FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2007945445> ?p ?o ?g. }

• W2007945445 endingPage "27743" @default.
• W2007945445 startingPage "27733" @default.
• W2007945445 abstract "Campylobacter jejuni produces glycoproteins that are essential for virulence. These glycoproteins carry diacetamidobacillosamine (DAB), a sugar that is not found in humans. Hence, the enzymes responsible for DAB synthesis represent potential therapeutic targets. We describe the biochemical characterization of Cj1121c, a putative aminotransferase encoded by the general protein glycosylation locus, to assess its role in DAB biosynthesis. By using overexpressed and affinity-purified enzyme, we demonstrate that Cj1121c has pyridoxal phosphate- and glutamate-dependent UDP-4-keto-6-deoxy-GlcNAc C-4 transaminase activity and produces UDP-4-amino-4,6-dideoxy-GlcNAc. This is consistent with a role in DAB biosynthesis and distinguishes Cj1121c from Cj1294, a homologous UDP-2-acetamido-2,6-dideoxy-β-l-arabino-4-hexulose C-4 aminotransferase that we characterized previously. We show that Cj1121c can also use this 4-keto-arabino sugar indirectly as a substrate, that Cj1121c and Cj1294 are active simultaneously in C. jejuni, and that the activity of Cj1121c is preponderant under standard growth conditions. Kinetic data indicate that Cj1121c has a slightly higher catalytic efficiency than Cj1294 with regard to the 4-keto-arabino substrate. By site-directed mutagenesis, we show that residues Glu-158 and Leu-131 are not essential for catalysis or for substrate specificity contrary to expectations. We further demonstrate that a cj1121c knock-out mutant is impaired for flagella-mediated motility, for invasion of intestinal epithelial cells, and for persistence in the chicken intestine, clearly demonstrating that Cj1121c is essential for host colonization and virulence. Finally, we show that cj1121c is necessary for protein glycosylation by lectin Western blotting. Collectively, these results validate Cj1121c as a promising drug target and provide the means to assay for inhibitors. Campylobacter jejuni produces glycoproteins that are essential for virulence. These glycoproteins carry diacetamidobacillosamine (DAB), a sugar that is not found in humans. Hence, the enzymes responsible for DAB synthesis represent potential therapeutic targets. We describe the biochemical characterization of Cj1121c, a putative aminotransferase encoded by the general protein glycosylation locus, to assess its role in DAB biosynthesis. By using overexpressed and affinity-purified enzyme, we demonstrate that Cj1121c has pyridoxal phosphate- and glutamate-dependent UDP-4-keto-6-deoxy-GlcNAc C-4 transaminase activity and produces UDP-4-amino-4,6-dideoxy-GlcNAc. This is consistent with a role in DAB biosynthesis and distinguishes Cj1121c from Cj1294, a homologous UDP-2-acetamido-2,6-dideoxy-β-l-arabino-4-hexulose C-4 aminotransferase that we characterized previously. We show that Cj1121c can also use this 4-keto-arabino sugar indirectly as a substrate, that Cj1121c and Cj1294 are active simultaneously in C. jejuni, and that the activity of Cj1121c is preponderant under standard growth conditions. Kinetic data indicate that Cj1121c has a slightly higher catalytic efficiency than Cj1294 with regard to the 4-keto-arabino substrate. By site-directed mutagenesis, we show that residues Glu-158 and Leu-131 are not essential for catalysis or for substrate specificity contrary to expectations. We further demonstrate that a cj1121c knock-out mutant is impaired for flagella-mediated motility, for invasion of intestinal epithelial cells, and for persistence in the chicken intestine, clearly demonstrating that Cj1121c is essential for host colonization and virulence. Finally, we show that cj1121c is necessary for protein glycosylation by lectin Western blotting. Collectively, these results validate Cj1121c as a promising drug target and provide the means to assay for inhibitors. Campylobacter jejuni is a Gram-negative microaerophilic bacterium that is the leading cause of enteritis in developed countries (1Blaser M.J. J. Infect. Dis. 1997; 176: 103-105Crossref PubMed Scopus (344) Google Scholar). It is endemic in developing countries, causing significant mortality and morbidity in very young children. This bacterium is a commensal in poultry and cattle, and infection occurs mostly via ingestion of contaminated water or under-cooked poultry. The recent emergence of antibiotic-resistant strains has triggered renewed interest for the understanding of the pathogenesis of C. jejuni (2Engberg J. Aarestrup F.M. Taylor D.E. Gerner-Smidt P. Nachamkin I. Emerg. Infect. Dis. 2001; 7: 24-34Crossref PubMed Scopus (539) Google Scholar, 3Gibreel A. Sjogren E. Kaijser B. Wretlind B. Skold O. Antimicrob. Agents Chemother. 