FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2008028586> ?p ?o ?g. }

• W2008028586 endingPage "19455" @default.
• W2008028586 startingPage "19449" @default.
• W2008028586 abstract "Class III ribonucleotide reductase (RNR) is an anaerobic glycyl radical enzyme that catalyzes the reduction of ribonucleotides to deoxyribonucleotides. We have investigated the importance in the reaction mechanism of nine conserved cysteine residues in class III RNR from bacteriophage T4. By using site-directed mutagenesis, we show that two of the cysteines, Cys-79 and Cys-290, are directly involved in the reaction mechanism. Based on the positioning of these two residues in the active site region of the known three-dimensional structure of the phage T4 enzyme, and their structural equivalence to two cysteine residues in the active site region of the aerobic class I RNR, we suggest that Cys-290 participates in the reaction mechanism by forming a transient thiyl radical and that Cys-79 participates in the actual reduction of the substrate. Our results provide strong experimental evidence for a similar radical-based reaction mechanism in all classes of RNR but also identify important differences between class III RNR and the other classes of RNR as regards the reduction per se. We also identify a cluster of four cysteines (Cys-543, Cys-546, Cys-561, and Cys-564) in the C-terminal part of the class III enzyme, which are essential for formation of the glycyl radical. These cysteines make up a CX 2C–CX 2C motif in the vicinity of the stable radical at Gly-580. We propose that the four cysteines are involved in radical transfer between Gly-580 and the cofactor S-adenosylmethionine of the activating NrdG enzyme needed for glycyl radical generation. Class III ribonucleotide reductase (RNR) is an anaerobic glycyl radical enzyme that catalyzes the reduction of ribonucleotides to deoxyribonucleotides. We have investigated the importance in the reaction mechanism of nine conserved cysteine residues in class III RNR from bacteriophage T4. By using site-directed mutagenesis, we show that two of the cysteines, Cys-79 and Cys-290, are directly involved in the reaction mechanism. Based on the positioning of these two residues in the active site region of the known three-dimensional structure of the phage T4 enzyme, and their structural equivalence to two cysteine residues in the active site region of the aerobic class I RNR, we suggest that Cys-290 participates in the reaction mechanism by forming a transient thiyl radical and that Cys-79 participates in the actual reduction of the substrate. Our results provide strong experimental evidence for a similar radical-based reaction mechanism in all classes of RNR but also identify important differences between class III RNR and the other classes of RNR as regards the reduction per se. We also identify a cluster of four cysteines (Cys-543, Cys-546, Cys-561, and Cys-564) in the C-terminal part of the class III enzyme, which are essential for formation of the glycyl radical. These cysteines make up a CX 2C–CX 2C motif in the vicinity of the stable radical at Gly-580. We propose that the four cysteines are involved in radical transfer between Gly-580 and the cofactor S-adenosylmethionine of the activating NrdG enzyme needed for glycyl radical generation. ribonucleotide reductase S-adenosylmethionine dithiothreitol electron paramagnetic resonance isopropyl-1-thio-β-d-galactopyranoside truncated form of NrdD pyruvate formate-lyase polyacrylamide gel electrophoresis Ribonucleotide reductase (RNR)1 catalyzes the reduction of ribonucleotides to their corresponding deoxyribonucleotides. As this is the only way for de novosynthesis of building blocks for DNA, RNR is an essential constituent of all living cells. At least three different classes of RNRs can be distinguished based on their polypeptide composition and cofactor requirements (1.Sjöberg B.-M. Struct. Bonding. 1997; 88: 139-173Crossref Google Scholar, 2.Jordan A. Reichard P. Annu. Rev. Biochem. 