FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2008073344> ?p ?o ?g. }

• W2008073344 endingPage "2476" @default.
• W2008073344 startingPage "2468" @default.
• W2008073344 abstract "Osteocalcin (OC) is a small (6 kDa) polypeptide whose expression was thought to be limited to mature osteoblasts. The discovery of OC expression in prostate cancer specimens led us to study the regulation of OC gene in androgen-independent metastatic human prostate PC3 cells. An 800-bp human OC (hOC) promoter-luciferase construct exhibited strong basal and vitamin D-induced activity in OC-positive human prostate and osteosarcoma cell lines. Through deletion analysis of the hOC promoter, the functional hierarchy of the cis-acting elements, OSE1, OSE2, and AP-1/VDRE, was established in PC3 cells (OSE1 > AP-1/VDRE > OSE2). By juxtaposing dimers of these 3 cis-elements, we produced a minimal hOC promoter capable of displaying high tissue specific activity in prostate cancer cells. Our study demonstrated three groups of transcription factors, Runx2, JunD/Fra-2, and Sp1, responsible for the high hOC promoter activity in PC3 cells by binding to the OSE2, AP-1/VDRE, and OSE1 elements, respectively. Among the three groups of transcription factors, the expression levels of Runx2 and Fra-2 are higher in the OC-positive PC3 cells and osteoblasts, compared with the OC-negative LNCaP cells. Interestingly, unlike the mouse OC promoter, the OSE1 site in hOC promoter is regulated by members of Sp1 family instead of the osteoblast-specific factor Osf1. The molecular basis for androgen-independent prostate cancer cells behaving like mature osteoblasts may be explained by the interplay and coordination of these transcription factors under the tight regulation of autocrine and paracrine mediators. Osteocalcin (OC) is a small (6 kDa) polypeptide whose expression was thought to be limited to mature osteoblasts. The discovery of OC expression in prostate cancer specimens led us to study the regulation of OC gene in androgen-independent metastatic human prostate PC3 cells. An 800-bp human OC (hOC) promoter-luciferase construct exhibited strong basal and vitamin D-induced activity in OC-positive human prostate and osteosarcoma cell lines. Through deletion analysis of the hOC promoter, the functional hierarchy of the cis-acting elements, OSE1, OSE2, and AP-1/VDRE, was established in PC3 cells (OSE1 > AP-1/VDRE > OSE2). By juxtaposing dimers of these 3 cis-elements, we produced a minimal hOC promoter capable of displaying high tissue specific activity in prostate cancer cells. Our study demonstrated three groups of transcription factors, Runx2, JunD/Fra-2, and Sp1, responsible for the high hOC promoter activity in PC3 cells by binding to the OSE2, AP-1/VDRE, and OSE1 elements, respectively. Among the three groups of transcription factors, the expression levels of Runx2 and Fra-2 are higher in the OC-positive PC3 cells and osteoblasts, compared with the OC-negative LNCaP cells. Interestingly, unlike the mouse OC promoter, the OSE1 site in hOC promoter is regulated by members of Sp1 family instead of the osteoblast-specific factor Osf1. The molecular basis for androgen-independent prostate cancer cells behaving like mature osteoblasts may be explained by the interplay and coordination of these transcription factors under the tight regulation of autocrine and paracrine mediators. osteocalcin human osteocalcin mouse osteocalcin rat osteocalcin vitamin D response element vitamin D response androgen-independent electrophoretic mobility shift assay relative luciferase activity reverse transcriptase Osteocalcin (OC)1 is the major noncollagenous bone matrix protein expressed in bone (1Price P.A. Otsuka A.A. Poser J.W. Kristaponis J. Raman N. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 1447-1451Crossref PubMed Scopus (688) Google Scholar).OC expression is transcriptionally regulated by vitamin D and limited exclusively to cells of the osteoblast lineage (2Nakase T. Takaoka K. Hirakawa K. Hirota S. Takemura T. Onoue H. Takebayashi K. Kitamura Y. Nomura S. Bone Miner. 1994; 26: 109-122Abstract Full Text PDF PubMed Scopus (103) Google Scholar). OC is synthesized, secreted, and deposited by mature osteoblasts at the time of bone mineralization. It serves as a phenotypic marker for mature osteoblasts (3Gundberg C.M. Lian J.B. Gallop P.M. Steinberg J.J. J. Clin. Endocrinol. Metab. 