s); TRP, transient receptor potential; TRPC, TRP canonical subfamily; RCEC, rabbit corneal epithelial cells; 2-APB, 2-aminoethoxydiphenyl borate; HCEC, human corneal epithelial cells; RT, reverse transcription; siRNA, small interfering RNA; CPA, cyclopiazonic acid; pF, picofarad(s); DIDS, 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid. that activate their cognate receptors in the deeper layers of the epithelium. Following injury to the corneal epithelial layer, wound repair is stimulated by autocrine-mediated increases in the synthesis of EGF and various other growth factors. EGF stimulates wound closure in vitro by a myriad of signaling pathways. One of the events in these cascades includes the activation of calcium transients through stimulation of capacitative calcium entry (CCE) (3Yang H. Sun X. Wang Z. Ning G. Zhang F. Kong J. Lu L. Reinach P.S. J. Membr. Biol. 2003; 194: 47-58Crossref PubMed Scopus (40) Google Scholar). According to this paradigm, depletion of intracellular calcium stores (ICS) occurs as a result of calcium loss through inositol 1,4,5-trisphosphate (IP3) receptor-linked pathways. Such losses elicit a feedback signal to the plasma membrane and result in the activation of store-operated channels (SOC) (4Putney Jr., J.W. Bird G.S. Cell. 1993; 75: 199-201Abstract Full Text PDF PubMed Scopus (394) Google Scholar, 5Clapham D.E. Cell. 1995; 80: 259-268Abstract Full Text PDF PubMed Scopus (2272) Google Scholar, 6Tsien R.W. Tsien R.Y. Annu. Rev. Cell Biol. 1990; 6: 715-760Crossref PubMed Scopus (1022) Google Scholar, 7Putney Jr., J.W. Bird G.S. Endocr. Rev. 1993; 14: 610-631Crossref PubMed Scopus (486) Google Scholar). In the corneal epithelium, however, neither the nature of the feedback signal nor the mechanisms underlying the increases in plasma membrane calcium influx induced by this growth factor are known (8Putney Jr., J.W. Cell Calcium. 1986; 7: 1-12Crossref PubMed Scopus (2115) Google Scholar). Using tissues other than the corneal epithelium, two different alternatives have been proposed to describe how ICS depletion activates plasma membrane calcium influx. One is the conformational coupling model, which involves direct communication between IP3 receptors in the ICS and plasma membrane-permeable channels (9Irvine R.F. FEBS Lett. 1990; 263: 5-9Crossref PubMed Scopus (580) Google Scholar, 10Berridge M.J. Biochem. J. 1995; 312: 1-11Crossref PubMed Scopus (1050) Google Scholar). The other involves communication between ICS and these channels due to release of a diffusible signal from the ICS, the so-called calcium influx factor (11Randriamampita C. Tsien R.Y. Nature. 1993; 364: 809-814Crossref PubMed Scopus (789) Google Scholar, 12Csutora P. Su Z. Kim H.Y. Bugrim A. Cunningham K.W. Nuccitelli R. Keizer J.E. Hanley M.R. Blalock J.E. Marchase R.B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 121-126Crossref PubMed Scopus (103) Google Scholar). Irrespective of the specific mechanism, calcium entry occurs with variable ionic selectivity after activation of SOC. Transient receptor potential (TRP) proteins are members of a superfamily made up of five different major subfamilies (13Harteneck C. Cell Calcium. 2003; 33: 303-310Crossref PubMed Scopus (32) Google Scholar). They are components of plasma membrane influx pathways, activated directly by depletion of ICS and/or receptor-linked signal transduction cascades. One such subfamily is the canonical family, i.e. TRPC, which contains seven different isoforms (14Montell C. Sci. STKE 2001. 2001; : RE1Google Scholar). Calcium influx-dependent proliferation occurs through plasma membrane channels that contain a variety of TRPC isoforms, including TRPC1, TRPC4, and TRPC6 (15Landsberg J.W. Yuan J.X. News Physiol. Sci. 2004; 19: 44-50PubMed Google Scholar, 16Zhang S. Remillard C.V. Fantozzi I. Yuan J.X. Am. J. Physiol. 