FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2008778493> ?p ?o ?g. }

• W2008778493 endingPage "14454" @default.
• W2008778493 startingPage "14444" @default.
• W2008778493 abstract "Coproporphyrinogen III oxidase, encoded by a single nuclear gene in Chlamydomonas reinhardtii, produces three distinct transcripts. One of these transcripts is greatly induced in copper-deficient cells by transcriptional activation, whereas the other forms are copper-insensitive. The induced form of the transcript was expressed coordinately with the cytochromec 6-encoding (Cyc6) gene, which is known to be transcriptionally regulated in copper-deficient cells. The sequence GTAC, which forms the core of a copper response element associated with the Cyc6 gene, is also essential for induction of the Cpx1 gene, suggesting that both are targets of the same signal transduction pathway. The constitutive and induced Cpx1 transcripts have the same half-lives in vivo, and all encode the same polypeptide with a chloroplast-targeting transit sequence, but the shortest one representing the induced form is a 2–4-fold better template for translation than are either of the constitutive forms. The enzyme remains localized to a soluble compartment in the chloroplast even in induced cells, and its abundance is not affected when the tetrapyrrole pathway is manipulated either genetically or by gabaculine treatment. Coproporphyrinogen III oxidase, encoded by a single nuclear gene in Chlamydomonas reinhardtii, produces three distinct transcripts. One of these transcripts is greatly induced in copper-deficient cells by transcriptional activation, whereas the other forms are copper-insensitive. The induced form of the transcript was expressed coordinately with the cytochromec 6-encoding (Cyc6) gene, which is known to be transcriptionally regulated in copper-deficient cells. The sequence GTAC, which forms the core of a copper response element associated with the Cyc6 gene, is also essential for induction of the Cpx1 gene, suggesting that both are targets of the same signal transduction pathway. The constitutive and induced Cpx1 transcripts have the same half-lives in vivo, and all encode the same polypeptide with a chloroplast-targeting transit sequence, but the shortest one representing the induced form is a 2–4-fold better template for translation than are either of the constitutive forms. The enzyme remains localized to a soluble compartment in the chloroplast even in induced cells, and its abundance is not affected when the tetrapyrrole pathway is manipulated either genetically or by gabaculine treatment. Chlamydomonas reinhardtii exhibits multiple adaptations to copper deficiency, making it an excellent model system for the study of metal-responsive gene expression. One well characterized metal-responsive pathway in many green algae and cyanobacteria is the reciprocal accumulation of plastocyanin and cytochromec 6 (cytc 6) 1The abbreviations used are: cyt, cytochrome; coprogen, coproporphyrinogen III; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; UTR, untranslated region; TAP, Tris acetate-phosphate; pBSII, pBluescript II; CuRE, copper response element; +Cu, copper-supplemented; −Cu, copper-deficient 1The abbreviations used are: cyt, cytochrome; coprogen, coproporphyrinogen III; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; UTR, untranslated region; TAP, Tris acetate-phosphate; pBSII, pBluescript II; CuRE, copper response element; +Cu, copper-supplemented; −Cu, copper-deficientin response to the amount of copper supplied in the growth medium (1Wood P.M. Eur. J. Biochem. 1978; 87: 8-19Crossref Scopus (183) Google Scholar, 2Sandmann G. Reck H. Kessler E. Boger P. Arch. Microbiol. 1983; 134: 23-27Crossref Scopus (79) Google Scholar, 3Morand L.Z. Cheng R.H. Krogmann D.W. Bryant D.A. The Molecular Biology of Cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands1994: 243-269Google Scholar, 4Kerfeld C.A. Krogmann D.W. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998; 49: 397-425Crossref PubMed Google Scholar, 5Merchant S. Rochaix J.-D. Goldschmidt-Clermont M. Merchant S. Molecular Biology of Chlamydomonas: Chloroplasts and Mitochondria. 