1998; 42: 3276-3278Crossref PubMed Google Scholar), which could lead to the identification of novel targets that could be further investigated for the development of therapeutics. A variety of virulence factors has been identified, such as the lipo-oligosaccharide (4Aspinall G.O. Fujimoto S. McDonald A.G. Pang H. Kurjanczyk L.A. Penner J.L. Infect. Immun. 1994; 62: 2122-2125Crossref PubMed Google Scholar, 5Aspinall G.O. McDonald A.G. Pang H. Kurjanczyk L.A. Penner J.L. Biochemistry. 1994; 33: 241-249Crossref PubMed Scopus (174) Google Scholar, 6Aspinall G.O. McDonald A.G. Raju T.S. Pang H. Mills S.D. Kurjanczyk L.A. Penner J.L. J. Bacteriol. 1992; 174: 1324-1332Crossref PubMed Scopus (76) Google Scholar, 7Perez Perez G.I. Blaser M.J. Infect. Immun. 1985; 47: 353-359Crossref PubMed Google Scholar), capsule (8Bacon D.J. Szymanski C.M. Burr D.H. Silver R.P. Alm R.A. Guerry P. Mol. Microbiol. 2001; 40: 769-777Crossref PubMed Scopus (231) Google Scholar), flagellum (9Nuijten P.J. Bleumink-Pluym N.M. Gaastra W. van der Zeijst B.A. Infect. Immun. 1989; 57: 1084-1088Crossref PubMed Google Scholar), toxins (10Hickey T.E. McVeigh A.L. Scott D.A. Michielutti R.E. Bixby A. Carroll S.A. Bourgeois A.L. Guerry P. Infect. Immun. 2000; 68: 6535-6541Crossref PubMed Scopus (187) Google Scholar), and adhesins (11Blaser M.J. Hopkins J.A. Berka R.M. Vasil M.L. Wang W.L. Infect. Immun. 1983; 42: 276-284Crossref PubMed Google Scholar, 12Jin S. Joe A. Lynett J. Hani E.K. Sherman P. Chan V.L. Mol. Microbiol. 2001; 39: 1225-1236Crossref PubMed Google Scholar, 13Pei Z. Blaser M.J. J. Biol. Chem. 1993; 268: 18717-18725Abstract Full Text PDF PubMed Google Scholar, 14Song Y.C. Jin S. Louie H. Ng D. Lau R. Zhang Y. Weerasekera R. Al Rashid S. Ward L.A. Der S.D. Chan V.L. Mol. Microbiol. 2004; 53: 541-553Crossref PubMed Scopus (104) Google Scholar). They allow for colonization and invasion of the intestinal epithelium and protection against host immune defense systems.Recently, it has been shown that C. jejuni produces numerous glycoproteins that are also essential for its virulence (15Szymanski C.M. Burr D.H. Guerry P. Infect. Immun. 2002; 70: 2242-2244Crossref PubMed Scopus (189) Google Scholar, 16Karlyshev A.V. Everest P. Linton D. Cawthraw S. Newell D.G. Wren B.W. Microbiology. 2004; 150: 1957-1964Crossref PubMed Scopus (145) Google Scholar). Their production was linked to a large cluster of genes encoding putative sugar-nucleotide-modifying enzymes named the pgl cluster for protein glycosylation (17Szymanski C.M. Yao R. Ewing C.P. Trust T.J. Guerry P. Mol. Microbiol. 1999; 32: 1022-1030Crossref PubMed Scopus (315) Google Scholar, 18Linton D. Dorrell N. Hitchen P.G. Amber S. Karlyshev A.V. Morris H.R. Dell A. Valvano M.A. Aebi M. Wren B.W. Mol. Microbiol. 2005; 55: 1695-1703Crossref PubMed Scopus (173) Google Scholar, 19Young N.M. Brisson J.R. Kelly J. Watson D.C. Tessier L. Lanthier P.H. Jarrell H.C. Cadotte N. St Michael F. Aberg E. Szymanski C.M. J. Biol. Chem. 2002; 277: 42530-42539Abstract Full Text Full Text PDF PubMed Scopus (349) Google Scholar). The proteins glycosylated via this operon harbor a heptasaccharide motif that contains diacetamidobacillosamine (DAB) 4The abbreviations used are: DAB, 2,4-diacetamido-2,4,6-trideoxyglucopyranose; UDP-4-keto-6-deoxy-GlcNAc, uridine-5′-diphospho-4-keto-6-deoxy-N-acetylglucosamine; UDP-4-amino-4,6-dideoxy-GalNAc, uridine-5′-diphospho-4-amino-4,6-dideoxy-N-acetylgalactosamine; UDP-4-amino-4,6-dideoxy-GlcNAc, uridine-5′-diphospho-4-amino-4,6dideoxy-N-acetylglucosamine; AltNAc, N-acetyl-β-l-altrosamine; PLP, pyridoxal phosphate; CE, capillary electrophoresis; TNBS, 2,4,6-trinitrobenzensulfonic acid; NOE, nuclear Overhauser effect; Cfu, colony-forming units; SBA, soybean agglutinin; MH, Mueller-Hinton; MS, mass spectrometry.4The abbreviations used are: DAB, 