FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2008767446> ?p ?o ?g. }

• W2008767446 endingPage "36462" @default.
• W2008767446 startingPage "36454" @default.
• W2008767446 abstract "Osteocrin (Ostn) is a recently discovered secreted protein produced by cells of the osteoblast lineage that shows a well conserved homology with members of the natriuretic peptide (NP) family. We hypothesized that Ostn could interact with the NP receptors, thereby modulating NP actions on the skeleton. Ostn binds specifically and saturably to the NP peptide receptor-C (NPR-C) receptor with a Kd of ∼5 nm with no binding to the GC-A or GC-B receptors. Deletion of several of the residues deemed important for NP binding to NPR-C led to abolition of Ostn binding, confirming the presence of a “natriuretic motif.” Functionally, Ostn was able to augment C-type natriuretic peptide-stimulated cGMP production in both pre-chondrocytic (ATDC5) and osteoblastic (UMR106) cells, suggesting increased NP levels due to attenuation of NPR-C associated NP clearance. Ostn-transgenic mice displayed elongated bones and a marked kyphosis associated with elevated bone cGMP levels, suggesting that elevated natriuretic peptide activity contributed to the increased bone length possibly through an increase in growth plate chondrocyte proliferation. Thus, we have demonstrated that Ostn is a naturally occurring ligand of the NPR-C clearance receptor and may act to locally modulate the actions of the natriuretic system in bone by blocking the clearance action of NPR-C, thus locally elevating levels of C-type natriuretic peptide. Osteocrin (Ostn) is a recently discovered secreted protein produced by cells of the osteoblast lineage that shows a well conserved homology with members of the natriuretic peptide (NP) family. We hypothesized that Ostn could interact with the NP receptors, thereby modulating NP actions on the skeleton. Ostn binds specifically and saturably to the NP peptide receptor-C (NPR-C) receptor with a Kd of ∼5 nm with no binding to the GC-A or GC-B receptors. Deletion of several of the residues deemed important for NP binding to NPR-C led to abolition of Ostn binding, confirming the presence of a “natriuretic motif.” Functionally, Ostn was able to augment C-type natriuretic peptide-stimulated cGMP production in both pre-chondrocytic (ATDC5) and osteoblastic (UMR106) cells, suggesting increased NP levels due to attenuation of NPR-C associated NP clearance. Ostn-transgenic mice displayed elongated bones and a marked kyphosis associated with elevated bone cGMP levels, suggesting that elevated natriuretic peptide activity contributed to the increased bone length possibly through an increase in growth plate chondrocyte proliferation. Thus, we have demonstrated that Ostn is a naturally occurring ligand of the NPR-C clearance receptor and may act to locally modulate the actions of the natriuretic system in bone by blocking the clearance action of NPR-C, thus locally elevating levels of C-type natriuretic peptide. Osteocrin (Ostn) 3The abbreviations used are:OstnosteocrinOstn-TGOstn-transgenic mouserhOstnrecombinant human OstnNPnatriuretic peptideANPatrial natriuretic peptideBNPB-type natriuretic peptideCNPC-type natriuretic peptideNPRNP receptorNPR-Cnatriuretic clearance receptorPLAP-Ostnplacental alkaline phosphatase-osteocrin fusion proteinHEK cellshuman embryonic kidney cellsRTreverse transcriptase. 3The abbreviations used are:OstnosteocrinOstn-TGOstn-transgenic mouserhOstnrecombinant human OstnNPnatriuretic peptideANPatrial natriuretic peptideBNPB-type natriuretic peptideCNPC-type natriuretic peptideNPRNP receptorNPR-Cnatriuretic clearance receptorPLAP-Ostnplacental alkaline phosphatase-osteocrin fusion proteinHEK cellshuman embryonic kidney cellsRTreverse transcriptase. is a recently discovered novel small secreted protein with prohormone-like characteristics (1Thomas G. Moffatt P. Salois P. Gaumond M.H. Gingras R. Godin E. Miao D. Goltzman D. Lanctot C. J. Biol. Chem. 2003; 278: 50563-50571Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). To date, the exact role of Ostn has not been elucidated. Limited homology, however, was observed between Ostn and members of the natriuretic peptide family, suggesting a possible functional link. The natriuretic system, key in the maintenance of vascular tone and cardiovascular homeostasis, consists of three related natriuretic peptides (NPs), ANP, BNP, and CNP (2Levin E.R. Gardner D.G. Samson W.K. N. Engl. J. Med. 1998; 339: 321-328Crossref PubMed Scopus (2046) Google Scholar) and three receptors (NPRs) mediating the biological activity of these peptides. The GC-A receptor, which preferentially binds ANP and BNP, and the GC-B receptor, whose cognate ligand is CNP, are coupled to guanylyl cyclase, producing cGMP as a secondary messenger (3Matsuo H. Can. J. Physiol. Pharmacol. 