1983; 57: 1221-1225Crossref PubMed Scopus (132) Google Scholar). Despite its well characterized specificity of expression in transgenic mouse (4Kesterson R.A. Stanley L. DeMayo F. Finegold M. Pike J.W. Mol. Endocrinol. 1993; 7: 462-467Crossref PubMed Scopus (50) Google Scholar), the precise function of OC in bone remodeling remains unclear. The location of OC at the bone-forming surfaces (5Roach H.I. Cell Biol. Int. 1994; 18: 617-628Crossref PubMed Scopus (271) Google Scholar) and the increased bone mineralization observed inOC gene knockout mice (6Ducy P. Desbois C. Boyce B. Pinero G. Story B. Dunstan C. Smith E. Bonadio J. Goldstein S. Gundberg C. Bradley A. Karsenty G. Nature. 1996; 382: 448-452Crossref PubMed Scopus (1405) Google Scholar) supports a role of OC in suppression of bone mineralization. Due to its tissue specificity, regulation of OC expression has been studied extensively in bone cells. Many regulatory elements have been identified in the proximal 800-bp region of the promoters. These include OSE1, OSE2 (7Ducy P. Karsenty G. Mol. Cell. Biol. 1995; 15: 1858-1869Crossref PubMed Scopus (529) Google Scholar), AP-1/VDRE (8Goldberg D. Polly P. Eisman J.A. Morrison N.A. J. Cell. Biochem. 1996; 60: 447-457Crossref PubMed Scopus (20) Google Scholar), and GRE (9Meyer T. Carlstedt-Duke J. Starr D.B. J. Biol. Chem. 1997; 272: 30709-30714Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). OSE1 and OSE2 were identified in mouse OC (mOC) promoter and are responsible for its tissue specific activity in osteoblasts. Both of these cis-elements are occupied by osteoblast-specific transcription factors, Osf1 and Runx2, respectively (7Ducy P. Karsenty G. Mol. Cell. Biol. 1995; 15: 1858-1869Crossref PubMed Scopus (529) Google Scholar, 10Schinke T. Karsenty G. J. Biol. Chem. 1999; 274: 30182-30189Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Runx2 belongs to the RUNT domain transcription factor family (11Ogawa E. Maruyama M. Kagoshima H. Inuzuka M. Lu J. Satake M. Shigesada K. Ito Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6859-6863Crossref PubMed Scopus (563) Google Scholar) and it has an indispensable role in osteoblast differentiation, maturation, and bone formation (12Komori T. Yagi H. Nomura S. Yamaguchi A. Sasaki K. Deguchi K. Shimizu Y. Bronson R.T. Gao Y.H. Inada M. Sato M. Okamoto R. Kitamura Y. Yoshiki S. Kishimoto T. Cell. 1997; 89: 755-764Abstract Full Text Full Text PDF PubMed Scopus (3678) Google Scholar). Runx2 was shown to bind the OSE2 site and regulates the mOC promoter in a tissue-specific manner (13Ducy P. Zhang R. Geoffroy V. Ridall A.L. Karsenty G. Cell. 1997; 89: 747-754Abstract Full Text Full Text PDF PubMed Scopus (3668) Google Scholar). In contrast to mOC promoter (14Zhang R. Ducy P. Karsenty G. J. Biol. Chem. 1997; 272: 110-116Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar), hOC promoter is highly inducible by vitamin D3 (15Sims N.A. White C.P. Sunn K.L. Thomas G.P. Drummond M.L. Morrison N.A. Eisman J.A. Gardiner E.M. Mol. Endocrinol. 1997; 11: 1695-1708Crossref PubMed Scopus (53) Google Scholar). As a result, studies have mostly stressed its regulation by vitamin D3 in bone cells (16Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (341) Google Scholar). Little is known about the basal regulation of the gene. Vitamin D response element (VDRE) has been mapped to the proximal promoter and it is contiguous to an AP-1 site (8Goldberg D. Polly P. Eisman J.A. Morrison N.A. J. Cell. Biochem. 1996; 60: 447-457Crossref PubMed Scopus (20) Google Scholar). Studies suggest that various AP-1 factors occupy this site at different stages during osteoblast development and they tightly regulate the interactions between vitamin D receptor (VDR) and its cognate binding sites. In proliferating osteoblasts, the binding of c-Fos and c-Jun heterodimers to the AP-1 site suppresses the rat OC (rOC) promoter activity, while the association of Fra-2 and JunD in the post-proliferate osteoblasts facilitates VDR/retinoid X receptor binding to the rOC promoter and induces its activity (17Lian J.B. Stein G.S. Stein J.L. van Wijnen A.J. J. Cell. Biochem. Suppl. 