1998; 67: 71-98Crossref PubMed Scopus (626) Google Scholar, 3.Stubbe J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2723-2724Crossref PubMed Scopus (87) Google Scholar). Several prokaryotic organisms encode more than one class of RNR and in some cases also more than one representative from the same class. All previously characterized class I and II RNRs operate via a radical based mechanism, considered to involve one cysteine residue that forms a transient thiyl radical during catalysis and a cysteine pair that provides the reducing electrons (4.Åberg A. Hahne S. Karlsson M. Larsson A. Ormö M. Åhgren A. Sjöberg B.-M. J. Biol. Chem. 1989; 264: 12249-12252Abstract Full Text PDF PubMed Google Scholar, 5.Mao S.S. Holler T.P., Yu, G.X. Bollinger J.M. Booker S. Johnston M.I. Stubbe J. Biochemistry. 1992; 31: 9733-9743Crossref PubMed Scopus (201) Google Scholar, 6.Booker S. Licht S. Broderick J. Stubbe J. Biochemistry. 1994; 33: 12676-12685Crossref PubMed Scopus (92) Google Scholar). However, the two classes differ in the way they acquire the thiyl radical. The resting class I RNR harbors a stable tyrosyl radical close to a diferric-oxo center within one of its components. The tyrosyl radical interacts with the active site in the other component via a long range radical transfer pathway. Class II RNRs require the cofactor adenosylcobalamin that by homolytic cleavage acts as a thiyl radical generator. Class III RNRs represent a third variant and harbors a stable glycyl radical within the so-called NrdD component that also harbors the active site region. An activating component, the 4Fe-4S NrdG protein, has the ability to generate the glycyl radical in NrdD via cleavage of the cofactor AdoMet (7.Ollagnier S. Mulliez E. Schmidt P.P. Eliasson R. Gaillard J. Deronzier C. Bergman T. Gräslund A. Reichard P. Fontecave M. J. Biol. Chem. 1997; 272: 24216-24223Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 8.Ollagnier S. Meier C. Mulliez E. Gaillard J. Schuenemann V. Trautwein A. Mattioli T. Lutz M. Fontecave M. J. Am. Chem. Soc. 1999; 121: 6344-6350Crossref Scopus (56) Google Scholar, 9.Tamarit J. Mulliez E. Meier C. Trautwein A. Fontecave M. J. Biol. Chem. 1999; 274: 31291-31296Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Class III RNR is an anaerobic enzyme, and the glycyl radical is extremely sensitive to oxygen. In the recently deduced three-dimensional structure of a class III enzyme from bacteriophage T4, only two cysteine residues were encountered in the active site region (10.Logan D.T. Andersson J. Sjöberg B.-M. Nordlund P. Science. 1999; 283: 1499-1504Crossref PubMed Scopus (168) Google Scholar). The radical generation procedure of class III RNRs is similar to that of pyruvate formate-lyase (PFL), a key enzyme in anaerobic glucose metabolism (11.Knappe J. Wagner A.F.V. Methods Enzymol. 1995; 258: 343-362Crossref PubMed Scopus (31) Google Scholar). An activating iron-sulfur protein cleaves AdoMet to generate a glycyl radical in PFL (12.Wagner A.F. Frey M. Neugebauer F.A. Schäfer W. Knappe J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 996-1000Crossref PubMed Scopus (306) Google Scholar, 13.Frey M. Rothe M. Wagner A.F. Knappe J. J. Biol. Chem. 1994; 269: 12432-12437Abstract Full Text PDF PubMed Google Scholar). Two vicinal cysteines, Cys-418 and Cys-419, are crucial for catalysis, and both are capable of forming a transient thiyl radical (14.Knappe J. Elbert S. Frey M. Wagner A.F.V. Biochem. Soc. Trans. 1993; 21: 731-734Crossref PubMed Scopus (76) Google Scholar, 15.Parast C.V. Wong K.K. Kozarich J.W. Peisach J. Magliozzo R.S. Biochemistry. 1995; 34: 5712-5717Crossref PubMed Scopus (42) Google Scholar, 16.Becker A. FritzWolf K. Kabsch W. Knappe J. Schultz S. Wagner A.F.V. Nat. Struct. Biol. 1999; 6: 969-975Crossref PubMed Scopus (173) Google Scholar). Recently, other proteins have also been suggested to harbor a glycyl radical (17.Hesslinger C. Fairhurst S.A. Sawers G. Mol. Microbiol. 1998; 27: 477-492Crossref PubMed Scopus (123) Google Scholar, 18.Leuthner B. Leutwein C. Schulz H. Horth P. Haehnel W. Schiltz E. Schagger H. Heider J. Mol. Microbiol. 1998; 28: 615-628Crossref PubMed Scopus (228) Google Scholar), making glycyl radical enzymes a distinct group of proteins (19.Eklund H. Fontecave M. Structure. 1999; 7: R257-R262Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Despite the lack of significant overall amino acid sequence similarities between class III RNRs on the one hand and class I and II RNRs on the other hand, or between class III RNRs and PFL enzymes, the catalytic cores of T4 class III RNR, protein R1 of class I RNR fromEscherichia coli, and E. coli PFL are strikingly similar (10.Logan D.T. Andersson J. Sjöberg B.