2001; 79: 736-740Crossref PubMed Scopus (22) Google Scholar, 4Hirose S. Hagiwara H. Takei Y. Can. J. Physiol. Pharmacol. 2001; 79: 665-672Crossref PubMed Scopus (32) Google Scholar). The third receptor, NPR-C, has no guanylyl cyclase activity and binds all three NPs with similar affinity (5Suga S. Nakao K. Hosoda K. Mukoyama M. Ogawa Y. Shirakami G. Arai H. Saito Y. Kambayashi Y. Inouye K. Imura H. Endocrinology. 1992; 130: 229-239Crossref PubMed Google Scholar). To date, no specific endogenous ligand has been identified for NPR-C, and it is thought to act mainly as a clearance receptor (6Levin E.R. Am. J. Physiol. 1993; 264: E483-E489PubMed Google Scholar). However, other biological functions have been postulated for this receptor (6Levin E.R. Am. J. Physiol. 1993; 264: E483-E489PubMed Google Scholar). osteocrin Ostn-transgenic mouse recombinant human Ostn natriuretic peptide atrial natriuretic peptide B-type natriuretic peptide C-type natriuretic peptide NP receptor natriuretic clearance receptor placental alkaline phosphatase-osteocrin fusion protein human embryonic kidney cells reverse transcriptase osteocrin Ostn-transgenic mouse recombinant human Ostn natriuretic peptide atrial natriuretic peptide B-type natriuretic peptide C-type natriuretic peptide NP receptor natriuretic clearance receptor placental alkaline phosphatase-osteocrin fusion protein human embryonic kidney cells reverse transcriptase A number of recent reports have demonstrated that the NPs also play a key role in regulation of the skeleton (7Potter L.R. Abbey-Hosch S. Dickey D.M. Endocr. Rev. 2006; 27: 47-72Crossref PubMed Scopus (777) Google Scholar). Mice overexpressing either BNP (8Chusho H. Ogawa Y. Tamura N. Suda M. Yasoda A. Miyazawa T. Kishimoto I. Komatsu Y. Itoh H. Tanaka K. Saito Y. Garbers D.L. Nakao K. Endocrinology. 2000; 141: 3807-3813Crossref PubMed Scopus (35) Google Scholar) or CNP (9Yasoda A. Komatsu Y. Chusho H. Miyazawa T. Ozasa A. Miura M. Kurihara T. Rogi T. Tanaka S. Suda M. Tamura N. Ogawa Y. Nakao K. Nat. Med. 2004; 10: 80-86Crossref PubMed Scopus (307) Google Scholar) or lacking NPR-C (10Matsukawa N. Grzesik W.J. Takahashi N. Pandey K.N. Pang S. Yamauchi M. Smithies O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7403-7408Crossref PubMed Scopus (361) Google Scholar) display elongated bones, whereas mice lacking CNP (11Chusho H. Tamura N. Ogawa Y. Yasoda A. Suda M. Miyazawa T. Nakamura K. Nakao K. Kurihara T. Komatsu Y. Itoh H. Tanaka K. Saito Y. Katsuki M. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4016-4021Crossref PubMed Scopus (367) Google Scholar) or a functional GC-B receptor exhibit dwarfism (12Tsuji T. Kunieda T. J. Biol. Chem. 2005; 280: 14288-14292Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar). Interestingly, we initially identified Ostn in cells of the osteoblast lineage, the bone-producing cells, which together with its regulatory effects on these cells suggested a role in bone activity. Given the homology of Ostn to the NP family and its putative bone regulatory action, a role for Ostn as a molecule mediating co-operation between the natriuretic and skeletal regulatory systems presented an intriguing possibility. Investigation of the nature of Ostn interactions with the natriuretic system in vitro demonstrated specific binding to the natriuretic clearance receptor (NPR-C) and the ability to augment NP activity. Furthermore, overexpression of Ostn using the collagen type I promoter in transgenic mice resulted in enhanced bone growth associated with elevated cGMP levels. We, therefore, propose a role for Ostn as a specific NPR-C ligand capable of modulating local levels of CNP and its effects on skeletal development. Rat ANP-(1-28) and CNP-(1-22) were purchased from Sigma. The cGMP EIA (Biotrak System) was from Amersham