2004; 287: C1192-C1201Crossref PubMed Scopus (95) Google Scholar). However, in corneal epithelial cells, there is no information regarding a role for TRPC expression in mediating CCE and the mitogenic response to EGF. Furthermore, the importance of such expression to SOC function has not been described. In rabbit corneal epithelial cells (RCEC), EGF induces ICS depletion, which in turn triggers CCE (3Yang H. Sun X. Wang Z. Ning G. Zhang F. Kong J. Lu L. Reinach P.S. J. Membr. Biol. 2003; 194: 47-58Crossref PubMed Scopus (40) Google Scholar). This effect of EGF is fully suppressed by 2-aminoethoxydiphenyl borate (2-APB). However, the mechanism of this effect could not be clarified because there is increasing realization that 2-APB can have numerous other effects besides suppression of SOC activity (17Gregory R.B. Rychkov G. Barritt G.J. Biochem. J. 2001; 354: 285-290Crossref PubMed Scopus (170) Google Scholar). 2-APB can have multiple effects, even within the same tissue. In some cases, 2-APB blocks IP3 receptor-mediated calcium release from ICS and gap junctional coupling (18Ma H.T. Patterson R.L. van Rossum D.B. Birnbaumer L. Mikoshiba K. Gill D.L. Science. 2000; 287: 1647-1651Crossref PubMed Scopus (534) Google Scholar, 19van Rossum D.B. Patterson R.L. Ma H.T. Gill D.L. J. Biol. Chem. 2000; 275: 28562-28568Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 20Rychkov G.Y. Litjens T. Roberts M.L. Barritt G.J. Cell Calcium. 2005; 37: 183-191Crossref PubMed Scopus (29) Google Scholar, 21Harks E.G. Camina J.P. Peters P.H. Ypey D.L. Scheenen W.J. van Zoelen E.J. Theuvenet A.P. FASEB J. 2003; 17: 941-943Crossref PubMed Scopus (66) Google Scholar), whereas it also activates the heat-sensitive TRP protein channel TRPV3 (22Chung M.K. Lee H. Mizuno A. Suzuki M. Caterina M.J. J. Neurosci. 2004; 24: 5177-5182Crossref PubMed Scopus (253) Google Scholar). 2-APB also inhibits the activity of heterologously expressed TRPC1 and TRPC3 (18Ma H.T. Patterson R.L. van Rossum D.B. Birnbaumer L. Mikoshiba K. Gill D.L. Science. 2000; 287: 1647-1651Crossref PubMed Scopus (534) Google Scholar, 23Delmas P. Wanaverbecq N. Abogadie F.C. Mistry M. Brown D.A. Neuron. 2002; 34: 209-220Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar, 24Trebak M. Bird G.S. McKay R.R. Putney Jr., J.W. J. Biol. Chem. 2002; 277: 21617-21623Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar) as well as TRPC5 (25Lee Y.M. Kim B.J. Kim H.J. Yang D.K. Zhu M.H. Lee K.P. So I. Kim K.W. Am. J. Physiol. 2003; 284: G604-G616Crossref PubMed Scopus (137) Google Scholar, 26Xu S.Z. Zeng F. Boulay G. Grimm C. Harteneck C. Beech D.J. Br. J. Pharmacol. 2005; 145: 405-414Crossref PubMed Scopus (211) Google Scholar) and TRPV6. Other studies have shown that 2-APB activates TRPV3 (14Montell C. Sci. STKE 2001. 2001; : RE1Google Scholar, 27Voets T. Prenen J. Fleig A. Vennekens R. Watanabe H. Hoenderop J.G. Bindels R.J. Droogmans G. Penner R. Nilius B. J. Biol. Chem. 2001; 276: 47767-47770Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar, 28Schindl R. Kahr H. Graz I. Groschner K. Romanin C. J. Biol. Chem. 2002; 277: 26950-26958Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 29Hu H.Z. Gu Q. Wang C. Colton C.K. Tang J. Kinoshita-Kawada M. Lee L.Y. Wood J.D. Zhu M.X. J. Biol. Chem. 2004; 279: 35741-35748Abstract Full Text Full Text PDF PubMed Scopus (424) Google Scholar). Therefore, the mechanism whereby EGF induces CCE in RCEC could not be completely characterized in our previous study (3Yang H. Sun X. Wang Z. Ning G. Zhang F. Kong J. Lu L. Reinach P.S. J. Membr. Biol. 2003; 194: 47-58Crossref