2,4-diacetamido-2,4,6-trideoxyglucopyranose; UDP-4-keto-6-deoxy-GlcNAc, uridine-5′-diphospho-4-keto-6-deoxy-N-acetylglucosamine; UDP-4-amino-4,6-dideoxy-GalNAc, uridine-5′-diphospho-4-amino-4,6-dideoxy-N-acetylgalactosamine; UDP-4-amino-4,6-dideoxy-GlcNAc, uridine-5′-diphospho-4-amino-4,6dideoxy-N-acetylglucosamine; AltNAc, N-acetyl-β-l-altrosamine; PLP, pyridoxal phosphate; CE, capillary electrophoresis; TNBS, 2,4,6-trinitrobenzensulfonic acid; NOE, nuclear Overhauser effect; Cfu, colony-forming units; SBA, soybean agglutinin; MH, Mueller-Hinton; MS, mass spectrometry. (18Linton D. Dorrell N. Hitchen P.G. Amber S. Karlyshev A.V. Morris H.R. Dell A. Valvano M.A. Aebi M. Wren B.W. Mol. Microbiol. 2005; 55: 1695-1703Crossref PubMed Scopus (173) Google Scholar, 19Young N.M. Brisson J.R. Kelly J. Watson D.C. Tessier L. Lanthier P.H. Jarrell H.C. Cadotte N. St Michael F. Aberg E. Szymanski C.M. J. Biol. Chem. 2002; 277: 42530-42539Abstract Full Text Full Text PDF PubMed Scopus (349) Google Scholar). A direct role of the pgl operon in the synthesis of DAB was demonstrated by reconstituting the glycosylation of the C. jejuni protein PEB3 into an Escherichia coli strain that harbored a plasmid-borne pgl cluster (20Wacker M. Linton D. Hitchen P.G. Nita-Lazar M. Haslam S.M. North S.J. Panico M. Morris H.R. Dell A. Wren B.W. Aebi M. Science. 2002; 298: 1790-1793Crossref PubMed Scopus (612) Google Scholar). Disruption of the pgl cluster in C. jejuni affects bacterial virulence, but its impact on protein glycosylation varies depending on the gene disrupted within the cluster, the strain of C. jejuni used, and the glycoprotein target examined. The effects range from incorporation of slightly different sugars in the glycoproteins to total abolition of glycoprotein production or to the absence of glycosylation (18Linton D. Dorrell N. Hitchen P.G. Amber S. Karlyshev A.V. Morris H.R. Dell A. Valvano M.A. Aebi M. Wren B.W. Mol. Microbiol. 2005; 55: 1695-1703Crossref PubMed Scopus (173) Google Scholar, 19Young N.M. Brisson J.R. Kelly J. Watson D.C. Tessier L. Lanthier P.H. Jarrell H.C. Cadotte N. St Michael F. Aberg E. Szymanski C.M. J. Biol. Chem. 2002; 277: 42530-42539Abstract Full Text Full Text PDF PubMed Scopus (349) Google Scholar, 21Goon S. Kelly J.F. Logan S.M. Ewing C.P. Guerry P. Mol. Microbiol. 2003; 50: 659-671Crossref PubMed Scopus (145) Google Scholar, 22Larsen J.C. Szymanski C. Guerry P. J. Bacteriol. 2004; 186: 6508-6514Crossref PubMed Scopus (96) Google Scholar).In addition to the glycoproteins whose glycosylation is encoded by the pgl operon, C. jejuni also produces glycosylated flagellins. The flagellins are glycosylated by pseudaminic acid (23Thibault P. Logan S.M. Kelly J.F. Brisson J.R. Ewing C.P. Trust T.J. Guerry P. J. Biol. Chem. 2001; 276: 34862-34870Abstract Full Text Full Text PDF PubMed Scopus (288) Google Scholar), and the gene cj1293, which is not part of the pgl cluster, is important for this process. Disruption of cj1293 prevents flagellin glycosylation, thus preventing the assembly of the flagellum (21Goon S. Kelly J.F. Logan S.M. Ewing C.P. Guerry P. Mol. Microbiol. 2003; 50: 659-671Crossref PubMed Scopus (145) Google Scholar), an essential virulence factor. Overall, because protein glycosylation is essential for bacterial virulence, the sugar-nucleotide-modifying enzymes involved in the synthesis of the sugars dedicated to protein glycosylation represent potential targets for the development of inhibitors with therapeutic value. Their biochemical characterization is a prerequisite in the quest for potential inhibitors.The biochemical pathway for the biosynthesis of DAB has not been elucidated, but we surmised that it should contain three steps including C-6 dehydration of UDP-GlcNAc, C-4 transamination of the resulting 4-keto intermediate, and final N-acetylation to generate UDP-DAB (Fig. 1). We have demonstrated that Cj1293 has UDP-GlcNAc C-6 dehydratase activity and generates UDP-4-keto-6-deoxy-GlcNAc (24Creuzenet C. FEBS Lett. 2004; 559: 136-140Crossref PubMed Scopus (32) Google Scholar). Recent data indicate that, in addition to UDP-4-keto-6-deoxy-GlcNAc, Cj1293 also generates UDP-2-acetamido-2,6-dideoxy-β-l-arabino-4-hexulose (25Schoenhofen I.C. McNally D.J. Vinogradov E. Whitfield D. Young N.M. Dick S. Wakarchuk W.W. Brisson J.R. Logan S.M. J. Biol. Chem. 2006; 281: 