7. Kluwer Academic Publishers, Dordrecht, The Netherlands1998: 597-611Google Scholar, 6Merchant S. Silver S. Walden W. Metal Ions in Gene Regulation. Chapman and Hall, New York1998: 450-467Crossref Google Scholar). Plastocyanin is a small thylakoid lumen-localized copper protein that functions in photosynthesis to transfer electrons from cytf of the cyt b 6 f complex to P700+ in photosystem I (reviewed in Refs. 3Morand L.Z. Cheng R.H. Krogmann D.W. Bryant D.A. The Molecular Biology of Cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands1994: 243-269Google Scholar, 7Redinbo M.R. Yeates T.O. Merchant S. J. Bioenerg. Biomembr. 1994; 26: 49-66Crossref PubMed Scopus (131) Google Scholar, and 8Sigfridsson K. Photosynth. Res. 1998; 57: 1-28Crossref Scopus (75) Google Scholar). Because it is required for plastocyanin function, copper is essential for photosynthesis in plants (9Owen C.A.J. Copper Deficiency and Toxicity: Acquired and Inherited, in Plants, Animals and Man. Noyes Publications, Park Ridge, NJ1981Google Scholar, 10Sandmann G. Photosynth. Res. 1987; 11: 37-44Crossref PubMed Scopus (3) Google Scholar, 11Droppa M. Horvath G. Crit. Rev. Plant Sci. 1990; 9: 111-123Crossref Scopus (95) Google Scholar); however, many green algae and cyanobacteria can adapt under conditions of copper deficiency by inducing the synthesis of heme-containing cytc 6, which functions as an alternate electron transfer catalyst (2Sandmann G. Reck H. Kessler E. Boger P. Arch. Microbiol. 1983; 134: 23-27Crossref Scopus (79) Google Scholar, 12Sandmann G. Arch. Microbiol. 1986; 145: 76-79Crossref Scopus (70) Google Scholar). The replacement of the copper protein by a heme protein allows the organism to remain photosynthetically competent in the face of copper deficiency, a situation that is not uncommon in nature (4Kerfeld C.A. Krogmann D.W. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998; 49: 397-425Crossref PubMed Google Scholar). In C. reinhardtii, cyt c 6 expression is regulated via transcriptional activation of theCyc6 gene under conditions of copper deficiency (13Quinn J.M. Merchant S. Plant Cell. 1995; 7: 623-638PubMed Google Scholar). Plastocyanin abundance is regulated at the level of accumulation of the mature protein; in −Cu cells, the plastocyanin-encoding genePcy1 continues to be transcribed, the mRNA is translated, and the pre-apoprotein is imported into chloroplasts and processed, but if copper is not available, the relatively unstable apoprotein is degraded readily (14Merchant S. Bogorad L. J. Biol. Chem. 1986; 261: 15850-15853Abstract Full Text PDF PubMed Google Scholar, 15Li H.H. Merchant S. J. Biol. Chem. 1995; 270: 23504-23510Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). In addition to changes in the abundance of plastocyanin and cyt c 6, other differences have been noted between copper-deficient versuscopper-replete cells, including increased synthesis of a 35-kDa polypeptide and induction of a high affinity copper uptake mechanism (16Merchant S. Bogorad L. EMBO J. 1987; 6: 2531-2535Crossref PubMed Scopus (63) Google Scholar, 17Hill K.L. Hassett R. Kosman D. Merchant S. Plant Physiol. 1996; 112: 697-704Crossref PubMed Scopus (66) Google Scholar). These increases in response to copper deficiency occur in coordination with cyt c 6 synthesis and accumulation, and therefore are potential targets of the same signal transduction pathway. In previous work, the 35-kDa polypeptide was purified and identified as the enzyme coproporphyrinogen III (coprogen) oxidase through assay of its enzymatic activity and sequence analysis of tryptic peptides (18Hill K.L. Merchant S. EMBO J. 1995; 14: 857-865Crossref PubMed Scopus (48) Google Scholar). Coprogen oxidase is the 5th enzyme in the 6-step pathway leading from δ-aminolevulinic acid to protoporphyrin IX, the substrate for ferrochelatase, yielding heme or, for magnesium-chelatase, eventually yielding chlorophyll (19Beale S.I. Bryant D.A. The Molecular Biology of Cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands1993: 519-558Google Scholar, 20Timko M.P. Rochaix J.