-M. Nordlund P. Science. 1999; 283: 1499-1504Crossref PubMed Scopus (168) Google Scholar, 16.Becker A. FritzWolf K. Kabsch W. Knappe J. Schultz S. Wagner A.F.V. Nat. Struct. Biol. 1999; 6: 969-975Crossref PubMed Scopus (173) Google Scholar, 19.Eklund H. Fontecave M. Structure. 1999; 7: R257-R262Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 20.Uhlin U. Eklund H. Nature. 1994; 370: 533-539Crossref PubMed Scopus (513) Google Scholar). Interestingly, Cys-290 in the class III enzyme is in a position corresponding to the active site residues Cys-439 in the R1 structure (Fig. 1) and Cys-419 in the PFL structure. Cys-439 in R1 is the residue proposed to form the transient thiyl radical during catalysis of RNR. Additionally, Cys-79 from the class III enzyme is in a corresponding position to Cys-225 in R1, the residue in class I RNR that together with Cys-462 forms the redox active cysteine pair mentioned above (Fig. 1). Cys-462 in the class I structure has no cysteine counterpart in the class III RNR. These structural similarities suggest that Cys-290 in class III RNR could have the same proposed function as Cys-439 in the class I reaction mechanism, but it also suggests that the reaction mechanisms are different as regards Cys-79 in class III RNR and the redox active Cys-225–Cys-462 pair in the class I enzyme. We have earlier used site-directed mutagenesis to identify Gly-580 in phage T4 class III RNR as the site of the stable glycyl radical (21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). In this work we have used the same approach to identify cysteine residues involved in the reaction mechanism of the T4 class III enzyme. Alignment of available class III RNR sequences identified five invariant, one highly conserved, and three moderately conserved cysteine residues (cf. Table I). We show that six of these cysteine residues are essential for class III RNR function. Cys-79 and Cys-290 are directly involved in catalysis, whereas a cluster of four cysteine residues (Cys-543, Cys-546, Cys-561, and Cys-564) in the C-terminal part of the enzyme is involved in the radical generation mechanism. We propose that Cys-290 forms a transient thiyl radical corresponding to Cys-439 in the class I RNR, which suggests that the initiation of the reaction for all three RNR classes is similar. In addition, we propose that the C-terminal cysteine cluster is involved in the radical transfer between AdoMet and the stable radical position at Gly-580 in the T4 enzyme.Table ISummary of sequence comparisons of NrdD from different organismsNrdD sequenceaSequences are from the National Center for Biotechnology Information (NCBI).Conserved residuesCys-79Cys-260Cys-290Cys-453Cys-543/Cys-546/Cys-561/Cys-564Cys-579Bacteriophage T4++++++Escherichia coli++++++Lactococcus lactis++++++Haemophilus influenza++++++Ralstonia eutrophaplasmid pHG1+−+−−Methanobacterium thermoautotrophicum+−+−+−Methanococcus jannaschii+−+−+−Pyrococcus horikoshii/abyssi+−+−+−Other NrdD sequencesbIncludes Clostridium acetobutylicum, Corynebacterium diphteriae, Enterococcus faecalis, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus mutans, Streptococcus pyogenes, Salmonella typhi/typhimurium, Vibrio cholera, andYersinia pestis, all from the NCBI.,cNumbers refer to occurrence of a cysteine residue per number of sequences aligned.19/1912/1919/1912/19CX 2 CX 10–14CX 2C, 16/1912/19CX2HX10CX2C, 3/19Conserved motifCysCysCX 2C—CX 2Ca Sequences are from the National Center for Biotechnology Information (NCBI).b Includes Clostridium acetobutylicum, Corynebacterium diphteriae, Enterococcus faecalis, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus mutans, Streptococcus pyogenes, Salmonella typhi/typhimurium, Vibrio cholera, andYersinia pestis, all from the NCBI.c Numbers refer to occurrence of a cysteine residue per number of sequences aligned. Open table in a new tab Oligonucleotides used for site-directed mutagenesis and sequencing were synthesized by Scandinavian Gene Synthesis AB, Sweden. Restriction enzymes were from Amersham Pharmacia Biotech, New England Biolabs, or