Biosciences. The C-terminal synthetic mouse peptides, Ostn-(107-129) (amidated) (106YDHSKKRFGIPMDRIGRNRLSNSR129) and Ostn-(117-130) (116CMDRIGRNRLSNSRG130), were from Sigma and Affinity BioReagents (Golden, CO), respectively. These peptides are consensus mammalian sequences for these regions of the Ostn protein. The human peptides Ostn-(83-133) and 125I-labeled Ostn-(83-133) were purchased from Phoenix Peptides (Belmont, CA). Human embryonic kidney cells (HEK293) and rat osteosarcoma cells (UMR106) were maintained in Dulbecco's modified Eagle's medium with 10% fetal calf serum (Invitrogen). Mouse pre-chondrocytic cells, ATDC5, were maintained in 1:1 Ham's/F-12 (Invitrogen) with 10% fetal calf serum (Cansera), 1 mm glutamine (Wisent), 100 μg/ml streptomycin, 100 units/ml penicillin (Wisent), 30 nm sodium selenite (Sigma), and 10 μg/ml transferrin (Sigma). Exact experimental conditions are described below. To generate a secreted placental alkaline phosphatase-Ostn fusion protein (PLAP-Ostn), the mouse Ostn sequence covering amino acids 29-130 was amplified by PCR with forward 5′-tctctgtcgacttagcatcagg-3′ and reverse 5′-ccatcagcctctggaactggagag-3′ primers. The PCR product was digested with SalI (underlined) and cloned into an XhoI/PmeI-digested pAPtag5 vector containing the PLAP sequence (GenHunter, Nashville, TN). The resulting PLAP-Ostn plasmid and the pAPtag5 were transiently transfected into HEK293 cells (QBiogene, Carlsbad, CA) using Effectene (Qiagen, Mississauga, ON, Canada). The day after transfection, cells were washed and incubated for 48 h in serum-free Dulbecco's modified Eagle's medium. The conditioned medium was collected, cells and debris were spun out, and the supernatant was stored at 4 °C after buffering with 20 mm HEPES (pH 8). Quantification of the PLAP-Ostn fusion protein was assayed by direct enzyme-linked immunosorbent assay using the Ostn-(107-129) peptide as standard curve. Briefly, samples and standards were mixed with carbonate buffer 100 mm (pH 10) and bound onto high protein-binding capacity polystyrene (Corning Costar) 96-well plates for 1 h at 37 °C. Wells were washed, blocked with 5% skim milk in Tris-buffered saline-Tween (TBST) for 1 h at 37 °C, incubated with the anti-Ostn antibody (1:2500 in TBST with 2.5% skim milk) for 1 h at 37 °C, then washed and incubated with an anti-rabbit antibody linked to horseradish peroxidase (Sigma) (1:30,000 in TBST with 2.5% skim milk) for 45 min at 37 °C. Revelation was achieved with o-phenylenediamine dihydrochloride Sigma Fast substrate (Sigma) in the dark for 30 min and read on a microplate reader at 492 nm. SDS-PAGE and Western blotting against Ostn was also performed to confirm the presence of the fusion protein. The expression plasmid for rat GC-A containing the entire coding sequence cloned between the NheI-KpnI sites of cytomegalovirus-driven pBK plasmid (Stratagene, La Jolla, CA) was kindly provided by Dr. A. De Léan (Département de Pharmacologie, Université de Montréal). The human NPR-C and GC-B coding sequences were amplified by RT-PCR from human embryonic kidney poly(A) RNA (Clontech, Palo Alto, CA) with the following primer pairs: NPR-C, 5′-agggcaagctctttcttgcg-3′ (forward) and 5′-gggcttcctttaagctactg-3′ (reverse); GC-B, 5′-ctgctgctttatccccatgg-3′ (forward) and 5′-ggtttacaggagtccaggag-3′ (reverse). The resulting PCR products were then cloned downstream of the cytomegalovirus promoter into the pcDNA1.1 plasmid (Invitrogen). All constructs were validated by DNA sequencing. To produce a bacterial human Ostn (recombinant human Ostn (rhOstn)), its cDNA encoding amino acids 23-133 was PCR-amplified with oligos 5′-gagggtacccgtagatgtaacaacaacagagg-3′ (forward) and 5′-ctcctgcagttagcctctggaatttgaaagccg-3′ (reverse). The purified PCR fragment was digested with KpnI and PstI and cloned into pQE30 plasmid and transformed into the Escherichia coli strain SG13009 (Qiagen). The N-terminal six-histidine-tagged rhOstn was purified from the soluble bacterial extract by sonication followed by chromatography through nickel-nitrilotriacetic acid-Sepharose (Qiagen) and a Sepharose-SP cationic exchanger (GE Healthcare). The final rhOstn preparation was estimated to be ∼95% pure by SDS-PAGE and silver staining and was quantified by direct enzyme-linked immunosorbent assay as described above. PLAP-Ostn Fusion Protein—Binding studies were performed as described previously (13Flanagan J.G. Cheng H.J. Methods Enzymol. 