1998; 31: 62-72Crossref Google Scholar). Prostate cancer is the second leading cause of cancer death in Northern American men. Despite its common occurrence, the molecular mechanisms responsible for prostate cancer growth, androgen-independent (AI) progression and acquisition of bone metastatic potential are poorly characterized. Bone matrix proteins such as OC, bone sialoproteins, and osteopontin are expressed at high levels in primary and metastatic prostate cancer specimens (18Jung C. Ou Y.C. Yeung F. Frierson Jr., H.F. Kao C. Gene (Amst.). 2001; 271: 143-150Crossref PubMed Scopus (38) Google Scholar). We hypothesized previously that prostate cancer acquires “bone-like properties” to thrive and grow in the bone microenvironment (19Koeneman K.S. Yeung F. Chung L.W. Prostate. 1999; 39: 246-261Crossref PubMed Scopus (378) Google Scholar). The goal of this study therefore is to better understand the osteomimetic properties of prostate cancer cells by studying the regulation of hOC gene expression in an AI prostate cancer cell line, PC3. PC3 cells were established from the bone metastatic lesions of a prostate cancer patient. It is considered a highly aggressive AI cell line which expresses neither AR nor PSA, and it does not require androgen for growth or survival. When injected intracardially in athymic mouse, PC3 cells have high propensity to metastasize to bone. In this study, we established the functional hierarchy of three regulatory elements, OSE1, OSE2, and AP-1/VDRE, in the regulation of the hOC promoter activity in PC3 cells (OSE1 > AP-1/VDRE > OSE2). Furthermore, through EMSA we identified Runx2, JunD/Fra-2, and Sp1 as the transcription factors which regulate OSE2, AP-1/VDRE, and OSE1, respectively. By expressing osteoblast-specific factor-like Runx2 and selectively activating Ap1 factor Fra-2, PC3 is able to behave like a mature osteoblast in activating OC expression. Based on our results, a model was constructed to explain how prostate cancer cells might become osteomimetic. This biochemical switch may contribute to the osteolytic/osteoblastic phenotype of prostate cancer cells frequently observed in metastatic skeletal lesions. Prostate cancer cells (PC3, DU145, and LNCaP) and MG63 (human osteosarcoma cell) were cultured in T-medium (20Gleave M. Hsieh J.T. Gao C.A. von Eschenbach A.C. Chung L.W. Cancer Res. 1991; 51: 3753-3761PubMed Google Scholar) supplemented with 5% fetal bovine serum. Rat osteosarcoma cells (rat osteosarcoma cells) were cultured in Dulbecco's mdofied Eagle's medium (Invitrogen) with 10% fetal bovine serum. For transfections, cells were plated at a density of 1.0 × 105 (PC3, DU145, and rat osteosarcoma cells) cells/well in 12-well plates 24 h or 3 × 105 cells/well (LNCaP) in 6-well plates 48 h before transfection. Plasmid DNAs were introduced into cells either by complexing with DOTAP (Roche Molecular Biochemicals) or Clonfectin (CLONTECH, Palo Alto, CA). Briefly 1–3.5 μg of tested DNA constructs were used in the experiments. DNA-lipid complexes were allowed to form for 5–15 min at room temperature prior to their addition to each well containing 0.5 or 1 ml of serum-free and phenol red-free RPMI 1640 medium or serum-free Dulbecco's modified Eagle's medium. The cells were incubated with the complexes for 4–5 h at 5% CO2, 37 °C. DNA-lipid containing medium was then replaced with fresh medium with fetal bovine serum. Cells were collected after 36–48 h of additional incubation. Cells were washed with 0.5 ml/well of phosphate-buffered saline and lysed in 100–300 μl of 1 × lysis buffer (Promega, Madison, WI). Cell lysates were vortexed for a few seconds and spun for 2 min. For luciferase activity detection, 20 μl of the supernatant was mixed with 100 μl of luciferase substrate (Promega) and measured by a luminometer (Monolight 2010, Analytical Luminescence Laboratory, Sparks, MD). For β-galactosidase activity detection, 50 or 100 μl of the supernatant was mixed with an equal volume of 2 × β-galactosidase substrate (Promega) and incubated at 37 °C for 15–30 min. The β-galactosidase activity was determined by plate reader at 405 nm wavelength. For protein assays, 10 μl of cell extracts were mixed with 200 μl of Coomassie plus protein reagent (Pierce, Rockford, IL) and measured at 590 nm. Data are expressed as relative luciferase activity (RLA), which is obtained by normalizing the luciferase activity with either CMV-β-galactosidase activity or the protein concentrations of the cell lysates. All transfection experiments were carried out either in duplicate