723-732Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar) via a change of chirality at carbon 5 during the dehydration step. Structural studies of a homologous enzyme from Helicobacter pylori, FlaA1, indicate that the formation of the 4-keto-arabino intermediate is enzymatically catalyzed but that of the 4-keto-gluco intermediate is not and occurs via enolization of a double bond between C-4 and C-5 (26Ishiyama N. Creuzenet C. Miller W.L. Demendi M. Anderson E.M. Harauz G. Lam J.S. Berghuis A. J. Biol. Chem. 2006; (in press)PubMed Google Scholar) (Fig. 1). The cj1293 gene is part of an operon that also encodes an aminotransferase (Cj1294) and a putative N-acetyltransferase (Cj1298). We have demonstrated that Cj1294 is a C-4 aminotransferase that uses the reaction product generated by Cj1293 as a substrate, which was the very first aminotransferase with such substrate specificity to be characterized (27Obhi R.K. Creuzenet C. J. Biol. Chem. 2005; 280: 20902-20908Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Not suspecting that a change of chirality occurred during dehydration, we had determined previously by NMR that Cj1294 generated UDP-4-amino-4,6-dideoxy-GalNAc (27Obhi R.K. Creuzenet C. J. Biol. Chem. 2005; 280: 20902-20908Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar), which is not a DAB precursor. By taking the change of chirality at C-5 into account, the NMR assignments had to be revisited so that the reaction product of Cj1294 is UDP-4-amino-4,6-dideoxy-β-l-AltNAc (Fig. 1). This product is not consistent either with the formation of DAB in which the sugar ring is in the gluco-configuration.The pgl cluster also potentially encodes for the three biochemical activities necessary for DAB biosynthesis, namely including Cj1120c as the dehydratase, Cj1121c as the aminotransferase, and Cj1123c as the N-acetyltransferase. Because no biochemical data were available at onset of this work, it was reasonable to assume that Cj1120c had at least the same UDP-GlcNAc C-6 dehydratase activity as Cj1293. This was based on the fact that both enzymes are highly similar to one another (30% identity) and are also highly similar to two other UDP-GlcNAc C-6 dehydratases that we characterized previously, FlaA1 from H. pylori (28% identity with Cj1120c) and WbpM from Pseudomonas aeruginosa (35% identity with Cj1120c) (28Creuzenet C. Schur M.J. Li J. Wakarchuk W.W. Lam J.S. J. Biol. Chem. 2000; 275: 34873-34880Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 29Creuzenet C. Lam J.S. Mol. Microbiol. 2001; 41: 1295-1310Crossref PubMed Scopus (48) Google Scholar).We undertook the biochemical characterization of the putative aminotransferase Cj1121c to determine whether it had a distinct activity from Cj1294 and could be involved in the DAB biosynthetic pathway. Using overexpressed and purified Cj1121c, we demonstrate that Cj1121c is indeed a C-4 aminotransferase that uses UDP-4-keto-6-deoxy-GlcNAc as a substrate in a glutamate- and pyridoxal phosphate (PLP)-dependent fashion. We showed that it produces UDP-4-amino-4,6-dideoxy-GlcNAc, which is distinct from the reaction product of Cj1294, and is consistent with a role of Cj1121c in DAB biosynthesis. We also report on the characterization of a cj1121c knock-out mutant with regard to protein glycosylation, motility, flagellum synthesis, interactions with epithelial cells, and colonization of chicken intestinal tract. Our data clearly establish a role for cj1121c in bacterial virulence. This, together with our biochemical characterization, opens the way for therapeutic development.EXPERIMENTAL PROCEDURESBacterial Growth Conditions—All E. coli strains (DH5α, BL21(DE3)pLys) were routinely grown at 37 °C in Luria Bertani broth, with agitation. Selection with 100 μg/ml ampicillin or 34 μg/ml chloramphenicol was applied as necessary.C. jejuni strain ATCC 700819 was typically grown under microaerophilic conditions for 48 h on Mueller-Hinton (MH) plates containing 10 μg/ml vancomycin and 5 μg/ml trimethoprim, as well as 0.05% pyruvate and 5% fetal calf serum.Cloning of cj1121c in the pET System for Overexpression— The cj1121c gene was amplified by PCR from genomic DNA of C. jejuni strain ATCC 700819 using Expand Long Range Template polymerase (Roche Diagnostics) under conditions recommended by the manufacturer. The primers used were Cj1121cP5 AGGGTCCATGGGCATGAGATTTTTTCTTTCTCC and Cj1121cP6 GCGTCGGATCCTAAGCCTTTATGCTCTTTAA, which were designed based on genomic data (30Parkhill J. Wren B.W. Mungall K. Ketley J.M. Churcher C. Basham D. Chillingworth T. Davies R.M. Feltwell T. Holroyd S. Jagels K. Karlyshev A.V. Moule S. Pallen M.J. Penn C.W. Quail M.A. Rajandream M.A. Rutherford K.M. van Vliet A.H. Whitehead S. Barrell B.G. Nature. 