PubMed Scopus (40) Google Scholar). In RCEC, TRPC4 expression is plasma membrane-delimited, suggesting that it may be a component of an ionic influx pathway whose activation elicits CCE. Our finding in RCEC that 2-APB has corresponding inhibitory effects on EGF-induced CCE and an increase in proliferation is consistent with such a suggestion (3Yang H. Sun X. Wang Z. Ning G. Zhang F. Kong J. Lu L. Reinach P.S. J. Membr. Biol. 2003; 194: 47-58Crossref PubMed Scopus (40) Google Scholar). However, given the complex pharmacology of 2-APB, the possible importance of TRPC4 expression to these responses is unknown. Such uncertainty is further indicated by the aforementioned finding that 2-APB can inhibit influx pathways composed of TRPC1 and TRPC3, which are two of the four other TRPC isoforms whose gene expression was detected in RCEC. Therefore, it is not possible to draw any conclusions about the importance of TRPC4 expression to CCE and the mitogenic function of EGF. On the other hand, TRPC4 expression may be requisite for EGF to induce increases in corneal epithelial SOC activity because, in human mesangial cells, the stimulation by EGF of such activity is dependent on TRPC4 expression (30Li W.P. Tsiokas L. Sansom S.C. Ma R. J. Biol. Chem. 2004; 279: 4570-4577Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 31Wang X. Pluznick J.L. Wei P. Padanilam B.J. Sansom S.C. Am. J. Physiol. 2004; 287: C357-C364Crossref Scopus (80) Google Scholar). We describe in human corneal epithelial cells (HCEC) the involvement of TRPC4 gene and protein expression in eliciting SOC activation required for (i) EGF-induced increases in plasma membrane calcium influx and (ii) the mitogenic response to this growth factor. Our results indicate that TRPC4 protein expression is required for EGF stimulation of SOC activity. This dependence is evident, as EGF had no stimulatory effect on plasma membrane calcium influx and SOC activity following TRPC4 knockdown. Finally, TRPC4 expression is requisite for EGF to induce optimum increases in proliferation. Cell Culture—SV40-immortalized HCEC (a generous gift from Dr. Araki-Sasaki) were cultured at 37 °C with 5% CO2 and 95% ambient air in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (Invitrogen) supplemented with 6% fetal bovine serum, 5 ng/ml EGF, and 5 μg/ml insulin as described previously (32Araki-Sasaki K. Ohashi Y. Sasabe T. Hayashi K. Watanabe H. Tano Y. Handa H. Investig. Ophthalmol. Vis. Sci. 1995; 36: 614-621PubMed Google Scholar). Cell cycle arrest was achieved by culturing cells in serum- and EGF-free Dulbecco's modified Eagle's medium/nutrient mixture F-12 for 24 h before experimentation. Fluorescence Cell Imaging—Cells grown on 22-mm circular coverslips were loaded with 2 μm fura2 acetoxymethyl ester (Molecular Probes, Inc., Eugene, OR) at room temperature for 30 min and then washed (33Yang H. Wang Z. Miyamoto Y. Reinach P.S. J. Membr. Biol. 2001; 183: 93-101Crossref PubMed Scopus (33) Google Scholar). Cells were continuously superfused at 34 °C in a perfusion chamber (the base of which was formed by a coverslip) that was placed on the stage of an inverted microscope (Nikon Diaphot 200). Cells were then alternately illuminated at 340 and 380 nm, and emission was monitored every 5 s at 510 nm using a digital imaging system. The field of interest contained ∼6–10 cells. A mean running ratio was calculated for each region. Changes in fluorescence intensity were estimated as described (34Grynkiewicz G. Poenie M. Tsien R.Y. J. Biol. Chem. 1985; 260: 3440-3450Abstract Full Text PDF PubMed Scopus (80) Google Scholar). If a vehicle contained Me2SO, its final concentration was <0.1%. The n values provided indicate the number of