-D. Goldschmidt-Clermont M. Merchant S. The Molecular Biology of Chloroplasts and Mitochondria in Chlamydomonas. Kluwer Academic Publishers, Dordrecht, The Netherlands1998: 377-414Google Scholar). Increased synthesis of coprogen oxidase in copper-deficient cells was attributed to increased abundance ofCpx1 mRNA and was rationalized on the basis of an increased demand for heme when cyt c 6 synthesis is induced (18Hill K.L. Merchant S. EMBO J. 1995; 14: 857-865Crossref PubMed Scopus (48) Google Scholar). The entire heme biosynthetic pathway is localized in the plastid although ferrochelatase and protoporphyrinogen oxidase are found also in plant mitochondria (21Smith A.G. Marsh O. Elder G.H. Biochem. J. 1993; 292: 503-508Crossref PubMed Scopus (92) Google Scholar, 22Chow K.S. Singh D.P. Roper J.M. Smith A.R. J. Biol. Chem. 1997; 272: 27565-27571Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 23Lermontova I. Kruse E. Mock H.-P. Grimm B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8895-8900Crossref PubMed Scopus (140) Google Scholar), suggesting that the terminal steps are duplicated in the mitochondrion, presumably to provide heme for mitochondrial function. For both protoporphyrinogen oxidase and ferrochelatase, two different isoforms are encoded by two different genes (23Lermontova I. Kruse E. Mock H.-P. Grimm B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8895-8900Crossref PubMed Scopus (140) Google Scholar, 24Chow K.S. Singh D.P. Walker A.R. Smith A.G. Plant J. 1998; 15: 531-541Crossref PubMed Scopus (73) Google Scholar). In the case of protoporphyrinogen oxidase, one isoform is specifically targeted to each of the organelles, but whereas one of the ferrochelatase precursors is specifically targeted to chloroplasts, dual targeting of the other precursor has been proposed, with plastid targeting occurring as efficiently as mitochondrion targeting (22Chow K.S. Singh D.P. Roper J.M. Smith A.R. J. Biol. Chem. 1997; 272: 27565-27571Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). The discovery that coprogen oxidase activity was so highly induced in copper-deficient cells raised several questions concerning both the copper-responsive signal transduction pathway and the operation of the tetrapyrrole pathway. Specifically, was the Cpx1 gene regulated by the same mechanism as the Cyc6 gene? Does the observed regulation occur in direct response to copper deficiency or indirectly to heme depletion? Does all of the enzyme remain plastid-localized in copper-deficient cells or is it redistributed to the mitochondrion? Is the subsequent enzyme in the pathway, protoporphyrinogen oxidase, induced? To address these questions, we isolated full-length cDNAs corresponding to transcripts from copper-supplemented and copper-deficient cells, characterized induced and constitutive forms of Cpx1 transcripts with respect to half-lives and translatability in vivo, tested for mitochondrial localization of the enzyme, and analyzed cloned genomic DNA for its ability to confer copper responsiveness to a reporter gene. The possibility that Ppx1 transcripts (encoding the chloroplast form of protoporphyrinogen oxidase) exhibited copper-responsive regulation was also tested. Cultures of C. reinhardtii wild type strains CC124, CC125, 2137, and strain CC849 (cw10); strain CC425 (arg2, cw15); and transformants derived from CC425 were maintained under constant illumination (∼100 μmol m−2 s−1) in copper-containing (6 μm) or “copper-free” TAP or TAP agar (25Quinn J.M. Merchant S. Methods Enzymol. 1998; 297: 263-279Crossref PubMed Scopus (66) Google Scholar), supplemented with 200 μg/ml arginine for strain CC425. The mutant strain y-1 (yellow in the dark) was maintained under either constant illumination or constant darkness in +Cu or −Cu TAP medium. Cells were de-greened by growing in the dark and making serial one-half dilutions of cells into fresh medium. Cells took 7–12 days (average, 10 days) to completely de-green. Genomic sequences encoding coprogen oxidase were identified from a C. reinhardtii λ-EMBL3 genomic DNA library (26Goldschmidt-Clermont M. Plant Mol. Biol. 1986; 6: 13-21Crossref PubMed Scopus (54) Google Scholar) by plaque hybridization to cpx440 DNA (18Hill K.L. Merchant S. EMBO J. 1995; 14: 857-865Crossref PubMed Scopus (48) Google Scholar). An ∼3.8-kilobase pair SstI fragment was subcloned in both orientations into pBSIIKS(−) (Stratagene) to generate pCpx1a and c. An overlapping 5.8-kilobase pair NotI-SalI