or triplicate, and RLA was expressed as the mean ± S.D. of two to three independent experiments. Genomic DNA was used in the PCR of the 800-bp human osteocalcin promoter (16Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (341) Google Scholar), subsequently cloned into luciferase reporter vector-pGL3/Basic (Promega). The deletion constructs were generated by recombinant PCR method (21Carey M. Smale S.T. Transcriptional Regulation in Eukaryotes: Concepts, Strategies, and Techniques.1st Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY2000Google Scholar). Complementary oligomers (the detailed oligos sequences are listed below in the EMSA section) containing two copies of individual element withKpnI and NheI sites were annealed and ligated toKpnI- and NheI-digested pGL3/TATA vector to generate OSE12/, mOSE12/, OSE22/, and AV2/TATA. Ligating respective constructs digested with either BamHI and AvrII or BamHI andNheI generated different combinations of the OSE12/, OSE22/, and AV2/TATA. Immunoblotting was performed using the NOVEX (Invitrogen, Carlsbad, CA) system. Briefly, 20 μg of nuclear extracts were separated on 4–12% Tris glycine PAGE gels and transferred onto a 0.2-μm nitrocellulose membrane. Nonspecific binding was blocked with 5% nonfat milk in TBS-T for 1 h at 37 °C. Primary antibody was used at a 1:500-Runx2 (22Meyers S. Lenny N. Sun W. Hiebert S.W. Oncogene. 1996; 13: 303-312PubMed Google Scholar) or 1:200-Fra-2 or JunD (Santa Cruz Biotechnology, Santa Cruz, CA) dilution. Secondary antibody (horseradish peroxidase-anti-rabbit antibody) (Amersham Bioscience, Inc., Piscataway, NJ) was used in a 1:4000 dilution. The incubation of both primary and secondary antibodies was done at 37 °C for 1 h with 30 min washing (TBS-T) in between. ECL plus (Amersham Bioscience, Inc.) reagent was used for detection. PAGE purified oligos (Sigma-Genosys, Woodlands, TX) were annealed by heating up to 95 °C and slowly cooled down to room temperature. The oligo sequences used as probes or competitors were as follows: ARE-III, 5′-tcgacgaggaacatattgtatcgagtcga-3′ (23Cleutjens K.B. van der Korput H.A. van Eekelen C.C. van Rooij H.C. Faber P.W. Trapman J. Mol. Endocrinol. 1997; 11: 148-161Crossref PubMed Scopus (294) Google Scholar); SP-1, 5′-attcgatcggggcggggcgagc-3′; mSP-1, 5′-attcgatcggttcggggcgagc-3′; AP-1, 5′-cgcttgatgactcagccggaa-3′; VDRE, 5′-aggtcaaggaggtca-3′ (Santa Cruz Biotechnology); OSE1, 5′-caggcatgcccctcctcatcgctgggcac-3′; mOSE1, 5′-caggcatgcctttcctcatcgctgggcac-3′; OSE2, 5′-gctcccaaccacatatcc-3′; AP-1/VDRE, 5′-tggtgactcaccgggtgaa-3′. The double-stranded probes were end-labeled with [γ-32P]ATP by using T4 polynucleotide kinase (New England Biolabs, Beverly, MA). Nuclear extracts were prepared as describe in Current Protocols (24Ausubel F.M. Brent R. kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar). 40,000 cpm of labeled probe and 5–10 μg of nuclear extracts were incubated with binding buffer containing 10 mm Tris-HCl (pH 7.5), 50 mm NaCl, 0.5 mm EDTA, 0.5 mmdithiothreitol, 4% glycerol, 1 μg of poly(dI-dC) (Amersham Bioscience, Inc.), and 1 mm KCl at room temperature for 30 min. The samples were subjected to electrophoresis at room temperature on a 4% nondenaturing polyacrylamide gel in 0.5 × TBE at 35 mA for 2 h. For experiments using Runx2 antibody, 2 μg of antibody was added to the reaction mixture for 30 min after the incubation period of the probe and nuclear extracts. For experiments using Sp1, Sp2, Sp3, VDR, Fra-2, JunD, and AR antibodies (Santa Cruz Biotechnology), nuclear extracts and 2 μg of antibody were preincubated at room temperature for 30 min before the addition of probe. In competition experiments, competitor oligos were incubated with nuclear extracts for 30 min at room temperature before the addition of the probe. RNA was extracted using RNAzolB (Teltest, Friendswood, TX). Reverse transcription was performed using Superscript II reverse transcriptase (Invitrogen), according to the manufacturer's protocol. Each RT reaction contained 5 μg of total RNA, 0.5 μg of oligo(dT) (Amersham Bioscience, Inc.), and 0.5 μg of random hexamer (Amersham Bioscience, Inc.) in a total volume of 20 μl which were then incubated at 42 °C for 1.5 h. Subsequently, 3 μl of the fresh RT reaction was used for PCR. The primers (25Celeste A.J. Rosen V. Buecker J.L. Kriz R. Wang E.A. Wozney J.M. EMBO