2000; 327: 198-210Crossref PubMed Scopus (67) Google Scholar, 14Flanagan J.G. Cheng H.J. Feldheim D.A. Hattori M. Lu Q. Vanderhaeghen P. Methods Enzymol. 2000; 327: 19-35Crossref PubMed Scopus (106) Google Scholar, 15Flanagan J.G. Leder P. Cell. 1990; 63: 185-194Abstract Full Text PDF PubMed Scopus (630) Google Scholar). Briefly, HEK293 cells were transiently transfected with the appropriate expression plasmids (GC-A, GC-B, or NPR-C) or a negative control (cytomegalovirus-based green fluorescent protein expression plasmid (pQBIfc3, Qbiogene)). Forty-eight hours later cells were washed twice with Hanks' balanced salt solution containing 0.1% d-glucose, 0.5% bovine serum albumin, 20 mm HEPES, and 0.05% NaN3. Binding of the PLAP-Ostn-containing conditioned media with or without the various peptides (500 μl total/well) was performed at 25 °C for 15 min. Cells were washed 6 times with Hanks' balanced salt solution for 5 min each and lysed with 10 mm Tris-HCl (pH 8) containing 0.1% Triton X-100 at 25 °C, and endogenous alkaline phosphatase was inactivated at 65 °C for 10 min. PLAP activity was measured in the linear range by a standard enzymatic assay using p-nitrophenyl phosphate as substrate (Sigma). 125I-Labeled Ostn-(83-133)—Intact cell binding studies with radiolabeled Ostn-(83-133) were carried out in confluent ATDC5 cells. Briefly, ATDC5 cells were washed in cold phosphate-buffered saline then incubated in Ham's/F-12 plus 0.1% bovine serum albumin with 50,000 cpm of 125I-labeled Ostn-(83-133) for 90 min at 4 °C with varying concentrations of cold Ostn-(83-133) competitor. Cells were washed in cold phosphate-buffered saline and lysed into 0.5 m NaOH, and the bound cpm were counted on a Wallac Wizard 1470 gamma counter (PerkinElmer Life Sciences). Binding curves were analyzed by nonlinear regression using GraphPad Prism software (GraphPad Software, San Diego, CA). For cGMP assays, cells were washed and incubated for 10 min in culture media containing 0.1% bovine serum albumin and 0.25 mm of the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (Sigma) to minimize cGMP degradation. Treatments were carried out in the presence of 3-isobutyl-1-methylxanthine for 15 min, and cells were collected in ice-cold 65% ethanol. Cell extracts were assayed in duplicate using cGMP Direct Biotrak EIA (Amersham Biosciences) according to the manufacturer's protocol. Transgenic mice were generated by nuclear microinjection of a 4454-bp DNA fragment containing the rat collagen 1 α1 3.6-kilobase promoter (-3500 to +115) (GenBank™ accession number J04464) and the mouse Ostn coding region. Five hundred copies were microinjected into the pronuclei of C3B6F1 fertilized eggs (C57BL/6J x C3H/HeJ F1 hybrid) which were then transplanted to the oviducts of pseudopregnant foster mothers using standard protocols at the Transgenic Facility at the Institut de Recherches Cliniques de Montréal (16Hogan B. Beddington R.S. Costantini F. Lacy E. Manipulating the Mouse Embryo: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Plainview, NY1994Google Scholar). Three independent mouse lines, 650, 677, and 688, were generated arising from three different founders. Genotyping was carried out by Southern analysis of EcoRI-digested genomic DNA with a mouse Ostn coding region probe or by PCR using inter-exon primers covering the Ostn coding region (1Thomas G. Moffatt P. Salois P. Gaumond M.H. Gingras R. Godin E. Miao D. Goltzman D. Lanctot C. J. Biol. Chem. 2003; 278: 50563-50571Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Long bone lengths were measured using fine calipers on dissected bones. Tail lengths were measured from anus to tail tip using a ruler. All measurements were undertaken by the same operator blinded to the mouse genotype. For immunohistochemistry, bones were fixed, decalcified, embedded, and cut according to standard protocols (17Bourque W.T. Gross M. Hall B.K. J. Histochem. Cytochem. 