fragment from a different λ clone containing ∼ 4.9 kilobase pairs of additional 3′ untranslated sequence was also subcloned and an additional ∼800 base pairs of 3′ flanking sequence obtained (Fig.1, A and B). Two cDNA libraries were screened using cpx440 as a probe. Both libraries were generated from RNA isolated from copper-deficient cultures of either C. reinhardtii strain CC124 (λZipLox library) or 2137 (λgt11 library) (27Merchant S. Bogorad L. J. Biol. Chem. 1987; 262: 9062-9067Abstract Full Text PDF PubMed Google Scholar). From the λgt11 library, an ∼2.0-kilobase pair fragment that contained the entire 1098 base pairs of coding sequence and 770 base pairs of 3′ UTR was identified. From the λZipLox library, an overlapping ∼1.1-kilobase pair fragment that contained an additional 159 base pairs of 5′ untranslated sequence was identified and recovered in plasmid pZL1 following the manufacturer's excision protocol. The plasmid was named pCPX1.1. TheEcoRI fragment from the λgt11 clone was subcloned by standard techniques into pBSIIKS(−) to generate pCPX2.0. Genomic and cDNA clones were sequenced on both strands at the sequencing facility at UCLA using the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). Sequences were edited and assembled using the ABI PRISM Sequencing Analysis and Autoassembler programs (Perkin-Elmer), and further analyzed using DNA Strider, version 1.2 (28Marck C. Nucleic Acids Res. 1988; 16: 1829-1836Crossref PubMed Scopus (815) Google Scholar). Site-directed mutations were verified by sequencing (T7 Sequenase, version 2.0, sequencing kit, Amersham Pharmacia Biotech). Primers for amplification of C. reinhardtii Ppx1 cDNA (encoding protoporphyrinogen IX oxidase I) were designed based on the partial genomic DNA sequence (29Randolph-Anderson B.L. Sato R. Johnson A.M. Harris E.H. Hauser C.R. Oeda K. Ishige F. Nishio S. Gillham N.W. Boynton J.E. Plant Mol. Biol. 1998; 38: 839-858Crossref PubMed Scopus (57) Google Scholar), and were used to amplify a 435-base pair fragment. This fragment was digested with SacII andPstI and the resulting 196-base pair fragment was cloned into pBSIIKS(+), yielding pPpx196. Total DNA and total RNA from C. reinhardtii cells was isolated and analyzed by DNA or RNA blot hybridization as described previously (30Kindle K.K. Schnell R.A. Fernandez E. Lefebvre P.A. J. Cell Biol. 1989; 109: 2589-2601Crossref PubMed Scopus (288) Google Scholar, 31Merchant S. Hill K. Kim J.H. Thompson J. Zaitlin D. Bogorad L. J. Biol. Chem. 1990; 265: 12372-12379Abstract Full Text PDF PubMed Google Scholar, 32Hill K.L. Li H.H. Singer J. Merchant S. J. Biol. Chem. 1991; 266: 15060-15067Abstract Full Text PDF PubMed Google Scholar). The following cDNAs were used as probes: the cpx440 fragment (18Hill K.L. Merchant S. EMBO J. 1995; 14: 857-865Crossref PubMed Scopus (48) Google Scholar), the 710-base pair insert from pTZ18Cr552–7A (27Merchant S. Bogorad L. J. Biol. Chem. 1987; 262: 9062-9067Abstract Full Text PDF PubMed Google Scholar), the ∼7 × 102-base pair insert from pM1 (33Goldschmidt-Clermont M. Rahire M. J. Mol. Biol. 1986; 191: 421-432Crossref PubMed Scopus (185) Google Scholar), the 11 × 102-base pair BamHI fragment from pJD27 (34de Hostos E.L. Schilling J. Grossman A.R. Mol. Gen. Genet. 1989; 218: 229-239Crossref PubMed Scopus (94) Google Scholar), the 577-base pair insert of pTZ18R:CrPC6–2 (31Merchant S. Hill K. Kim J.H. Thompson J. Zaitlin D. Bogorad L. J. Biol. Chem. 1990; 265: 12372-12379Abstract Full Text PDF PubMed Google Scholar), the 16 × 102-base pair insert of pSKBluescript:ALAD (35Matters G.L. Beale S.I. Plant Mol. Biol. 1995; 27: 607-617Crossref PubMed Scopus (26) Google Scholar), the 20 × 102-base pair insert of pSKBluescript:GSAT (36Matters G.L. Beale S.I. Plant Mol. Biol. 1994; 24: 617-629Crossref PubMed Scopus (39) Google Scholar), the 6 × 102-base pair insert of pKSexp2+:HemA (37Mayer M. Willows R.D. Beale S.I. Plant Physiol. Suppl. 