Roche Molecular Biochemicals. Chemicals were from Sigma, Saveen, and Amersham Pharmacia Biotech. E. coli CJ236 (dut-1, ung-1, thi-1,relA1/pCJ105), E. coli MV1190 (Δ (lac-proAB), thi, supE, Δ(srl-recA)306::Tn10/F′traD36,proAB, lacIqZΔM15), E. coli JM109(DE3) endA1, recA1,gyrA96, thi, hsdR17, (rK−, mK+), relA1,supE44, Δ(lac-proAB), [F′, traD36,proAB, lacIqZΔM15], λ(DE3),E. coli C1-a, a wild-type, prototrophic strain. Plasmids pET29T4nrdD and pET21aT4nrdG were described previously (21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Plasmid pEE1010 containing the gene for ferredoxin (flavodoxin) NADP+ reductase (22.Bianchi V. Reichard P. Eliasson R. Pontis E. Krook M. Jörnvall H. Haggård-Ljungquist E. J. Bacteriol. 1993; 175: 1590-1595Crossref PubMed Google Scholar) was a kind gift from Vera Bianchi and Elisabeth Haggård-Ljungquist. The expression plasmid pDH1 for flavodoxin (23.Bianchi V. Eliasson R. Fontecave M. Mulliez E. Hoover D.M. Matthews R.G. Reichard P. Biochem. Biophys. Res. Commun. 1993; 197: 792-797Crossref PubMed Scopus (96) Google Scholar) was a kind gift from Peter Reichard. All mutants were constructed with the Kunkel method (24.Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 488-492Crossref PubMed Scopus (4903) Google Scholar, 25.Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4560) Google Scholar) using the Mutagene phagemidin vitro mutagenesis kit (version 2) as described previously (21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). The mutagenic oligonucleotides also contained the insertion or deletion of a restriction enzyme cleavage site to facilitate the screening for mutants. The primers (and within parentheses the screening restriction enzyme) used for each mutation were as follows: C79S, 5′-d(TACTAAACAGCT ATTAGTAAATG)-3′ (AluI); C260S, 5′-d(TTTTGCTTGCGGACTCTAGAGCA)-3′ (HhaI); C290S, 5′-d(AGAAACTACGGAACCCATCGGA)-3′ (NlaIV); C453S, 5′-d(CTGTATCGAGCTTAGAGAAGCGATA)-3′ (DdeI); C543S, 5′-d(CCACATGTAAA GCTTTTATCTACTG)-3′ (AluI); C546S, 5′-d(GGGTACTTCCAGATGTAAAACAT)-3′ (AflIII); C561S, 5′-d(CACAAATAGAAGAAACAAATCCG)-3′ (MboII); C564S, 5′-CAGTTTCTCCAGAAATAGAACAA-3′ (BpmI); C579S, 5′-CCAAATAACCAGATGTTCTTCTT-3′ (AflIII). The mismatching bases are shown in bold, and the changed codon is underlined. All mutant plasmids were confirmed by sequencing using an ABI Prism Cycle sequencing kit from Perkin-Elmer. The analyzing gels were run by Katarina Gell at CMB, Karolinska Institute, Sweden. JM109(DE3) strains containing wild-type or mutant pET29T4nrdD (kanamycinR) plasmids and the wild-type pET21aT4nrdG plasmid (ampicillinR) were grown aerobically in LB medium supplemented with 35 μg/ml kanamycin and 100 μg/ml carbenicillin. The cultures were grown until the A 640 reached 0.5 and were then induced with isopropyl-1-thio-β-d-galactopyranoside (IPTG; final concentration 1 mm). Samples of 0.5 absorbance units were withdrawn immediately before induction and after 3 h of induction. The samples were analyzed by SDS-PAGE on a 12.7% gel and stained with Coomassie Brilliant Blue. The gel was then densitometrically scanned, and the bands were quantified using the software ImageQuant from Molecular Dynamics. In Fig. 2, below the lanes, the extent of truncation is shown as percent NrdD′, which is the amount of NrdD′ divided by the sum of NrdD and NrdD′. For anaerobic growth and anaerobic crude extract preparations of wild-type or mutant NrdD, and of wild-type NrdG, the procedure described in Ref. 21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar was followed. Anaerobic activity assays and EPR measurements in anaerobic crude extracts are also described in Ref. 21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar. Wild-type and mutant proteins were prepared as described previously (26.Olcott M.C. Andersson J. Sjöberg B.