1993; 41: 1429-1434Crossref PubMed Scopus (52) Google Scholar). An Ostn-specific antibody (1Thomas G. Moffatt P. Salois P. Gaumond M.H. Gingras R. Godin E. Miao D. Goltzman D. Lanctot C. J. Biol. Chem. 2003; 278: 50563-50571Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) was used for immunolabeling and visualized with DAKO Envisision + System-HRP (AEC) (DAKO, Carpinteria, CA) as per the manufacturer's protocol. Proliferation of growth plate chondrocytes was assessed using a proliferating cell nuclear antigen staining kit (Zymed Laboratories Inc., San Francisco, CA) on 7-week-old tibiae from Ostn-Tg and wild type littermates. After immunohistochemistry, positively stained cells in the entire growth plate were counted and expressed as the percentage of total cell number. To measure cGMP levels in the bones of wild type and transgenic mice, 10-14-day-old mice were euthanized, and the femurs and tibia were dissected and cleaned of any adjacent soft tissue. The whole bones including epiphysis, metaphysis, diaphysis, and marrow were then immediately homogenized in 1 ml of cold 65% ethanol using a Polytron homogenizer and stored at -80 °C until assay. For assay, the bone extracts were spun at 12000 rpm at 4 °C for 10 min, and the supernatant was evaporated to dryness and resuspended in 1 ml of cGMP assay buffer. The cGMP assay was then carried out according to the manufacturer's protocol using 25-μl aliquots as for the cellular assays. RNA was isolated from whole bones, isolated tissues, or whole cell lysates using Trizol™ (Invitrogen). Tendons and muscles were obtained from 3-month-old rats and the bone tissue from 4-day-old neonates. Northern blots were generated on nylon membranes (Osmonics, Westborough, MA) by standard methods (18Sambrook J. Fritsch E. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Filters were prehybridized for 4 h and hybridized overnight in Church buffer (19Church G.M. Gilbert W. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 1991-1995Crossref PubMed Scopus (7266) Google Scholar) at 65 °C. The rat Ostn cDNA probe corresponded to the full coding sequence. A mouse glyceraldehyde-3-phosphate dehydrogenase cDNA probe corresponding to -21 to 956 bp of GenBank™ accession number M32599 was generated by PCR. Probes were labeled with [α-32P]dCTP using a standard random priming protocol (18Sambrook J. Fritsch E. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). RNA was extracted from confluent ATDC5 prechondrocytes and UMR106 osteoblasts 7 days post-confluence using Trizol™. For RT-PCR, cDNAs were generated with Superscript II™ reverse transcriptase (Invitrogen) and random hexamer priming from 2 μg of total RNA, and PCR amplification was carried out with gene-specific primers using Taq DNA polymerase (Amersham Biosciences). Gene-specific primers (all 5′-3′) and conditions were as follows: NPR-A, forward tggatctcaagtgggagcacag and reverse gatctgcatagagcacaagc (annealing temperature = 58 °C, 35 cycles, product 261 bp); NPR-B, forward aactgatgctggagaaggagc and reverse gcgagtaagatggttgaactggac (annealing temperature = 58 °C, 35 cycles, product 305 bp); NPR-C, forward ctacatccaaggcagcgagcg and reverse gcaaccacagagaagtcccca (annealing temperature = 56 °C, 35 cycles, product 492 bp); 18 S ribosomal RNA, forward tcaagaacgaaagtcggagg and reverse ccaactaagaacggccatgc (annealing temperature = 62 °C, 20 cycles, product 324 bp). Ostn Sequence Homology—Initial analysis of Ostn species conservation identified Ostn in humans, cows, mice, rats, chickens, and snakes (1Thomas G. Moffatt P. Salois P. Gaumond M.H. Gingras R. Godin E. Miao D. Goltzman D. Lanctot C. J. Biol. Chem. 2003; 278: 50563-50571Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Further analysis through genomic data mining has identified Ostn in amphibians (Ambystoma tigrinum tigrinum, Eastern tiger salamander) and fish (Danio rerio, Zebrafish) as well as chimpanzee, pig, and dog. Fig. 1 shows the alignment between Ostn protein sequences from various vertebrate species with strong conservation of the C-terminal half of Ostn (e.g. human to amphibian = 81% similarity). Within the Ostn C-terminal region are two highly conserved putative dibasic motifs (Fig. 1, shaded) which may represent active processing sites for proteinases. N-terminal microsequencing of purified Ostn from the conditioned media of HEK293 cells stably expressing mouse Ostn revealed the presence of a fragment starting at Ser80, thus demonstrating processing at the KKKR site. Processing at the KRR site has not as yet been demonstrated. The two dibasic sites delimit similar sequences (Fig. 1, boxed), which contain motifs