1997; 114: 180Google Scholar), and the 196-base pair insert of pPpx196 (described above). The specific activities of the probes ranged from to 0.9 × 108 to 4 × 108 cpm/μg DNA. The hybridization signals were visualized after exposure to Kodak XAR-5 (Eastman Kodak) or NEN Reflection (NEN Life Science Products) x-ray film at −80 °C with two intensifying screens. Hybridization signals were quantitated using a Molecular Dynamics PhosphorImager and Image QuaNT (v. 4.2a) software (Sunnyvale, CA). Poly(A)+ RNA was purified from total RNA by poly(U)-Sepharose chromatography as described (18Hill K.L. Merchant S. EMBO J. 1995; 14: 857-865Crossref PubMed Scopus (48) Google Scholar). Reverse transcription-PCR analysis of coprogen oxidase-encoding transcripts was performed as described by Xie and Merchant (38Xie Z. Merchant S. J. Biol. Chem. 1996; 271: 4632-4639Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar), except that primers 1–4 and 6 (Fig. 1 C, TableI) and the RACE-1 primer (5′-GACTCGAGTCGACATCGA(T)17-3′) (39Frohman M.A. Dush M.K. Martin G.R. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8998-9002Crossref PubMed Scopus (4314) Google Scholar) were used.Table IPrimers used for amplification of Cpx1PrimerPosition in genomic sequenceSequence (5′–3′)aUnderlined nucleotides indicate mutations.1+214 to +230ATGGCACTGCAAGCCTC2+1596 to +1578TGCCGTGGAAGTGCTTCA3+1517 to +1534GGCCAGTGGTGGTTCGGC4+2736 to +2721CAAGCCGTCACAGCTA5−12 to +12GTCGCGGCAGAATTAAGCCCGGCG6+3452 to +3434ACTCGTTGCTCTGATTCTG7−52 to −25CTGGGAATGAGGAATTCAAACATACACC8+1034 to +1017GTTGACGCCGGCCTTCTC10+230 to +214GAGGCTTGCAGTGCCAT12+12 to −12CGCCGGGCTTAATTCTGCCGCGAC14−25 to −52GGTGTATGTTTGAATTCCTCATTCCCAG15bPrimer 15 is designed to amplify the cDNA and hence the sequence is interrupted by the first intron. Primers 15 and 18 are designed with BamHI restriction sites at the 5′ ends to facilitate cloning in-frame into the thioredoxin fusion expression vector pTrxFus.+307 to +312/+437 to +448GAGTCGGATCCCGCGACGGCTATCGAGGCG18+2709 to +2690GAGTCGGATCCGGGCACCCAGACGCGGGGGTTGa Underlined nucleotides indicate mutations.b Primer 15 is designed to amplify the cDNA and hence the sequence is interrupted by the first intron. Primers 15 and 18 are designed with BamHI restriction sites at the 5′ ends to facilitate cloning in-frame into the thioredoxin fusion expression vector pTrxFus. Open table in a new tab Total RNA from cultures of C. reinhardtii was analyzed by three different methods to map the 5′ ends of transcripts from copper-supplemented versuscopper-deficient grown cells. 5′-RACE was performed using the Life Technologies, Inc. 5′-RACE system according to the manufacturer's instructions, using primer 2 for the initial amplification and primer 8 (Table I) for the nested amplification reactions. S1 nuclease protection analysis was performed (40Sharp P.A. Berk A.J. Berget S.M. Methods Enzymol. 1980; 65: 750-768Crossref PubMed Scopus (107) Google Scholar) using end-labeled primer 10 (Table I) and the genomic DNA clone pCpx1c as the template, followed by digestion with SalI to produce a 427-base pair single-stranded DNA fragment as the probe. RNase protection analysis was performed using the RPAII kit (Ambion Inc., Austin, TX). TheHindIII-KpnI fragment (nucleotides +150 to −40 of the genomic DNA sequence) from the coprogen oxidase-encoding gene promoter was cloned into pBSIIKS(−) and digested with KpnI. Labeled antisense RNA was synthesized using T7 RNA polymerase and [α-32P]CTP and was gel-purified. Hybridization signals were quantitated using a Molecular Dynamics PhosphorImager and Image QuaNT software. The indicated 5′ fragments of the coprogen oxidase-encoding gene (Cpx1) were cloned into theKpnI site of the promoterless arylsulfatase (Ars2) construct pJD54 (41Davies J.P. Weeks D.P. Grossman A.R. Nucleic Acids Res. 1992; 20: 2959-2965Crossref PubMed Scopus (135) Google Scholar) or into the β-tubulin-arylsulfatase construct pJD100 (42Davies J.P. Grossman A.R. Mol. Cell. Biol. 1994; 14: 5165-5174Crossref PubMed Google Scholar) in which theKpnI site was mutated to an EcoRI site. The resulting constructs, pCpxArs 1–5 (shown in Table III) were cotransformed into CC425 with the pArg7.8 plasmid (13Quinn J.M. Merchant S. Plant Cell. 1995; 7: 623-638PubMed Google Scholar). Arginine prototrophic transformants were tested on copper-supplementedversus copper-deficient TAP plates for copper-responsive arylsulfatase expression and analyzed by quantitative arylsulfatase assays (13Quinn J.M. Merchant S. Plant Cell. 1995; 7: 623-638PubMed Google Scholar).Table