experiments per data point. Cell Proliferation—[3H]Thymidine incorporation was performed as described (3Yang H. Sun X. Wang Z. Ning G. Zhang F. Kong J. Lu L. Reinach P.S. J. Membr. Biol. 2003; 194: 47-58Crossref PubMed Scopus (40) Google Scholar). Following 24 h of serum starvation in medium supplemented with 0.5% bovine serum albumin, both transfected and nontransfected cells were incubated at 37 °C for 1 h with 1 μCi/ml [3H]thymidine (3.3–4.8 TBq/mmol) and then washed three times with ice-cold 5% trichloroacetic acid. Cell lysates were solubilized with 0.2 n NaOH and 2% SDS. Radioactivity was monitored using a liquid scintillation counter, and the data were normalized to cellular protein content using a modified Lowry assay. RNA Extraction and Reverse Transcription (RT)-PCR—Total RNA was isolated using TRIzol, and cDNA was synthesized using the SuperScript RT kit (Invitrogen) following the manufacturer's instructions. PCR was performed as described previously (3Yang H. Sun X. Wang Z. Ning G. Zhang F. Kong J. Lu L. Reinach P.S. J. Membr. Biol. 2003; 194: 47-58Crossref PubMed Scopus (40) Google Scholar), and the amplified products were separated on 1.0% agarose gels. The expression levels of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase were evaluated in parallel. The glyceraldehyde-3-phosphate dehydrogenase sense and antisense primers were 5′-TGACCCCTTCATTGACCTTC-3′ and 5′-GGTCATAAGTCCCTCCAGGA-3′, respectively (35Sun X.C. Cui M. Bonanno J.A. BMC Physiology. 2004; http://www.biomedcentral.com/1472-6793/4/8PubMed Google Scholar). Band intensities were measured using SigmaScan Pro5 and were normalized to those for glyceraldehyde-3-phosphate dehydrogenase, which are expressed in arbitrary units. Immunoblot Analysis—Transfected and non-transfected HCEC were gently washed twice with cold phosphate-buffered saline and then scraped into homogenization buffer. Homogenization Buffer components: (150 mmol/liter NaCl, 50 mmol/liter Tris HCl, 1 mmol/liter EGTA, 1 mmol/liter EDTA, 1% Nonidet P-40, 0.1% sodium deoxycholate, 0.1% SDS, 20 μg/ml aprotinin, 10 μg/mL leupeptin, and 200 μmol/liter phenylsulfonyl fluoride). Subsequent steps were performed as described (36Sun X.C. Bonanno J.A. Exp. Eye Res. 2003; 77: 287-295Crossref PubMed Scopus (18) Google Scholar). Membranes were first exposed overnight at 4 °C to anti-TRPC4 primary antibody (diluted 1:1000; a kind gift of Dr. Michael X. Zhu) (37Tang Y. Tang J. Chen Z. Trost C. Flockerzi V. Li M. Ramesh V. Zhu M.X. J. Biol. Chem. 2000; 275: 37559-37564Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar). They were then washed three times with phosphate-buffered saline/Tween detergent and horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody was applied for 1 h at room temperature. Bound antibody was evaluated using an ECL detection system (Amersham Biosciences). Anti-β-actin monoclonal antibody (Upstate Biotechnology, Inc.) was used to test for equal protein loading. Synthesis and Transfection of Small Interfering RNA (siRNA)—The 21-nucleotide siRNA sequences specifically targeting human TRPC4 were designed and synthesized using the Silencer siRNA construction kit (Ambion Inc.). The four specific TRPC4 target sequences used in this study are listed in TABLE ONE. The siRNAs were transfected into HCEC using Oligofectamine (Invitrogen) as transfection reagent. After transfection, cells were incubated at 37 °C in Opti-MEM; reduced serum medium and fresh growth medium were added at 24 h posttransfection. All experimental measurements were performed at 48–72 h post-transfection. Non-targeting siRNA (siCONTROL, Dharmacon, Inc.) was used as a control for monitoring non-sequence-specific effects.TABLE ONETarget sequences of