found in the NPs (NP-like motifs, NM). Fig. 2 shows the alignment between the human Ostn motifs (NM1 and NM2) and NPs. Residues shaded in gray are well conserved, particularly those marked with asterisks (Phe7, Gly8, and Arg13, numbered according to CNP) which are considered important in binding to the NPR-C receptor. Note, however, the absence of the two cysteine residues present in all NPs (Fig. 2, shaded black). Extra-osseous Ostn Expression—Although initially identified as an osteoblast-specific gene, further analyses of non-osseous tissues demonstrated Ostn expression in other stromal-derived tissues. Northern blotting has demonstrated that Ostn was expressed at significant levels in both leg tendons/ligaments and skeletal muscle of young adult rats (Fig. 3). Ostn levels appeared very high in tendons, with weaker expression in muscle. However, direct comparisons are difficult to draw due to differing cell densities and cell population homogeneity in the various tissues. Preliminary immunohistochemistry localization of Ostn in long bones and teeth confirmed it is present in knee joint and periodontal ligaments (supplemental Fig. 1). Ostn Binding to Natriuretic Peptide Receptors—Two approaches were used to characterize Ostn binding to NPRs. First, a heterologous expression system (transiently transfected HEK293 cells) in conjunction with an Ostn-fusion reporter (PLAP-Ostn) was utilized to demonstrate receptor-specific binding. Further characterization of the binding of Ostn to the NPR-C receptor was then undertaken using an iodinated synthetic C-terminal Ostn peptide (125I-labeled Ostn-(83-133)) in a pre-chondrocytic cell line (ATDC5) and which endogenously express natriuretic receptors. These cells have the potential to differentiate into matrix producing chondrocytes with insulin treatment. However, for our studies the presence of excessive matrix would greatly complicate binding studies, and the expression pattern of the NPRs was most appropriate in the pre-differentiated confluent state. Functional consequences of Ostn binding to NPR-C were then demonstrated by an enhanced cGMP response to CNP treatment in ATDC5 cells and an osteoblastic cell line, UMR106. The Ostn fusion protein, PLAP-Ostn, comprised an N-terminal secreted PLAP moiety linked to full-length mouse Ostn (residues 29-130). Conditioned media containing PLAP-Ostn was used to assess Ostn binding on transiently transfected HEK293 cells. We first wished to establish the specificity of PLAP-Ostn for the different NPRs. Saturable binding of the PLAP-Ostn fusion protein was observed exclusively on NPR-C-overexpressing cells (Fig. 4A). No specific binding was seen on cells overexpressing either green fluorescent protein, GC-B (Fig. 4A) or GC-A (not shown). To verify functionality of the overexpressed receptors, intracellular cGMP levels were measured in transfected HEK293 cells upon stimulation with the appropriate ligand. As expected, ANP elicited the greatest response via GC-A and CNP through GC-B, indicating the receptors were functionally expressed in this heterologous system (Fig. 4B). Because of the presence of endogenous GC-A in HEK293 cells, low levels of cGMP were also induced by ANP after transfection with either GC-B or NPR-C (Fig. 4B). Consistent with absence of PLAP-Ostn binding to GC-A or GC-B, both a C-terminal Ostn peptide encompassing NM2 (Ostn-(107-129)) (see Fig. 2) or a recombinant form of human full-length Ostn (rhOstn) failed to activate either GC-A or GC-B (Fig. 4B). To investigate the role of the proposed natriuretic motifs in Ostn binding to NPR-C, two synthetic Ostn peptides, Ostn-(107-129) described above and Ostn-(107-129), lacking part of NM2, were used for competition binding studies. HEK293 cells transfected with NPR-C were co-incubated with ∼30 nm PLAP-Ostn and increasing concentrations of Ostn-(107-129) or Ostn-(107-129). Ostn-(107-129) was able to compete off 50% of the binding of PLAP-mouse Ostn in the ∼10-9-10-8m range, in contrast to Ostn-(107-129), which was unable to efficiently compete up to 10-7m (Fig. 4C). Having established that Ostn binds to the NPR-C receptor and that at least the NM2 motif was important for this interaction, we further characterized binding in ATDC5 cells which express both GC-B and NPR-C receptors (Fig. 4E, inset) (20Atsumi T. Miwa Y. Kimata