IIICopper-responsive arylsulfatase expression of CpxArs reporter gene constructs Open table in a new tab Table IITranscription of Cpx1 assessed by nuclear run-on hybridization signalsExperiment 1Experiment 2+Cu−Cu+Cu−CuCpx1/Tub2 aTranscription of the Tub2, Pcy1and RbcS2 genes was used for normalization of the nuclear preparations, because these genes are not regulated by copper. The values reported are thus arbitrary units. Transcription ofCyc6 served as a positive control for assessing the reliability of the assay (data not shown).0bSignal for +Cu Cpx1 was less than background.0.220.0140.076Cpx1/Pcy101.60.0730.56Cpx1/RbcS204.20.182.2a Transcription of the Tub2, Pcy1and RbcS2 genes was used for normalization of the nuclear preparations, because these genes are not regulated by copper. The values reported are thus arbitrary units. Transcription ofCyc6 served as a positive control for assessing the reliability of the assay (data not shown).b Signal for +Cu Cpx1 was less than background. Open table in a new tab The 404-base pair SalI to HinDIII fragment from the 5′ upstream sequence of pCpx1a was subcloned into pBSIIKS(+) and mutagenized by overlap extension PCR (43Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene. 1989; 77: 51-59Crossref PubMed Scopus (6769) Google Scholar) using Pfu polymerase (Stratagene, La Jolla, CA), reverse and universal vector primers and gene specific mutagenic primers. The complementary gene-specific mutagenic primer pairs were 5 and 12 (see Table I) for construct 4 (see Table III) and 7 and 14 for construct 5. All mutagenized fragments were sequenced to verify introduction of the desired mutation and absence of nontarget mutations. Primers 18 plus 15 (Table I) were used to amplify an ∼1.0-kilobase pair fragment from pCPX2.0 corresponding to amino acid residues 32–366 (the mature protein sequence). Amplification conditions were 95 °C for 5 min prior toTaq polymerase addition, 4 cycles of 94 °C for 1 min, 53 °C for 1 min, and 72 °C for 2 min followed by 26 cycles of 94 °C for 1 min, 58 °C for 45 s, and 72 °C for 1 min, with a final 15-min extension at 72 °C. The resulting product was gel-purified, digested with BamHI and cloned in-frame to the carboxyl terminus of the thioredoxin-encoding sequence of the expression vector pTrxFus (Invitrogen Corp., San Diego, CA), and introduced into Escherichia coli host strain GI724 for tryptophan-inducible expression. Because the fusion protein localized to inclusion bodies, a preparation of enriched inclusion bodies was solubilized (44Marston F.A.O. Glover D.M. DNA Cloning, Volume III: A Practical Approach. III. IRL Press, Oxford1987: 59-88Google Scholar) and used directly for antiserum production. Polyclonal antibodies were raised in rabbits by Cocalico Biologicals Inc. (Reamstown, PA) by popliteal lymph node injection of the purified antigen (0.25 mg) followed by three intramuscular boosts (0.15 mg). The resulting antiserum was designated anti-cpx-trx. The cDNA fragment cpx440 (18Hill K.L. Merchant S. EMBO J. 1995; 14: 857-865Crossref PubMed Scopus (48) Google Scholar) was cloned into the glutathioneS-transferase fusion vector pGEX 4T-1 (Amersham Pharmacia Biotech). The resulting overexpressed fusion protein localized to inclusion bodies, which were isolated (44Marston F.A.O. Glover D.M. DNA Cloning, Volume III: A Practical Approach. III. IRL Press, Oxford1987: 59-88Google Scholar), and the fusion protein was purified by SDS gel electrophoresis (45Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205496) Google Scholar). Protein bands were visualized with ice cold 0.25 m potassium chloride and gel slices containing the band of interest were sent to Cocalico Biologicals for antiserum (anti-cpx-glutathione S-transferase) production. CC425 or CC124 cells were grown in copper-free low sulfate TAP medium to mid-log phase. Cultures were divided into fresh acid-washed flasks, and CuCl2-EDTA (to 6 μm), and/or gabaculine (3-amino-2,3-dihydrobenzoic acid; Sigma) (to 2 mm) was added to cells. After incubation (6.8–19 h), cells were collected by centrifugation, and resuspended to 1 × 108 cells/ml in either copper-supplemented or copper-free, sulfate-free TAP medium, and allowed to recover for 2 h on a tissue culture wheel