2000; 403: 665-668Crossref PubMed Scopus (1542) Google Scholar). The PCR product was blunted and cloned into the SmaI site of the pUC18 vector using standard procedures. The cj1121c gene was then extracted from the pUC18 vector by digestion with NcoI and BamHI and inserted into a pET23 derivative (31Newton D.T. Mangroo D. Biochem. J. 1999; 339: 63-69Crossref PubMed Scopus (33) Google Scholar) that had been cleaved previously with the same enzymes. After transformation in E. coli DH5α and selection on 100 μg/ml ampicillin, the plasmid DNA was recovered, and the gene was fully sequenced. Sequencing was performed at the Robarts DNA sequencing facility (London, Ontario, Canada).Protein Overexpression and Purification—Protein expression was done in E. coli BL21(DE3)pLys with cells grown at 25 °C and induction overnight at 25 °C with 0.1 mm isopropyl β-d-1-thiogalactopyranoside. The harvested cells were kept at –20 °C until needed. The enzyme purification was performed by metal chelation as described before (27Obhi R.K. Creuzenet C. J. Biol. Chem. 2005; 280: 20902-20908Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). The eluted protein was incubated with PLP before dialysis in 100 mm Hepes, pH 7.5. The enzyme was used extemporaneously for all kinetic experiments. Otherwise, it was kept frozen at –20 °C in the presence of 20% glycerol. Expression and purification of Cj1293 and Cj1294 were performed as described previously (24Creuzenet C. FEBS Lett. 2004; 559: 136-140Crossref PubMed Scopus (32) Google Scholar, 27Obhi R.K. Creuzenet C. J. Biol. Chem. 2005; 280: 20902-20908Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). SDS-PAGE analysis and Western blotting with anti-histidine antibody (Amersham Biosciences) were done according to standard procedures.Enzyme Assays with Purified Enzymes—Typical enzymatic reactions contained 0.12 μg of Cj1293 and 0.8 μg of Cj1121c with 0.5 mm UDP-GlcNAc, 10 mm glutamic acid (or other amino acid), and 0.1 mm PLP (for fractions not preincubated with PLP at the end of the purification) in 20 mm Hepes buffer, pH 7.5, in a final volume of 20 μl. Catalysis was assessed by capillary electrophoresis (CE) as described before (28Creuzenet C. Schur M.J. Li J. Wakarchuk W.W. Lam J.S. J. Biol. Chem. 2000; 275: 34873-34880Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 32Creuzenet C. Belanger M. Wakarchuk W.W. Lam J.S. J. Biol. Chem. 2000; 275: 19060-19067Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). For the determination of kinetic parameters, fresh 4-keto-arabino intermediate was prepared using UDP-GlcNAc and Cj1293, and the Cj1293 enzyme was removed by ultrafiltration (Pall Life Sciences, 10-kDa cutoff). Appropriate serial dilutions of this 4-keto stock were used to assess enzymatic activity at 11 different concentrations centered around the expected Km value. Experiments were performed in triplicate.Purification of the Reaction Product by Anion Exchange Chromatography—The purification of the reaction product was performed by anion exchange chromatography using a High Q Econopac 1-ml column (Bio-Rad) and a linear gradient (50 mm to 1 m) of 20 column volumes of triethylammonium bicarbonate, pH 8.5. The fractions were checked for the presence of the product of interest by CE, pooled together, and lyophilized.Identification of the Reaction Product—The reactivity of the purified reaction product with trinitrobenzenesulfonic acid (TNBS) was tested by incubating it with a 20 m excess of TNBS in 100 mm Hepes, pH 7.5, for 1 h at 50°C. Mass spectrometry (MS) analysis of the reaction product was performed at the Don Rix MS facility of the University of Western Ontario on a Micromass Qtof Micromass spectrometer equipped with a Z-spray source operating in the negative ion mode (40 V, 80 °C). NMR analyses were performed at the University of Western Ontario NMR facility as described before (27Obhi R.K. Creuzenet C. J. Biol. Chem. 2005; 