K. Ikawa Y. Cell Differ. Dev. 1990; 30: 109-116Crossref PubMed Scopus (336) Google Scholar, 21Fujishige K. Kotera J. Yanaka N. Akatsuka H. Omori K. Biochim. Biophys. Acta. 1999; 1452: 219-227Crossref PubMed Scopus (17) Google Scholar). Competitive binding experiments with 125I-labeled Ostn-(83-133) and increasing concentrations of cold Ostn-(83-133) gave an average Kd of 4.8 ± 0.9 nm with a curve characteristic of competitive binding for a single receptor site (Fig. 4D). Binding of Ostn to NPR-C could result in attenuation of the clearance action of this receptor, thus increasing NP availability and cGMP production upon stimulation of GC-A or GC-B. We tested this hypothesis in ATDC5 and UMR106 cells whereby NP signaling (cGMP production) was assessed in the presence or absence of Ostn-(83-133). ATDC5 cells express both GC-B and NPR-C at confluence (Fig. 4E, inset). When treated with 10-7 or 10-6m CNP, ATDC5 cells produced 10.1 ± 1.9 and 37.0 ± 4.5 ng of cGMP/μg of protein, respectively. However, if the cells were incubated with the same concentrations of CNP together with 10-7m Ostn-(83-133), cGMP production was augmented 5.2- and 2.2-fold, respectively (p ≤ 0.01). UMR106 osteoblasts were used at 7 days post-confluence when both GC-B and NPR-C were expressed (Fig. 4F, inset). Treatment of UMR106 with a range of CNP concentrations from 10-7 to 10-6m resulted in a dose-responsive cGMP production. At all CNP concentrations tested, co-treatment with Ostn augmented cGMP production, with an average increase of 1.4-fold (p ≤ 0.05) (Fig. 4F). Using the heterologous HEK293 model, we showed that Ostn could not compete off either ANP or CNP for the endogenous GC-A or the overexpressed GC-B receptors, respectively (see supplemental Figs. 2 and 3). However, in both cases Ostn could effectively compete with either ANP or CNP for the NPR-C receptor, with concomitant activation of their respective cognate receptors and increase in intracellular cGMP accumulation (supplemental Figs. 2 and 3). Characterization of Ostn Transgenic Mice—Reflecting the initial identification of Ostn in osteoblastic cells, we investigated its role in the skeleton in vivo by generating transgenic mice utilizing the rat 3.6-kilobase collagen type I promoter to overexpress mouse Ostn in osteoblast-lineage cells (Ostn-TG) (22Dacic S. Kalajzic I. Visnjic D. Lichtler A.C. Rowe D.W. J. Bone Miner. Res. 2001; 16: 1228-1236Crossref PubMed Scopus (109) Google Scholar). It should be noted, however, that the collagen type I promoter also drives expression in the perichondrium, skin, and tendons (23Pavlin D. Lichtler A.C. Bedalov A. Kream B.E. Harrison J.R. Thomas H.F. Gronowicz G.A. Clark S.H. Woody C.O. Rowe D.W. J. Cell Biol. 1992; 116: 227-236Crossref PubMed Scopus (122) Google Scholar). Three independent mouse lines were established and analyzed with all three lines showing similar phenotypes. Northern blotting confirmed high levels of transgene expression in bone with no apparent effects on endogenous expression (data not shown). Immunohistochemical staining demonstrated elevated Ostn protein levels in osteoblastic cells of 4-day-old Ostn-TG tibiae versus wild type littermates (Fig. 5, A and B). Clear expression can be seen in the cuboidal osteoblasts in the primary spongiosa and surrounding periosteum, sites rich in osteoblasts. Expression was also seen in the perichondrium surrounding the growth plate (a known site of collagen type I expression). Ostn-TG mice displayed no gross physiological defects, with similar body weight to their wild type littermates. Life spans of the Ostn-TG mice appeared normal with no evidence of early death up until 12 months of age. Bone mineral density as well as lean and fat mass, as measured by dual energy x-ray absorptiometry (DEXA) in 8-month-old mice from the three transgenic lines, showed" @default.
• W2008767446 created "2016-06-24" @default.
• W2008767446 creator A5015390845 @default.
• W2008767446 creator A5017363918 @default.
• W2008767446 creator A5036735981 @default.
• W2008767446 creator A5048933317 @default.
• W2008767446 creator A5065814109 @default.
• W2008767446 creator A5071559407 @default.
• W2008767446 creator A5071844929 @default.
• W2008767446 creator A5084643424 @default.
• W2008767446 date "2007-12-01" @default.
• W2008767446 modified "2023-10-10" @default.