J. 1986; 5: 1885-1890Crossref PubMed Scopus (354) Google Scholar) used forhOC PCR were: cactcctcgccctattggcc (OCF) and gccaactcgtcacagtccgg (OCR). The primers used for human runx2PCR were: accatggtggagatcatcgc and catcaagcttctgtctgtgc. The cycle for PCR was 94 °C 30 s, 60 °C 30 s, and 72 °C 30 s for 35 cycles. The 1,25-(OH)2D3 (vitamin D3) used in the experiments was a generous gift from Hoffmann-LaRoche, Inc. (Nutley, NJ). We demonstrated previously that OC protein was not detectable in normal human prostate tissue, yet it was prevalently expressed in primary prostate cancer (85%) and in prostate cancer lymph node (100%) and bone metastasis specimens (100%) (26Chung L. Zhau H. Chung L. Isaacs W. Simons J. Prostate Cancer: Biology, Genetics and New Therapeutics. Human Press, Totowa, NJ2001: 341-364Google Scholar). To understand the molecular mechanism of hOC expression in prostate cancer cells, we examined the expression pattern of hOC mRNA in different cancer cell lines. RNA from four cell lines in two different conditions were extracted and used as templates for RT-PCR. Ethanol (the control groups) or 5 nm 1,25-(OH)2D3 (vitamin D3) was added to the medium when the cells reached 60% confluence. Cells were collected after an additional 48 h incubation. A human osteosarcoma cell line (MG63) known to express endogenous OC (27Mahonen A. Pirskanen A. Keinanen R. Maenpaa P.H. Biochim. Biophys. Acta. 1990; 1048: 30-37Crossref PubMed Scopus (86) Google Scholar) was used as a positive control. HOC mRNA was detected in both PC3 bone metastatic AI prostate cancer cells and the positive control MG63. Upon addition of vitamin D3, all the AI prostate cancer cell lines (DU145 and PC3) and MG63 showed an elevated level of hOC mRNA. However, the androgen-dependent/sensitive nontumorigenic prostate cancer cell LNCaP did not have any hOC expression in either the presence or absence of vitamin D3. To investigate whether the expression of hOC mRNA is controlled at the transcriptional level, the 800-bp hOC promoter was cloned and inserted upstream to a luciferase reporter gene (hOC/luc) for transient expression analysis (Fig.1B). In agreement with the RT-PCR data, PC3 exhibited the highest basal hOC/luc activity (34,850 ± 7,434 RLA) among the three prostate cancer cell lines, whereas the activity (2,311 ± 312 RLA) observed in LNCaP cells was similar to the empty vector. Rat osteosarcoma cells (16Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (341) Google Scholar) served as positive control in the transient transfection experiments because high transfection efficiency can be obtained with rat osteosarcoma cells, but not with MG63. In accordance with previous studies, the hOC promoter was inducible by the addition of vitamin D3 (Fig.1B) in all the cell lines tested. Thus the promoter is tissue-specific and regulated by vitamin D3. In this study, PC3 (which has the highest basal hOC promoter activity) was the target cell line for investigating basal hOC promoter regulation in prostate cancer cells and LNCaP was used as the negative control cell line. OSE1 and OSE2 of mOC promoter were reported to be responsible for its restrictive activity in bone cells (7Ducy P. Karsenty G. Mol. Cell. Biol. 1995; 15: 1858-1869Crossref PubMed Scopus (529) Google Scholar), while AP-1/VDRE (AV) is required for the vitamin D3inductive response in hOC promoter (8Goldberg D. Polly P. Eisman J.A. Morrison N.A. J. Cell. Biochem. 1996; 60: 447-457Crossref PubMed Scopus (20) Google Scholar). However, the roles of OSE1, OSE2, and AP-1/VDRE have never been examined in the regulation of basal hOC promoter activity in prostate cancer cells. To define the functional hierarchy of these cis-elements in the control of hOC promoter activity in PC3 cells, we used the recombinant PCR method to generate single, double, or triple deletions of these elements (Fig.2A). Among the single deletion mutants, ΔOSE1 suffered the greatest activity drop, followed by ΔAV which contains deletion of half of the VDRE and the contiguous AP-1 site. Deletion of OSE2 did not seem to affect promoter activity to a great extent. Moreover, when OSE2 was removed together with either OSE1 or AV in double deletion, no additional decrease of activity was observed compared with the single deletion mutants (ΔAV or ΔOSE1). Thus, the OSE2 element may not be required for the maintenance