-M. J. Biol. Chem. 1998; 273: 24853-24860Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). In brief, the NrdD protein was expressed aerobically using IPTG induction. After harvesting, the frozen cells were disintegrated in an X-press (from BIOX), extracted in 20 mm Tris-HCl, pH 8.0, 1 mm DTT, and soluble proteins were batch-purified by streptomycin sulfate (1% final concentration) and ammonium sulfate (40% final concentration) precipitations. Further purification was achieved using hydrophobic interaction chromatography with butyl-Sepharose 4 Fast Flow media from Amersham Pharmacia Biotech. The JM109(DE3) strain containing the plasmid pET21aT4nrdG was grown in Luria Broth medium, pH 7.0, supplemented with 50 μg/ml carbenicillin, and deionized water was used. The growth was done in a 10-liter container using a Microferm® fermentor from New Brunswick Scientific Co. The culture was grown at 30 °C, and when the cells reached an A 640 of 0.6 they were induced with IPTG (final concentration 0.5 mm), and the temperature was lowered (typically to 14–19 °C) to avoid formation of inclusion bodies. After 20 h of induction (A 640 = 1.0–1.4) the cells were harvested by centrifugation, and the pellet was frozen at −80 °C. The frozen pellet was pressed 3–5 times in an X-press and extracted with 100 mm Tris-HCl, pH 7.6, 5 mm DTT in a blender. Nucleic acids were removed by precipitation with streptomycin sulfate to a final concentration of 1%. The proteins were then precipitated with 40% ammonium sulfate and desalted over a NAP column containing Sephadex® G-25 medium from Amersham Pharmacia Biotech. The NrdG content was typically ∼10% of the total protein fraction, as estimated from SDS-PAGE analyses. The desalted crude extract preparation was later used for EPR samples and enzymatic activity assays. The protocol from Ref. 22.Bianchi V. Reichard P. Eliasson R. Pontis E. Krook M. Jörnvall H. Haggård-Ljungquist E. J. Bacteriol. 1993; 175: 1590-1595Crossref PubMed Google Scholar was followed with some minor changes. The C1-a strain containing the plasmid pEE1010 was grown to stationary phase for expression of flavodoxin reductase, and the cells were then lysed with lysozyme treatment and freeze-thawing. A Superose-12 column was used to purify the 29-kDa protein, and its flavin-related absorption spectrum was found identical to that in Ref.22.Bianchi V. Reichard P. Eliasson R. Pontis E. Krook M. Jörnvall H. Haggård-Ljungquist E. J. Bacteriol. 1993; 175: 1590-1595Crossref PubMed Google Scholar. The protocol from D. Hoover was followed. The plasmid pDH1 containing the gene for flavodoxin was grown in the C1-a strain, and induction was made with IPTG; the cells were lysozyme-treated and freeze-thawed 3 times; neutralized FMN was added, 1–2 mg/liter culture. A DEAE column was used to separate the flavodoxin protein as confirmed by SDS-PAGE, its absorption spectrum, and theA 274/A 467 ratio. Purified wild-type or mutant NrdD, crude extract preparation of NrdG, and a mixture containing all the activation components were flushed separately with argon at 4 °C for 40 min in order to remove oxygen. They were then transferred to a Forma Scientific anaerobic glove box where they were mixed and incubated anaerobically for 45 min at room temperature. The final concentrations were 37.5 μm pure NrdD, NrdG-containing crude extract (40 mg/ml total protein, ∼75 μm NrdG), 30 mmTris-HCl, pH 8.0, 30 mm KCl, 5 mm sodium formate, 5 mm DTT, 1.25 mm NADPH, 18 μm flavodoxin reductase, 6 μm flavodoxin, and 0.5 mm AdoMet, and the total volume was 160 μl. The samples were then transferred to EPR tubes, sealed, taken out of the anaerobic box, and frozen in liquid nitrogen. X-band EPR measurements were performed at 77 K on a Bruker ESP300 spectrometer using a cold finger Dewar filled with liquid nitrogen. Double integrals of the EPR signals were determined using the Bruker software, and the radical content was calculated from the spin concentration comparing with a Cu2+-EDTA standard and a known glycyl radical standard. Purified wild-type or mutant NrdD, crude extract preparation of NrdG, an activation mixture containing all the necessary components for generating the glycyl radical, and a substrate mixture were flushed separately with argon at 4 °C for 40 min to remove oxygen before transferring them to the anaerobic box. NrdD, NrdG and the activation mixture were then mixed and incubated at room temperature for 10 min. The incubation mixture contained 0.12 μm pure NrdD, NrdG-containing crude extract (10 mg/ml total protein,∼20 μm NrdG), 30 mm Tris-HCl, pH 8.0, 30 mm KCl, 5 mm DTT, 1.25 mm NADPH, 3 μm flavodoxin reductase, 2 μm flavodoxin, and 0.5 mm AdoMet, and the total volume was 25 μl. After 10 min, 25 μl of substrate