TRPC4 siRNAsiRNATarget sequencePosition in gene sequenceGC content%siRNA1AAATGTTAATGCTCCCTATAG2433.3siRNA2AATGAATTCAAGTCGGAGTAT70333.3siRNA3AAATTAAACAGATGTGGGATG125033.3siRNA4AAATATTCAACTGGAATCTCG264633.3 Open table in a new tab Electrophysiological Measurements—Coverslips with HCEC were mounted on the stage of an upright microscope (Olympus BX50WI). The cells were superfused with a sodium- and potassium-free extracellular bath solution containing 120 mmol/liter N-methyl-d-glucamine, 5.4 mmol/liter CsCl, 1.0 mmol/liter MgCl2, 10 mmol/liter glucose, 10 mmol/liter HEPES acid, and 0.5 mmol/liter EGTA (pH adjusted to 7.2). Cyclopiazonic acid (CPA) (Calbiochem), an inhibitor of the ICS Ca2+/Mg2+-ATPase pump, activated SOC currents (ISOC) through passive depletion of ICS. In brief, cells were first incubated with 10 μm CPA. After 10 min, 5 mm Ca2+ was applied to the bath to induce CCE. Control currents were measured with CPA in the bath. ISOC was recorded after induction of CCE. Pipettes of soft glass with a resistance of 2–5 megaohms were pulled using a Universal Puller. Pipettes for whole cell recordings were filled with a solution containing 130 mmol/liter CsCl, 4.0 mmol/liter MgCl2, 10 mmol/liter EGTA, and 10 mmol/liter HEPES salt (pH adjusted to 7.2). Membrane currents were recorded using an EPC 8 amplifier (HEKA, Lamprecht, Germany). Electrical stimulation, data storage, and processing were performed using TIDA software (HEKA) in conjunction with a PC/AT compatible computer. All electrophysiological experiments were performed at room temperature. Membrane capacitances and access resistances were calculated from the capacitative current transient induced by a 90-mV hyperpolarization from the holding potential (0 mV) of 50-ms duration. Mean access resistances of 41 ± 3 megaohms (n = 18) and mean membrane capacitances of 38 ± 3 picofarads (pF) (n = 25) were measured in the whole cell configuration in both non-transfected and siRNA-transfected cells. Pipette and membrane capacitances and access resistances were compensated with an EPC 8 patch-clamp amplifier. The liquid junction potential was estimated experimentally as well as theoretically and corrected for at the beginning of each measurement (38Barry P.H. J. Neurosci. Methods. 1994; 51: 107-116Crossref PubMed Scopus (551) Google Scholar). If drugs were added in a Me2SO-containing stock solution, the concentration was kept <0.1% (v/v), which did not affect the patch-clamp recordings (data not shown). Whole cell currents (ISOC) were recorded for 300 ms using voltage steps ranging between –120 and +20 mV (20-mV increments). Chemicals—All chemicals were purchased from Sigma unless indicated otherwise. Data Analyses—All values are reported as means ± S.E. The numbers of replicates are indicated in each case in parentheses. Statistical significance was determined with Student's t test. p values <0.05 were taken to be significant. To assess the role of TRPC4 in mediating EGF-induced responses, its gene expression was knocked down using each of four different siRNA candidates specifically targeting suppression of TRPC4 protein expression. Fig. 1 shows the RT-PCR product yields obtained with TRPC4 siRNA2, which was as effective as TRPC4 siRNA3 in eliciting TRPC4 gene expression knockdown. Forty-eight hours after transfection, TRPC4 gene expression decreased by 89 ± 0.3% (n = 3; p < 0.001) from the control value. RT omission was performed to assess genomic DNA contamination; lack of any cDNA product in the negative control lane reflects undetectable contamination. Similarly, Oligofectamine as vehicle by itself had no effect on TRPC4 gene expression. Fig. 1 (lower panel) shows that that levels of glyceraldehyde-3-phosphate