of basal hOC promoter activity. On the other hand, OSE1 and AV single or double deletions have caused dramatic loss of activity in the hOC promoter indicating that these two cis-elements are crucial in conferring basal activity to the promoter in prostate cancer cells. It is conceivable that the OSE1 element exerts its effect by being in close proximity to the TATA box, which would allow the OSE1-binding factor(s) to act as a mediator between the binding factors of the other two cis-elements and the TATA binding complex. The effect of deletions on vitamin D induction is depicted in Fig.2B. Constructs that contain AV deletion become unresponsive to vitamin D stimulation, this data agrees with the current understanding that the binding of VDR and AP-1 factors is critical for vitamin D induction. Even though OSE1 and/or OSE2 deletions did not affect fold induction of vitamin D, the overall induced activities of the constructs are significantly less than those of the wild type promoter due to lower basal activities (Fig. 2A). Therefore, OSE1 and OSE2 may function independently of AV and they are required to confer maximum vitamin D-induced activity to hOC promoter. To determine whether these cis-elements can function independently in gene transcription, we generated constructs with two copies of each of the cis-elements inserted upstream to an artificial TATA box. As shown in Fig. 2C, both AV and OSE1 could function independently in PC3 cells, with OSE12/TATA having the highest fold increase above the empty vector activity (28.1-fold) and OSE22/TATA the least activity (2-fold). These results are in agreement with the deletion data, indicating that OSE1 and AV are strong regulatory elements in the hOC promoter in PC3 cells. Interactions among the three elements were investigated by juxtaposing dimers of the elements in different combinations in the pGL3/TATA vector. The results suggested that OSE1 could interact with AV and activate the simple TATA promoter in a synergistic manner (181.3-fold). Addition of OSE22could not further increase the activity of either OSE12/TATA or AV2/TATA. However, when OSE2 was inserted between AV2 and OSE12 in the AV2-OSE22-OSE12/TATA construct, increased activity (299-fold) was observed. These results imply that the OSE2-binding factor is not sufficient to induce transcriptional activation, but it can cooperate with OSE1 and AV-binding factors and collectively activate hOC promoter. Next, we generated a chimeric promoter, AV2-OSE22-OSE12/TATA, which not only retained the tissue-specific characteristic of hOC promoter and was also 8.1-fold more active than wild type hOC promoter in the OC-positive PC3 cells, but not in the OC-negative LNCaP cells (Fig.2D). Tissue-specific transcription factor(s), which are only present in OC positive cells, may be involved in regulating the chimeric AV2-OSE22-OSE12/TATA promoter. Furthermore, the addition of vitamin D did not affect the activity of any of the constructs shown in Fig. 2C (data not shown). The half VDRE in the AV element appears insufficient to confer vitamin D response to the constructs that contain AV2(AV2/TATA, AV2-OSE12/TATA, AV2-OSE22/TATA, and AV2-OSE22-OSE12/TATA). Vitamin D may not be involved in the regulation of the cis-elements. Vitamin D is implicated as a protective factor against prostate cancer development and progression. Studies have indicated that there may be a local deficiency of the growth inhibitory vitamin D in prostate cancer patients (28Hsu J.Y. Feldman D. McNeal J.E. Peehl D.M. Cancer Res. 2001; 61: 2852-2856PubMed Google Scholar, 29Corder E.H. Guess H.A. Hulka B.S. Friedman G.D. Sadler M. Vollmer R.T. Lobaugh B. Drezner M.K. Bogelman J.H. Orentreich N. Cancer Epidemiol. Biomarkers Prev. 1993; 2: 467-472PubMed Google Scholar), resulting in increased proliferation, de-differentiation, and invasion of the cancer cells. Since the physiological level of vitamin D is uncertain in prostate cancer patients, the following sections focus on identifying transcription factors that regulate basal hOC promoter. Even though OSE2 in mOC promoter was shown to associate with the osteoblast-specific factor, Runx2 (13Ducy P. Zhang R. Geoffroy V. Ridall A.L. Karsenty G. Cell. 1997; 89: 747-754Abstract Full Text Full Text PDF PubMed Scopus (3668) Google Scholar), it is not clear whether the same transcription factor