280: 20902-20908Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar).Construction of C. jejuni cj1294 and cj1121c Knock-out Mutants—Inverse PCR was performed on the cj1294 or cj1121c genes that had been previously cloned into the pET vector (27Obhi R.K. Creuzenet C. J. Biol. Chem. 2005; 280: 20902-20908Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar) using primers Cj1294P3 (GTGGGTACCAACTCGATCACAATCTTGA) and Cj1294P4 (ATGCTAGGGCCCTCTACCACGCTAATAGCT) for cj1294, and primers Cj1121cP8 (GTCATCGGGCCCTAAAGCTTCAGCAGCATC) and Cj1121cP7 (ACAAGAATGCGGCCGCAAATGGAGGTTTTAGAACAA) for cj1121c. A chloramphenicol resistance cassette was PCR-amplified from the pRYIII vector (33Yao R. Alm R.A. Trust T.J. Guerry P. Gene (Amst.). 1993; 130: 127-130Crossref PubMed Scopus (200) Google Scholar) using primers CATCOLIP3 (GTCATCGGGCCCTTCCTTTCCAAGTTAATTGC) and CATCOLIP2 (GTCGGTACCTTATTTATTCAGCAAGTCTTG) for preparation of the cj1294 mutant and CATCOLIP3 and CATCOLIP4 (ACAAGAATGCGGCCGCTTATTTATTCAGCAAGTCTTG) for preparation of the cj1121c mutant. After digestion with ApaI and KpnI (for cj1294) or ApaI and NotI (for cj1121c), both PCR fragments (cat cassette and gene of interest) were ligated together to generate each disrupted gene. The disrupted genes were re-amplified using primers Cj1294P1 (AGGGTACATCTCCATGCTTACTTATTCTCATCA) and Cj1294P2 (GCGTCGGATCCTTATCCACAATATCCCTTTTT) and Cj1121cP1 (CGGGATCCATGAGATTTTTTCTTTCTCC) and Cj1121cP2 (GAAGATCTTAAGCCTTTATGCTCTTTA), cut with AflIII and BamHIII for cj1294 and BglII and BamHIII for cj1121c, and ligated to C. jejuni chromosomal DNA that had been cut with the same enzymes. The DNA was introduced into C. jejuni by natural transformation with 0.03% saponin using the biphasic method (9Nuijten P.J. Bleumink-Pluym N.M. Gaastra W. van der Zeijst B.A. Infect. Immun. 1989; 57: 1084-1088Crossref PubMed Google Scholar, 34van Vliet A.H.M. Wood A.C. Henderson J. Wooldridge K. Ketley J.M. Methods Microbiol. 1998; 27: 407-419Crossref Scopus (66) Google Scholar). After selection on 20 μg/ml chloramphenicol, candidate mutants were checked by PCR and Southern blotting.Growth Rates of C. jejuni—To assess growth rates, C. jejuni, wild-type or mutant, was inoculated in MH broth in Klett flasks at an A600 nm of 0.1, and growth was monitored for 16 h using a Klett Summerson photoelectric colorimeter.Enzyme Assays Using C. jejuni Cell Extracts—C. jejuni cell pellets (representing ∼100 μl of wet cells) were resuspended in ice-cold “breaking buffer” (20 mm sodium phosphate, pH 7.4, 1 mm EDTA) and ∼50 μl of acid-washed glass beads (Sigma) were added to the suspension. The cells were lysed by vigorous vortexing (three times for 30 s). The suspension was centrifuged at 12,000 × g for 10 min to remove unlysed cells and glass beads. The total protein concentration of the supernatants was measured using the Bio-Rad protein determination assay using bovine serum albumin as a standard. All supernatants from each series were then diluted at an equal protein concentration in breaking buffer for enzyme assays.A typical enzyme assay included 9.6 μl of supernatant, 0.5 mm UDP-GlcNAc, 0.12 μg of Cj1293, 10 mm glutamate, and 0.1 mm PLP in 20 mm Hepes buffer, pH 7.5. Reactions were incubated at 37 °C for 16 h. Enzymatic activity was stopped by snap freezing at –80 °C. The samples were analyzed by CE as described before.Production of the E158H and L131F Mutants of Cj1121c— Site-directed mutagenesis was performed using the Quik-Change mutagenesis procedure (Stratagene) except that the iProof™ High Fidelity DNA polymerase (Bio-Rad) was used, and six cycles of PCR were performed using each primer independently before pooling the reactions and allowing the PCR to resume for 19 more cycles as described previously (35Demendi M. Ishiyama N. Lam J.S. Berghuis A.M. Creuzenet C. Biochem. J. 2005; 389: 173-180Crossref PubMed Scopus (21) Google Scholar). The primers used were CATTGATTTTAACTCATTTTTATGGCAATGCG and CGCATTGCCATAAAAATGAGTTAAAATCAATG for E158H, and CGAAGATGCTGCTCATGCTTTAGGAAGTTT and CTTCCTAAAGCATGAGCAGCATCTTCG for L131F. The sequences introducing the mutated codons are underlined. The PCR conditions were 5 min at 98 °C, followed by 25 cycles (30 s at 98 °C, 1 min at 55 °C, and 3 min at 72 °C) and a final elongation of 7 min at 72 °C. The sample was treated with DpnI (Stratagene) to