dehydrogenase gene expression were invariant, indicating loading condition equivalence. Fig. 2 compares variations in TRPC4 protein expression levels resulting from exposure to the following conditions: (i) non-transfected cells, (ii) cells transfected with noncoding siRNA (siCONTROL), (iii) cells transfected with TRPC4 siRNA2 or siRNA3, and (iv) pre-absorption by specific anti-TRPC4 antibody of its peptide recognition sequence. A single band corresponding to TRPC4 with an apparent molecular mass of ∼90 kDa was detected, whereas pre-exposure of anti-TRPC4 antibody to its targeted epitope eliminated detection of the aforementioned band. There was no significant difference between the TRPC4 expression levels in the control and siCONTROL cells. On the other hand, siRNA2 and siRNA3 effectively decreased TRPC4 protein expression by 85 ± 0.3% (n = 4; p < 0.005) and 89 ± 0.2% (n = 4; p < 0.004), respectively, relative to that measured in non-transfected and siCONTROL cells. These results indicate that the TRPC4 siRNA sequence designs were sufficiently selective to suppress TRPC4 protein expression. EGF induces depletion of ICS, which results in CCE in RCEC (3Yang H. Sun X. Wang Z. Ning G. Zhang F. Kong J. Lu L. Reinach P.S. J. Membr. Biol. 2003; 194: 47-58Crossref PubMed Scopus (40) Google Scholar). The increases in plasma membrane influx associated with this response can be characterized by employing the calcium add-back protocol. This procedure entails initial emptying of ICS content, followed by repletion of the bathing solution calcium composition. The height of the transient resulting from Ca2+ add-back is at least partially reflective of the extent of SOC activation. We considered the dependence of SOC activation on TRPC4 protein expression by comparing the responses to calcium addback in TRPC4 siRNA-transfected HCEC with those in non-transfected cells. As shown in Fig. 3, ICS were initially depleted of Ca2+ content by inhibition of ICS Ca2+/Mg2+-ATPase activity with 10 μm CPA in Ca2+-free medium containing 1 mm EGTA. After addition of CPA, a Ca2+ transient frequently occurred, confirming depletion of ICS Ca2+ content. Following replacement of the medium with its calcium (1 mm)-containing counterpart, there was a rapid increase in the F340nm/F380nm ratio, which was at least partially due to SOC activation. In non-transfected cells, Ca2+ add-back induced an increase in the F340nm/F380nm ratio of >1 arbitrary unit (control set to 100%), whereas in TRPC4 siRNA2-transfected cells, the CCE amplitude was reduced by 76 ± 2% (n = 5; p < 0.005). This decline in amplitude indicates that activation of SOC pathways composed of TRPC4 contributes to the calcium addback response. To further substantiate the role of SOC activation in eliciting a rise in calcium influx following ICS depletion, we determined the effect of 0.5 mm Ni2+ on CCE amplitude. At high concentrations (in the mm range), this cation is a SOC blocker (39Golovina V.A. Platoshyn O. Bailey C.L. Wang J. Limsuwan A. Sweeney M. Rubin L.J. Yuan J.X. Am. J. Physiol. 2001; 280: H746-H755Crossref PubMed Google Scholar, 40Skryma R. Mariot P. Bourhis X.L. Coppenolle F.V. Shuba Y. Vanden Abeele F. Legrand G. Humez S. Boilly B. Prevarskaya N. J. Physiol. (Lond.). 2000; 527: 71-83Crossref Scopus (108) Google Scholar, 41Zweifach A. Lewis R.S. J. Gen. Physiol. 