binds to the OSE2 on hOC promoter in PC3 cells. To address this question, we first determined the expression of Runx2 in PC3 cells by both RT-PCR and immunoblot analysis.Runx2 mRNA was expressed in all the OC-positive cell lines tested both in the presence and absence of vitamin D3, with PC3 having the highest level of expression (Fig.3A). Vitamin D3does not seem to regulate the mRNA level of runx2. On the protein level, Runx2 is highly expressed only in the OC-positive PC3 cells, but was not detected in the OC-negative LNCaP cells (Fig.3B). Although the OSE2 site was not necessary for transcriptional activation of hOC promoter, its binding factor Runx2 was expressed at a high level in PC3 cells. To determine whether Runx2 in PC3 cells was capable of binding DNA, we compared EMSA profiles between PC3 and LNCaP nuclear extracts (Fig. 3C). PC3 nuclear extracts gave a specific DNA-protein complex (lane 7) that could only be competed away by a specific competitor, OSE2 (lane 8), but not by a nonspecific competitor, ARE-III (lane 9). With LNCaP nuclear extracts, no specific DNA-protein complex was observed (lanes 2–4). By adding Runx2 antibody or control AR antibody to the EMSA reactions, we observed that, as expected, the protein factor that associates with OSE2 in PC3 cells is indeed Runx2. In lanes 10 and 11, Runx2, but not AR antibody, could supershift the DNA-protein complex, suggesting that transcriptionally active Runx2 may play a significant role in the regulation of hOC promoter activity in PC3 cells as these cells acquire AI and skeletal metastatic potentials. Different AP-1-binding proteins are known to operate at the AP-1/VDRE (AV) site in the rOC promoter during different stages of osteoblast development. In proliferating osteoblasts, c-Fos and c-Jun are involved in phenotypic suppression of the OC promoter while in the post-proliferate stage, JunD and Fra-2 are responsible for enhancing the expression of OC (30McCabe L.R. Banerjee C. Kundu R. Harrison R.J. Dobner P.R. Stein J.L. Lian J.B. Stein G.S. Endocrinology. 1996; 137: 4398-4408Crossref PubMed Scopus (161) Google Scholar). Fig.4A shows that the hOC AV was occupied by AP-1 protein factors and not by VDR, because the VDRE consensus site could not compete away the protein-DNA complex observed (lanes 5, 10, and 15) while AP-1 competitor could successfully compete away the complex (lanes 4, 9, and14). Furthermore, we noticed that LNCaP nuclear extract yielded a lower level of the specific protein-DNA complex than the OC-positive PC3 and MG63. This result is further confirmed at the transcriptional level, where AV2/TATA showed lower activity in LNCaP than in PC3 cells (Fig. 4B). We then defined the AP-1 protein factors that regulate AP-1/VDRE in hOC promoter by using various AP-1 antibodies in EMSA (Fig.4C). Neither c-Fos nor c-Jun antibodies could supershift the DNA-protein complex observed (data not shown); however, with JunD antibody, the DNA-protein complex was clearly supershifted, while Fra-2 antibody acted more like a blocking antibody which prevented the protein-DNA complex formation and diminished the intensity of the original band. Furthermore, neither the control AR antibody nor VDR antibody could affect the complex. This confirms our previous observation that VDR does not associate with the AV site at the hOC promoter in the absence of vitamin D3 stimulation. We also demonstrated that there was less Fra-2 protein, but not less JunD (Fig.4D) in the nuclear extracts of LNCaP compared with MG63 or PC3 cells. Therefore," @default.
• W2008073344 created "2016-06-24" @default.
• W2008073344 creator A5002705958 @default.
• W2008073344 creator A5010686592 @default.
• W2008073344 creator A5020873093 @default.
• W2008073344 creator A5021934968 @default.
• W2008073344 creator A5029187007 @default.
• W2008073344 creator A5055608417 @default.
• W2008073344 creator A5071666865 @default.
• W2008073344 creator A5082117229 @default.
• W2008073344 date "2002-01-01" @default.
• W2008073344 modified "2023-10-16" @default.
• W2008073344 title "Regulation of Human Osteocalcin Promoter in Hormone-independent Human Prostate Cancer Cells" @default.
• W2008073344 cites W1509651969 @default.
• W2008073344 cites W1604433346 @default.
• W2008073344 cites W1977680000 @default.
• W2008073344 cites W1977859229 @default.
• W2008073344 cites W1985727076 @default.