mixture was added giving final concentrations of 30 mm Tris-HCl, pH 8.0, 30 mm KCl, 5 mm sodium formate, 5 mm DTT, 20 mm MgCl2, 1 mm dATP, and 5 mm [3H]CTP. Incubation with substrate was stopped after 20 min by addition of 500 μl of 1m perchloric acid. A carrier, 50 μl of dCMP, 5 mg/ml, was added as internal standard to follow recovery during the work-up procedure. After dephosphorylation to the monophosphate level by boiling, separation of [3H]dCMP and [3H]CMP was performed over a Dowex-50 column, and isocratic elution was made with 0.2 m acetic acid. The formed 3H-labeled product was then quantified in a scintillation counter. The analyses were made by ICP-AES, plasma emission spectrometry, or ICP-SMS, plasma mass spectrometry by SGAB Analytica, Luleå, Sweden. One additional purification step (anionic mono-Q chromatography) was added prior to analyses. Protein samples contained 85–90% NrdD as judged from SDS-PAGE analysis and Coomassie Blue staining. To test our hypothesis that cysteine residues are involved in the reaction mechanism of the class III RNRs, we used site-directed mutagenesis to change conserved cysteines in the T4 NrdD protein. In all, nine cysteines (cf. Table I) were separately mutated to serine in order to abolish the redox function of the SH group while maintaining the size and the H-bonding capacity of the side chain. Five of these residues (Cys-79, Cys-290, Cys-543, Cys-561, and Cys-564) are invariant, and one (Cys-546) is highly conserved (TableI). Four of the C-terminal cysteines make up a CX 2C–CX 2C motif, below denoted the C-terminal cluster. Cys-260 and Cys-453 are only conserved in 12 of the 19 available NrdD sequences, as is Cys-579, adjacent to the site of the stable radical at Gly-580 (Table I). During the expression and purification all mutant Cys → Ser NrdD proteins behaved like wild type. The class III anaerobic RNRs have been shown to undergo truncation at the site of the glycyl radical when the radical-containing enzyme is exposed to oxygen (27.King D.S. Reichard P. Biochem. Biophys. Res. Commun. 1995; 206: 731-735Crossref PubMed Scopus (35) Google Scholar). A facile in vivo assay to detect formation of the glycyl radical is to monitor this truncation of NrdD when coexpressed aerobically with NrdG (21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). This assay was used to monitor whether a glycyl radical is formed or not in the Cys → Ser mutants. Samples from the coexpressions were analyzed on a SDS-PAGE gel (Fig. 2). The full-length NrdD protein migrates approximately according to its theoretical molecular mass of 68 kDa (21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). The truncated form, denoted NrdD′, migrates slightly faster than the full-length NrdD, in good agreement with the anticipated truncation at Gly-580 ∼3 kDa from the C terminus of the phage T4 NrdD. The oxygen-dependent cleavage can clearly be seen for the mutants C79S, C260S, C290S, C453S, and C579S (Fig. 2). As a negative control, the G580A mutant is also shown; oxygen-dependent cleavage is not possible in this mutant since no radical can be formed at Ala-580 (21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). To estimate the extent of truncation, the protein gel was densitometrically scanned, and the protein bands were quantified. Samples harvested before induction with IPTG contained an unrelated protein band that comigrates with truncated NrdD′ protein (Fig. 2,Uninduced). This unrelated protein band was subtracted from the NrdD′ protein band. As can be seen, the truncation occurs in approximately 60% of the polypeptide chains of wild-type NrdD. The extent of truncation agrees with the amount of radical per NrdD dimer (∼0.55; cf. Table III) and has earlier been observed for NrdD from phage T4 and from E. coli (21.Young P. Andersson J. Sahlin M. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 20770-20775Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 28.Sun X.Y. Eliasson R. Pontis E. Andersson J. Buist G. Sjöberg B.-M. Reichard P. J. Biol. Chem. 1995; 270: 2443-2446Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 29.Sun X.Y. Ollagnier S. Schmidt P.P. Atta M. Mulliez E. Lepape L. Eliasson R. Gräslund A. Fontecave M. Reichard P. Sjöberg B.