at 25 °C under constant illumination (∼50 μmol m−2s−1) before radiolabeling. Just prior to radiolabeling, a 1-ml aliquot was removed for preparation of total RNA, and a 0.5-ml aliquot was removed for extraction of soluble protein to allow for quantitation of the abundance of Cpx1 mRNA and coprogen oxidase. Radiolabeling and immunoprecipitation were carried out with the remaining part of the culture using anti-cpx-trx antiserum (46Li H.H. Quinn J. Culler D. Girard-Bascou J. Merchant S. J. Biol. Chem. 1996; 271: 31283-31289Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Soluble extracts were prepared and analyzed by immunoblotting (47Merchant S. Hill K. Howe G. EMBO J. 1991; 10: 1383-1389Crossref PubMed Scopus (69) Google Scholar) using anti-cpx-trx antiserum. Antigen-antibody complexes were detected using125I-labeled protein A, and signals quantitated using the PhosphorImager and Image QuaNT software. Nuclear material was prepared, stored, and assayed as described previously (47Merchant S. Hill K. Howe G. EMBO J. 1991; 10: 1383-1389Crossref PubMed Scopus (69) Google Scholar). Hybridization signals were quantified using the PhosphorImager. Mitochondrial preparations were made as described (48Eriksson M. Gardeström P. Samuelsson G. Plant Physiol. 1995; 107: 479-483Crossref PubMed Scopus (65) Google Scholar) from strain CC849. Proteins were separated on 12% SDS-polyacrylamide gels and analyzed by immunoblotting (47Merchant S. Hill K. Howe G. EMBO J. 1991; 10: 1383-1389Crossref PubMed Scopus (69) Google Scholar, 49Li H.H. Merchant S. J. Biol. Chem. 1992; 267: 9368-9375Abstract Full Text PDF PubMed Google Scholar), except that nonfat dry milk was used instead of calf serum as the blocking reagent for detection of carbonic anhydrase. Anti-cpx-glutathioneS-transferase antiserum was used at a dilution of 1:3000, anti-carbonic anhydrase antiserum was used at a dilution of 1:2000, and anti-Oee1 antiserum was used at a dilution of 1:3000. Bound primary antibody was detected with an alkaline phosphatase-conjugated secondary antibody and chromogenic substrate. When copper is added to −Cu cells, the abundance of Cpx1 transcripts decreases dramatically within 60 min, reminiscent of the decay ofCyc6 transcripts (32Hill K.L. Li H.H. Singer J. Merchant S. J. Biol. Chem. 1991; 266: 15060-15067Abstract Full Text PDF PubMed Google Scholar). But in contrast to the situation withCyc6, in which the transcripts continue to decay over a period of 180 min until they are completely gone, Cpx1transcripts dropped to a minimal level and then reaccumulated to reach a new steady state comparable to that in cells maintained constantly under copper replete conditions (Fig. 2). We noted a small but highly reproducible shift in the mobility of theCpx1 hybridizing band during establishment of the new steady state. The Cpx1 transcript from copper-supplemented cells appeared slightly larger than the form in −Cu cells (compare 60- and 100- or 120-min time points in Fig. 2).This suggested that there were at least two types of Cpx1 mRNAs. The different species might represent alternative transcripts from one gene, or they might represent products of two different genes. Southern analysis of total DNA from C. reinhardtii cut with four different restriction enzymes revealed a single hybridizing band in each case (Fig. 3), and its size matched the size predicted from the sequence of the Cpx1gene described in this work (Figs. 1 and4). The same hybridization pattern was observed even under low stringency conditions (hybridization temperature, 50 °C; data not shown). Therefore, we conclude that coprogen oxidase is encoded by a single gene in C. reinhardtii: the different sized transcripts must result then from differential processing of a precursor RNA or from initiation of transcription at different sites.Figure 4Nucleotide sequence ofCpx1. Numbering for the genomic DNA clone (−1049 to +3542) and amino acids (1–365) is indicated on the leftside of the sequence and the numbering for the cDNA (1–2016) is shown on the right. For the genomic DNA sequence, the position numbered +1 represents the 5′ end of the longest transcript found in both copper-supplemented and copper-deficient cells, and this is also indicated by the" @default.