1996; 107: 597-610Crossref PubMed Scopus (127) Google Scholar). In Fig. 4A, a typical recording shows that, with Ni2+, the CPA-induced CCE increase fell to 68 ± 3% (n = 5) of the control value set equal to 100%. This response was followed by a slight but insignificant increase to a stable value (83 ± 7%, n = 5). Subsequent removal of Ca2+ from the bath caused the transient to fall to the value measured prior to Ca2+ addition. Fig. 4B summarizes the results obtained with this procedure. The average changes in the ratio closely correspond to those observed in Fig. 4A, indicating that SOC activation makes a substantial contribution to CCE. To directly assess the increases in calcium flux resulting from ICS depletion, we measured currents of non-transfected and TRPC4 siRNA2-transfected cells using the whole cell mode of the patch-clamp technique. As illustrated in Fig. 5A, cells were exposed to a solution lacking Na+ and K+ to eliminate any currents that could result from their presence. In addition, the bath solution contained 5 μm nifedipine to block voltage-dependent L-type channel activity, and the pipette solution contained 0.1 mm DIDS to inhibit chloride channel activity. The stimulation protocol used to characterize SOC activity is shown in Fig. 5B. The holding potential was set to 0 mV to eliminate any possible contributions by voltage-dependent calcium channel activity. The current responses in the absence and presence of bath calcium (i.e. 5mm) using this protocol and following ICS depletion with 10 μm CPA are shown in Fig. 5C. Subsequent to Ca2+ medium supplementation and in the continued presence of CPA, both inward and outward currents increased, which is indicative of SOC activity. Fig. 5D shows the current density-voltage relationship, wherein the current is normalized to capacitance to obtain current density (pA/pF). In the absence and presence of calcium, current densities were measured using the stimulation protocol shown in Fig. 5B after establishing the whole cell configuration. In the absence of bath calcium, some increases in inward currents were detected. By contrast, with 5 mm calcium in the bath, the current increased significantly. Specifically, the maximum inward current (at –120 mV) increased from –5.92 ± 1.03 to –13.94 ± 3.00 pA/pF (n = 5; p < 0.04). These results indicate that ICS depletion induces SOC activation. To assess the importance of TRPC4 expression to SOC activation, we determined whether SOC activity induced by ICS depletion is suppressed in TRPC4 siRNA2-transfected cells. Fig. 6A compares the current profiles obtained with the same voltage protocol used to characterize the non-transfected cells shown in Fig. 5B. In transfected cells, no effect of the charge carrier was visible. Fig. 6B shows that, in contrast to non-transfected cells, the current density-voltage relationship was tical irrespective of the presence or absence of Ca2+ in the bath solution. In particular, at –120 mV, the maximum inward current was –8.67 ± 1.73 pA/pF i" @default.
• W2007803500 created "2016-06-24" @default.
• W2007803500 creator A5033969727 @default.
• W2007803500 creator A5035130589 @default.
• W2007803500 creator A5045848195 @default.
• W2007803500 creator A5052267876 @default.
• W2007803500 creator A5059499344 @default.
• W2007803500 creator A5075065160 @default.
• W2007803500 creator A5081947536 @default.
• W2007803500 creator A5086161688 @default.
• W2007803500 date "2005-09-01" @default.
• W2007803500 modified "2023-10-11" @default.
• W2007803500 title "TRPC4 Knockdown Suppresses Epidermal Growth Factor-induced Store-operated Channel Activation and Growth in Human Corneal Epithelial Cells" @default.
• W2007803500 cites W1836265445 @default.
• W2007803500 cites W1839389203 @default.
• W2007803500 cites W1840415699 @default.
• W2007803500 cites W1874327812 @default.
• W2007803500 cites W1965484079 @default.
• W2007803500 cites W1970629236 @default.
• W2007803500 cites W1973977506 @default.
• W2007803500 cites W1974342767 @default.
• W2007803500 cites W1975108009 @default.
• W2007803500 cites W1975419239 @default.