-M. J. Biol. Chem. 1996; 271: 6827-6831Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar). The mutants C79S, C260S, C290S, and C453S were truncated to 51–62%, and the C579S mutant was truncated to 39% (Fig. 2). This result clearly establishes that a glycyl radical could be formed in these five mutants. Fig. 2 also shows that no truncation occurs in the four C-terminal mutants C543S, C546S, C561S, and C564S suggesting that no glycyl radical could be formed in these mutants.Table IIISpecific activity and radical content for purified wild-type NrdD and the cysteine mutantsNrdD proteinSpecific activityRelative specific activityaThe specific activity of wild-type NrdD was set to 1.00, and the specific activities of the mutants were correlated to this value.Glycyl radical/NrdD dimerRelative glycyl radical contentbThe glycyl radical content/NrdD dimer of wild-type NrdD was set to 1.00, and the glycyl radical content/NrdD dimers for the mutants were correlated to this value.nmol/min/mgμm/μmWild type1350cThis is an average value from two separate experiments.1.000.541.00C79SNDdND, not detectable; detection limits are ∼40 nmol min−1 mg−1 in specific activity and ∼0.01 mol/mol in radical content.—e—, below the detection limit.0.450.83C260S14801.100.470.87C290SND—ND—C453S9200.680.200.37C543SND—ND—C546SND—ND—C561SND—ND—C564SND—ND—C579S900.07ND—a The specific activity of wild-type NrdD was set to 1.00, and the specific activities of the mutants were correlated to this value.b The glycyl radical content/NrdD dimer of wild-type NrdD was set to 1.00, and the glycyl radical content/NrdD dimers for the mutants were correlated to this value.c This is an average value from two separate experiments.d ND, not detectable; detection limits are ∼40 nmol min−1 mg−1 in specific activity and ∼0.01 mol/mol in radical content.e —, below the detection limit. Open table in a new tab Anaerobic crude extracts from the four mutants C79S, C260S, C290S, and C453S were combined with anaerobically produced NrdG-containing extracts and incubated with AdoMet to promote generation of the glycyl radical and were then used for EPR measurements and enzymatic activity assays. All four mutant proteins displayed a doublet EPR signal with the characteristics of the glycyl radical of wild-type NrdD (Fig.3 A). The relative radical contents compared with wild-type NrdD are shown in TableII. As can be seen, the mutants C79S, C260S, and C453S have radical contents comparable to wild type; the mutant C260S has an even higher radical content than wild-type NrdD. The mutant C290S has roughly half the radical content of wild-type NrdD.Table IISpecific activity and radical content for anaerobic crude extracts of wild-type NrdD and the putative active site cysteine mutantsNrdD proteinSpecific activityaThe specific activity is calculated per total protein content in the anaerobic crude extract. The NrdD protein is estimated to ≈20% of the total protein.Relative specific activitybThe specific activity of wild-type NrdD was set to 1.00, and the specific activities of the mutants were correlated to this value.Glycyl radical contentRelative glycyl radical contentcThe glycyl radical content of wild-type NrdD was set to 1.00, and the glycyl radical contents for the mutants were correlated to this value.nmol/min/mgμmWild type2701.003.21.00C79S NDdND, not detectable; detection limits are ∼40 nmol min−1 mg−1 in specific activity and ∼0.5 μm r" @default.
• W2008028586 created "2016-06-24" @default.
• W2008028586 creator A5005029604 @default.
• W2008028586 creator A5016136510 @default.
• W2008028586 creator A5017566012 @default.
• W2008028586 creator A5056699006 @default.
• W2008028586 date "2000-06-01" @default.
• W2008028586 modified "2023-10-16" @default.
• W2008028586 title "Cysteines Involved in Radical Generation and Catalysis of Class III Anaerobic Ribonucleotide Reductase" @default.
• W2008028586 cites W1482410919 @default.
• W2008028586 cites W1498191390 @default.
• W2008028586 cites W1506430822 @default.
• W2008028586 cites W1509584721 @default.
• W2008028586 cites W1552443753 @default.
• W2008028586 cites W1589868601 @default.
• W2008028586 cites W1605201659 @default.
• W2008028586 cites W1653081612 @default.
• W2008028586 cites W1901656938 @default.
• W2008028586 cites W1963515928 @default.