• W2008767446 title "Osteocrin Is a Specific Ligand of the Natriuretic Peptide Clearance Receptor That Modulates Bone Growth" @default.
• W2008767446 cites W1496206652 @default.
• W2008767446 cites W1553668020 @default.
• W2008767446 cites W1600789747 @default.
• W2008767446 cites W1606294561 @default.
• W2008767446 cites W1608418464 @default.
• W2008767446 cites W1650161087 @default.
• W2008767446 cites W1968130104 @default.
• W2008767446 cites W1968719726 @default.
• W2008767446 cites W1973210891 @default.
• W2008767446 cites W1978327680 @default.
• W2008767446 cites W1978411785 @default.
• W2008767446 cites W1978835889 @default.
• W2008767446 cites W1984239590 @default.
• W2008767446 cites W1994900313 @default.
• W2008767446 cites W1996714783 @default.
• W2008767446 cites W2004801897 @default.
• W2008767446 cites W2011632934 @default.
• W2008767446 cites W2011929115 @default.
• W2008767446 cites W2013924303 @default.
• W2008767446 cites W2014429372 @default.
• W2008767446 cites W2029416726 @default.
• W2008767446 cites W2037949540 @default.
• W2008767446 cites W2038051362 @default.
• W2008767446 cites W2040325305 @default.
• W2008767446 cites W2046541342 @default.
• W2008767446 cites W2050380620 @default.
• W2008767446 cites W2050434322 @default.
• W2008767446 cites W2050526614 @default.
• W2008767446 cites W2054649519 @default.
• W2008767446 cites W2059535615 @default.
• W2008767446 cites W2066001203 @default.
• W2008767446 cites W2066223913 @default.
• W2008767446 cites W2069201449 @default.
• W2008767446 cites W2080736228 @default.
• W2008767446 cites W2090230696 @default.
• W2008767446 cites W2090376677 @default.
• W2008767446 cites W2098150638 @default.
• W2008767446 cites W2112893967 @default.
• W2008767446 cites W2113121713 @default.
• W2008767446 cites W2122414904 @default.
• W2008767446 cites W2122450538 @default.
• W2008767446 cites W2128725121 @default.
• W2008767446 cites W2132106701 @default.
• W2008767446 cites W2142994154 @default.
• W2008767446 cites W2152843678 @default.
• W2008767446 cites W2153706465 @default.
• W2008767446 cites W2158411945 @default.
• W2008767446 cites W2159012862 @default.
• W2008767446 cites W2162498210 @default.
• W2008767446 cites W2167198373 @default.
• W2008767446 cites W2171707147 @default.
• W2008767446 cites W2263089051 @default.
• W2008767446 cites W2576734941 @default.
• W2008767446 cites W4229755335 @default.
• W2008767446 cites W4236712566 @default.
• W2008767446 cites W53596582 @default.
• W2008767446 doi "https://doi.org/10.1074/jbc.m708596200" @default.
• W2008767446 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17951249" @default.
• W2008767446 hasPublicationYear "2007" @default.
• W2008767446 type Work @default.
• W2008767446 sameAs 2008767446 @default.
• W2008767446 citedByCount "79" @default.
• W2008767446 countsByYear W20087674462013 @default.
• W2008767446 countsByYear W20087674462014 @default.
• W2008767446 countsByYear W20087674462015 @default.
• W2008767446 countsByYear W20087674462016 @default.
• W2008767446 countsByYear W20087674462017 @default.
• W2008767446 countsByYear W20087674462018 @default.
• W2008767446 countsByYear W20087674462019 @default.
• W2008767446 countsByYear W20087674462020 @default.
• W2008767446 countsByYear W20087674462021 @default.
• W2008767446 countsByYear W20087674462022 @default.
• W2008767446 countsByYear W20087674462023 @default.
• W2008767446 crossrefType "journal-article" @default.
• W2008767446 hasAuthorship W2008767446A5015390845 @default.
• W2008767446 hasAuthorship W2008767446A5017363918 @default.
• W2008767446 hasAuthorship W2008767446A5036735981 @default.
• W2008767446 hasAuthorship W2008767446A5048933317 @default.
• W2008767446 hasAuthorship W2008767446A5065814109 @default.
• W2008767446 hasAuthorship W2008767446A5071559407 @default.
• W2008767446 hasAuthorship W2008767446A5071844929 @default.
• W2008767446 hasAuthorship W2008767446A5084643424 @default.
• W2008767446 hasBestOaLocation W20087674461 @default.
• W2008767446 hasConcept C116569031 @default.
• W2008767446 hasConcept C126322002 @default.

• next