eliminate native methylated plasmid DNA, and the PCR product was transformed into E. coli DH5α with selection on 100 μg/ml ampicillin. The plasmids extracted from independent clones were sequenced using the T7 promoter primer and primer CACTTCAGGTGGAGGTATGCT (internal to cj1121c) to check for the exclusive presence of the desired mutations. Protein expression and purification, as well as activity assays, were performed as described above for the wild-type protein.Motility Assays—C. jejuni were grown for 24 h on MH plates, harvested in MH broth, and adjusted to A600 nm of 0.2. Motility plates (0.3% agar in MH) were stabbed in triplicate with the wild-type or cj1121c mutant and incubated for 36–48 h under microaerophilic conditions at 37 °C. The diameter of the motility halo was monitored over time.Flagellin Analyses—Flagellins were extracted by glycine extraction (0.2 m glycine, pH 2.2, for 10 min at room temperature) and run on a 10% SDS-polyacrylamide gel with detection by Ponceau S staining or Western immunoblot using an antiflagellin antibody as described before (36Merkx-Jacques A. Obhi R.K. Bethune G. Creuzenet C. J. Bacteriol. 2004; 186: 2253-2265Crossref PubMed Scopus (31) Google Scholar). The presence or absence of flagella was also monitored by electron microscopy by negative staining with 2% ammonium molybdate. EM was done in the Department of Microbiology and Immunology at the University of Western Ontario.Tissue Culture Experiments—Caco-2 cells were grown for 3 days until they formed a confluent monolayer (∼650,000 cells per well in 24-well plates) and were fully differentiated, as determined by measuring the hydrolysis of p-nitrophenyl phosphate in a standard colorimetric assay (detection at 405 nm) (37Kucerova D. Stokrova J. Korb J. Sloncova E. Tuhackova Z. Sovova V. Int. J. Mol. Med. 2002; 10: 779-784PubMed Google Scholar). The cells were infected for 5 h with wild-type or mutant C. jejuni that had been grown for 48 h in tryptic soy broth (Oxoid) medium. Approximately 6.5 × 107 cfu of C. jejuni were added, resulting in a multiplicity of infection of 1 Caco-2 cell per 100 bacteria. The plates were spun briefly (500 × g for 5 min at room temperature) to maximize contact between the bacteria and the cell monolayer. To determine total bacterial cell association (adhering and internalized bacteria), Caco-2 cell monolayers were washed three times, lysed with 0.1% Triton X-100 for 10 min, and viable bacterial counts determined by plating serial dilutions. To determine the number of internalized bacteria, the Caco-2 cell monolayers were treated with 200 μg/ml gentamycin for 2 h to kill extracellular bacteria. The cells were then washed and treated as above to determine bacterial viable counts. Three independent sets of experiments were done, with triplicates within each experiment. The data represent the average of all experiments.Chicken Colonization Assays—For chicken infections, C. jejuni was grown on tryptic soy agar plates containing 5% sheep blood under microaerophilic conditions at 42 °C for 24 h. Cells from plates were resuspended in phosphate-buffered saline, pH 7.4, adjusted to an A600 nm of 0.2 (∼109 cfu/ml), and diluted 1:100 in phosphate-buffered saline. Two-day-old White Leghorn specific pathogen-free chicks were orally administered 100 μl (106 cfu) of either the C. jejuni wild-type strain or the cj1121c mutant. Five days later, chicks were euthanized, and the caeca and their contents were harvested, weighed, and homogenized. Viable counts were obtained from serial dilutions of samples that were plated on Campylobacter-selective medium plates (Quélab Inc., Montreal, Canada) for 48 h.Analysis of Protein Glycosylation by SBA Western Blotting— C. jejuni wild-type and cj1121c mutant cell pellets were resuspended in SDS-PAGE loading buffer, analyzed on 10% SDS-polyacrylamide gels, and transferred onto nitrocellulose using standard procedures. Detection was performed by staining with Ponceau S red" @default.
• W2007945445 created "2016-06-24" @default.
• W2007945445 creator A5000174953 @default.
• W2007945445 creator A5004316003 @default.
• W2007945445 creator A5030542493 @default.
• W2007945445 creator A5031275251 @default.
• W2007945445 creator A5050156704 @default.
• W2007945445 creator A5059639522 @default.
• W2007945445 creator A5065155909 @default.