• W2008073344 cites W1986170691 @default.
• W2008073344 cites W1987836745 @default.
• W2008073344 cites W1994596418 @default.
• W2008073344 cites W1995792613 @default.
• W2008073344 cites W1996467022 @default.
• W2008073344 cites W1997812904 @default.
• W2008073344 cites W2007021687 @default.
• W2008073344 cites W2013176040 @default.
• W2008073344 cites W2021771963 @default.
• W2008073344 cites W2031579239 @default.
• W2008073344 cites W2032804463 @default.
• W2008073344 cites W2046409934 @default.
• W2008073344 cites W2056560239 @default.
• W2008073344 cites W2059085904 @default.
• W2008073344 cites W2075721622 @default.
• W2008073344 cites W2077708138 @default.
• W2008073344 cites W2079971241 @default.
• W2008073344 cites W2082703532 @default.
• W2008073344 cites W2086831062 @default.
• W2008073344 cites W2087504707 @default.
• W2008073344 cites W2114528551 @default.
• W2008073344 cites W2120902417 @default.
• W2008073344 cites W2124843577 @default.
• W2008073344 cites W2128118061 @default.
• W2008073344 cites W2131424836 @default.
• W2008073344 cites W2142256883 @default.
• W2008073344 cites W2145262726 @default.
• W2008073344 cites W2145772312 @default.
• W2008073344 cites W2403847737 @default.
• W2008073344 cites W4323915761 @default.
• W2008073344 doi "https://doi.org/10.1074/jbc.m105947200" @default.
• W2008073344 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11684680" @default.
• W2008073344 hasPublicationYear "2002" @default.
• W2008073344 type Work @default.
• W2008073344 sameAs 2008073344 @default.
• W2008073344 citedByCount "102" @default.
• W2008073344 countsByYear W20080733442012 @default.
• W2008073344 countsByYear W20080733442013 @default.
• W2008073344 countsByYear W20080733442014 @default.
• W2008073344 countsByYear W20080733442015 @default.
• W2008073344 countsByYear W20080733442016 @default.
• W2008073344 countsByYear W20080733442017 @default.
• W2008073344 countsByYear W20080733442018 @default.
• W2008073344 countsByYear W20080733442020 @default.
• W2008073344 countsByYear W20080733442021 @default.
• W2008073344 crossrefType "journal-article" @default.
• W2008073344 hasAuthorship W2008073344A5002705958 @default.
• W2008073344 hasAuthorship W2008073344A5010686592 @default.
• W2008073344 hasAuthorship W2008073344A5020873093 @default.
• W2008073344 hasAuthorship W2008073344A5021934968 @default.
• W2008073344 hasAuthorship W2008073344A5029187007 @default.
• W2008073344 hasAuthorship W2008073344A5055608417 @default.
• W2008073344 hasAuthorship W2008073344A5071666865 @default.
• W2008073344 hasAuthorship W2008073344A5082117229 @default.
• W2008073344 hasBestOaLocation W20080733441 @default.
• W2008073344 hasConcept C121608353 @default.
• W2008073344 hasConcept C126322002 @default.
• W2008073344 hasConcept C131075544 @default.
• W2008073344 hasConcept C134018914 @default.
• W2008073344 hasConcept C160160445 @default.
• W2008073344 hasConcept C181199279 @default.
• W2008073344 hasConcept C185592680 @default.
• W2008073344 hasConcept C2780192828 @default.
• W2008073344 hasConcept C502942594 @default.
• W2008073344 hasConcept C55493867 @default.
• W2008073344 hasConcept C71315377 @default.
• W2008073344 hasConcept C71924100 @default.
• W2008073344 hasConcept C86803240 @default.
• W2008073344 hasConceptScore W2008073344C121608353 @default.
• W2008073344 hasConceptScore W2008073344C126322002 @default.
• W2008073344 hasConceptScore W2008073344C131075544 @default.
• W2008073344 hasConceptScore W2008073344C134018914 @default.
• W2008073344 hasConceptScore W2008073344C160160445 @default.
• W2008073344 hasConceptScore W2008073344C181199279 @default.
• W2008073344 hasConceptScore W2008073344C185592680 @default.
• W2008073344 hasConceptScore W2008073344C2780192828 @default.
• W2008073344 hasConceptScore W2008073344C502942594 @default.
• W2008073344 hasConceptScore W2008073344C55493867 @default.
• W2008073344 hasConceptScore W2008073344C71315377 @default.
• W2008073344 hasConceptScore W2008073344C71924100 @default.

• next