• W2007803500 cites W1976584289 @default.
• W2007803500 cites W1992546660 @default.
• W2007803500 cites W1993818203 @default.
• W2007803500 cites W1998606603 @default.
• W2007803500 cites W2000819593 @default.
• W2007803500 cites W2002441736 @default.
• W2007803500 cites W2005413789 @default.
• W2007803500 cites W2009667219 @default.
• W2007803500 cites W2010897136 @default.
• W2007803500 cites W2013831058 @default.
• W2007803500 cites W2013962899 @default.
• W2007803500 cites W2017178896 @default.
• W2007803500 cites W2038021647 @default.
• W2007803500 cites W2051766064 @default.
• W2007803500 cites W2051947809 @default.
• W2007803500 cites W2067369435 @default.
• W2007803500 cites W2070832223 @default.
• W2007803500 cites W2074993010 @default.
• W2007803500 cites W2078824120 @default.
• W2007803500 cites W2081588134 @default.
• W2007803500 cites W2083977901 @default.
• W2007803500 cites W2085297137 @default.
• W2007803500 cites W2086669662 @default.
• W2007803500 cites W2091441992 @default.
• W2007803500 cites W2092220395 @default.
• W2007803500 cites W2101082686 @default.
• W2007803500 cites W2113236143 @default.
• W2007803500 cites W2117917356 @default.
• W2007803500 cites W2128450740 @default.
• W2007803500 cites W2133922610 @default.
• W2007803500 cites W2136191791 @default.
• W2007803500 cites W2141260882 @default.
• W2007803500 cites W2144888928 @default.
• W2007803500 cites W2146833243 @default.
• W2007803500 cites W2148806848 @default.
• W2007803500 cites W2164481768 @default.
• W2007803500 cites W2174190166 @default.
• W2007803500 cites W4249424055 @default.
• W2007803500 cites W4254511085 @default.
• W2007803500 doi "https://doi.org/10.1074/jbc.m504553200" @default.
• W2007803500 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4096720" @default.
• W2007803500 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16033767" @default.
• W2007803500 hasPublicationYear "2005" @default.
• W2007803500 type Work @default.
• W2007803500 sameAs 2007803500 @default.
• W2007803500 citedByCount "78" @default.
• W2007803500 countsByYear W20078035002012 @default.
• W2007803500 countsByYear W20078035002013 @default.
• W2007803500 countsByYear W20078035002014 @default.
• W2007803500 countsByYear W20078035002015 @default.
• W2007803500 countsByYear W20078035002016 @default.
• W2007803500 countsByYear W20078035002017 @default.
• W2007803500 countsByYear W20078035002018 @default.
• W2007803500 countsByYear W20078035002019 @default.
• W2007803500 countsByYear W20078035002020 @default.
• W2007803500 countsByYear W20078035002021 @default.
• W2007803500 countsByYear W20078035002022 @default.
• W2007803500 crossrefType "journal-article" @default.
• W2007803500 hasAuthorship W2007803500A5033969727 @default.
• W2007803500 hasAuthorship W2007803500A5035130589 @default.
• W2007803500 hasAuthorship W2007803500A5045848195 @default.
• W2007803500 hasAuthorship W2007803500A5052267876 @default.
• W2007803500 hasAuthorship W2007803500A5059499344 @default.
• W2007803500 hasAuthorship W2007803500A5075065160 @default.
• W2007803500 hasAuthorship W2007803500A5081947536 @default.
• W2007803500 hasAuthorship W2007803500A5086161688 @default.
• W2007803500 hasBestOaLocation W20078035001 @default.
• W2007803500 hasConcept C104317684 @default.
• W2007803500 hasConcept C127162648 @default.
• W2007803500 hasConcept C170493617 @default.
• W2007803500 hasConcept C173396325 @default.
• W2007803500 hasConcept C185592680 @default.
• W2007803500 hasConcept C2776362946 @default.
• W2007803500 hasConcept C41008148 @default.
• W2007803500 hasConcept C55493867 @default.

• next