• W2008028586 cites W1964824966 @default.
• W2008028586 cites W1983901754 @default.
• W2008028586 cites W1985725501 @default.
• W2008028586 cites W1990836062 @default.
• W2008028586 cites W1991536506 @default.
• W2008028586 cites W1996153116 @default.
• W2008028586 cites W1998165486 @default.
• W2008028586 cites W2005783000 @default.
• W2008028586 cites W2012730317 @default.
• W2008028586 cites W2036931150 @default.
• W2008028586 cites W2038877370 @default.
• W2008028586 cites W2047119353 @default.
• W2008028586 cites W2047167565 @default.
• W2008028586 cites W2051974567 @default.
• W2008028586 cites W2052446942 @default.
• W2008028586 cites W2064308892 @default.
• W2008028586 cites W2072289725 @default.
• W2008028586 cites W2075330404 @default.
• W2008028586 cites W2079145222 @default.
• W2008028586 cites W2084086913 @default.
• W2008028586 cites W2091950735 @default.
• W2008028586 cites W2092572333 @default.
• W2008028586 cites W2097198628 @default.
• W2008028586 cites W2101231282 @default.
• W2008028586 cites W2105622733 @default.
• W2008028586 cites W2145551500 @default.
• W2008028586 cites W2151620241 @default.
• W2008028586 cites W2369873787 @default.
• W2008028586 cites W2888511473 @default.
• W2008028586 cites W4248412843 @default.
• W2008028586 cites W45293212 @default.
• W2008028586 cites W7200491 @default.
• W2008028586 doi "https://doi.org/10.1074/jbc.m001278200" @default.
• W2008028586 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10748010" @default.
• W2008028586 hasPublicationYear "2000" @default.
• W2008028586 type Work @default.
• W2008028586 sameAs 2008028586 @default.
• W2008028586 citedByCount "32" @default.
• W2008028586 countsByYear W20080285862012 @default.
• W2008028586 countsByYear W20080285862013 @default.
• W2008028586 countsByYear W20080285862014 @default.
• W2008028586 countsByYear W20080285862020 @default.
• W2008028586 countsByYear W20080285862021 @default.
• W2008028586 crossrefType "journal-article" @default.
• W2008028586 hasAuthorship W2008028586A5005029604 @default.
• W2008028586 hasAuthorship W2008028586A5016136510 @default.
• W2008028586 hasAuthorship W2008028586A5017566012 @default.
• W2008028586 hasAuthorship W2008028586A5056699006 @default.
• W2008028586 hasBestOaLocation W20080285861 @default.
• W2008028586 hasConcept C104292427 @default.
• W2008028586 hasConcept C104317684 @default.
• W2008028586 hasConcept C154945302 @default.
• W2008028586 hasConcept C161790260 @default.
• W2008028586 hasConcept C185592680 @default.
• W2008028586 hasConcept C2777212361 @default.
• W2008028586 hasConcept C41008148 @default.
• W2008028586 hasConcept C42407357 @default.
• W2008028586 hasConcept C4710235 @default.
• W2008028586 hasConcept C512185932 @default.
• W2008028586 hasConcept C5140985 @default.
• W2008028586 hasConcept C55493867 @default.
• W2008028586 hasConcept C71240020 @default.
• W2008028586 hasConcept C86803240 @default.
• W2008028586 hasConcept C98892162 @default.
• W2008028586 hasConceptScore W2008028586C104292427 @default.
• W2008028586 hasConceptScore W2008028586C104317684 @default.
• W2008028586 hasConceptScore W2008028586C154945302 @default.
• W2008028586 hasConceptScore W2008028586C161790260 @default.
• W2008028586 hasConceptScore W2008028586C185592680 @default.
• W2008028586 hasConceptScore W2008028586C2777212361 @default.
• W2008028586 hasConceptScore W2008028586C41008148 @default.
• W2008028586 hasConceptScore W2008028586C42407357 @default.
• W2008028586 hasConceptScore W2008028586C4710235 @default.
• W2008028586 hasConceptScore W2008028586C512185932 @default.
• W2008028586 hasConceptScore W2008028586C5140985 @default.
• W2008028586 hasConceptScore W2008028586C55493867 @default.
• W2008028586 hasConceptScore W2008028586C71240020 @default.
• W2008028586 hasConceptScore W2008028586C86803240 @default.
• W2008028586 hasConceptScore W2008028586C98892162 @default.

• next