• W2007945445 creator A5091533484 @default.
• W2007945445 date "2006-09-01" @default.
• W2007945445 modified "2023-10-03" @default.
• W2007945445 title "Cj1121c, a Novel UDP-4-keto-6-deoxy-GlcNAc C-4 Aminotransferase Essential for Protein Glycosylation and Virulence in Campylobacter jejuni" @default.
• W2007945445 cites W1496336166 @default.
• W2007945445 cites W1578434328 @default.
• W2007945445 cites W1581703278 @default.
• W2007945445 cites W1595022912 @default.
• W2007945445 cites W1853727284 @default.
• W2007945445 cites W189193852 @default.
• W2007945445 cites W1943024006 @default.
• W2007945445 cites W1963382297 @default.
• W2007945445 cites W1967413988 @default.
• W2007945445 cites W1967977834 @default.
• W2007945445 cites W1972551162 @default.
• W2007945445 cites W1984646810 @default.
• W2007945445 cites W1988391981 @default.
• W2007945445 cites W1995777663 @default.
• W2007945445 cites W1997261048 @default.
• W2007945445 cites W2004677095 @default.
• W2007945445 cites W2048622484 @default.
• W2007945445 cites W2052962301 @default.
• W2007945445 cites W2071968632 @default.
• W2007945445 cites W2072163165 @default.
• W2007945445 cites W2074678796 @default.
• W2007945445 cites W2080329840 @default.
• W2007945445 cites W2089509030 @default.
• W2007945445 cites W2090378229 @default.
• W2007945445 cites W2101220987 @default.
• W2007945445 cites W2107508284 @default.
• W2007945445 cites W2108832457 @default.
• W2007945445 cites W2110132014 @default.
• W2007945445 cites W2115175555 @default.
• W2007945445 cites W2116147857 @default.
• W2007945445 cites W2120904752 @default.
• W2007945445 cites W2122029016 @default.
• W2007945445 cites W2128214209 @default.
• W2007945445 cites W2128553162 @default.
• W2007945445 cites W2131571647 @default.
• W2007945445 cites W2140417635 @default.
• W2007945445 cites W2142342668 @default.
• W2007945445 cites W2143361610 @default.
• W2007945445 cites W2144644296 @default.
• W2007945445 cites W2145996426 @default.
• W2007945445 cites W2148906574 @default.
• W2007945445 cites W2150764734 @default.
• W2007945445 cites W2153778599 @default.
• W2007945445 cites W2156512781 @default.
• W2007945445 cites W2158692910 @default.
• W2007945445 cites W2160197593 @default.
• W2007945445 cites W2161171034 @default.
• W2007945445 cites W2169733608 @default.
• W2007945445 cites W2420410816 @default.
• W2007945445 doi "https://doi.org/10.1074/jbc.m511714200" @default.
• W2007945445 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16690622" @default.
• W2007945445 hasPublicationYear "2006" @default.
• W2007945445 type Work @default.
• W2007945445 sameAs 2007945445 @default.
• W2007945445 citedByCount "35" @default.
• W2007945445 countsByYear W20079454452012 @default.
• W2007945445 countsByYear W20079454452013 @default.
• W2007945445 countsByYear W20079454452014 @default.
• W2007945445 countsByYear W20079454452015 @default.
• W2007945445 countsByYear W20079454452016 @default.
• W2007945445 countsByYear W20079454452017 @default.
• W2007945445 countsByYear W20079454452018 @default.
• W2007945445 countsByYear W20079454452019 @default.
• W2007945445 countsByYear W20079454452021 @default.
• W2007945445 countsByYear W20079454452022 @default.
• W2007945445 crossrefType "journal-article" @default.
• W2007945445 hasAuthorship W2007945445A5000174953 @default.
• W2007945445 hasAuthorship W2007945445A5004316003 @default.
• W2007945445 hasAuthorship W2007945445A5030542493 @default.
• W2007945445 hasAuthorship W2007945445A5031275251 @default.
• W2007945445 hasAuthorship W2007945445A5050156704 @default.
• W2007945445 hasAuthorship W2007945445A5059639522 @default.
• W2007945445 hasAuthorship W2007945445A5065155909 @default.
• W2007945445 hasAuthorship W2007945445A5091533484 @default.
• W2007945445 hasBestOaLocation W20079454451 @default.
• W2007945445 hasConcept C104317684 @default.
• W2007945445 hasConcept C185592680 @default.
• W2007945445 hasConcept C2776957140 @default.
• W2007945445 hasConcept C2777313579 @default.
• W2007945445 hasConcept C2779910956 @default.
• W2007945445 hasConcept C523546767 @default.
• W2007945445 hasConcept C54355233 @default.
• W2007945445 hasConcept C55493867 @default.
• W2007945445 hasConcept C60987743 @default.
• W2007945445 hasConcept C86803240 @default.

• next