• W2008778493 created "2016-06-24" @default.
• W2008778493 creator A5052051439 @default.
• W2008778493 creator A5065501629 @default.
• W2008778493 creator A5079308326 @default.
• W2008778493 date "1999-05-01" @default.
• W2008778493 modified "2023-10-03" @default.
• W2008778493 title "Induction of Coproporphyrinogen Oxidase inChlamydomonas Chloroplasts Occurs via Transcriptional Regulation of Cpx1 Mediated by Copper Response Elements and Increased Translation from a Copper Deficiency-specific Form of the Transcript" @default.
• W2008778493 cites W1225871036 @default.
• W2008778493 cites W1440014715 @default.
• W2008778493 cites W1493966034 @default.
• W2008778493 cites W1500849587 @default.
• W2008778493 cites W1523481867 @default.
• W2008778493 cites W1526504444 @default.
• W2008778493 cites W1539649121 @default.
• W2008778493 cites W1544494533 @default.
• W2008778493 cites W1557096417 @default.
• W2008778493 cites W1579020547 @default.
• W2008778493 cites W1592070037 @default.
• W2008778493 cites W1597247216 @default.
• W2008778493 cites W1598254601 @default.
• W2008778493 cites W1601471170 @default.
• W2008778493 cites W1607557152 @default.
• W2008778493 cites W1607961060 @default.
• W2008778493 cites W1622534368 @default.
• W2008778493 cites W1831365609 @default.
• W2008778493 cites W1963738699 @default.
• W2008778493 cites W1965040477 @default.
• W2008778493 cites W1968376538 @default.
• W2008778493 cites W1971491618 @default.
• W2008778493 cites W1972487430 @default.
• W2008778493 cites W1976220540 @default.
• W2008778493 cites W1978150029 @default.
• W2008778493 cites W1986700855 @default.
• W2008778493 cites W1989728768 @default.
• W2008778493 cites W1993859138 @default.
• W2008778493 cites W2004454704 @default.
• W2008778493 cites W2006229743 @default.
• W2008778493 cites W2028084169 @default.
• W2008778493 cites W2028906717 @default.
• W2008778493 cites W2039244683 @default.
• W2008778493 cites W2046344097 @default.
• W2008778493 cites W2060913542 @default.
• W2008778493 cites W2076014842 @default.
• W2008778493 cites W2089443729 @default.
• W2008778493 cites W2089608400 @default.
• W2008778493 cites W2090917678 @default.
• W2008778493 cites W2091846850 @default.
• W2008778493 cites W2092505937 @default.
• W2008778493 cites W2095815875 @default.
• W2008778493 cites W2100837269 @default.
• W2008778493 cites W2108388593 @default.
• W2008778493 cites W2111330501 @default.
• W2008778493 cites W2129328541 @default.
• W2008778493 cites W2150218190 @default.
• W2008778493 cites W2164862858 @default.
• W2008778493 cites W2247660488 @default.
• W2008778493 cites W232916448 @default.
• W2008778493 cites W2329677638 @default.
• W2008778493 cites W288844378 @default.
• W2008778493 cites W329898363 @default.
• W2008778493 cites W9623643 @default.
• W2008778493 doi "https://doi.org/10.1074/jbc.274.20.14444" @default.
• W2008778493 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10318870" @default.
• W2008778493 hasPublicationYear "1999" @default.
• W2008778493 type Work @default.
• W2008778493 sameAs 2008778493 @default.
• W2008778493 citedByCount "41" @default.
• W2008778493 countsByYear W20087784932013 @default.
• W2008778493 countsByYear W20087784932014 @default.
• W2008778493 countsByYear W20087784932015 @default.
• W2008778493 countsByYear W20087784932016 @default.
• W2008778493 countsByYear W20087784932017 @default.
• W2008778493 countsByYear W20087784932020 @default.
• W2008778493 crossrefType "journal-article" @default.
• W2008778493 hasAuthorship W2008778493A5052051439 @default.
• W2008778493 hasAuthorship W2008778493A5065501629 @default.
• W2008778493 hasAuthorship W2008778493A5079308326 @default.
• W2008778493 hasConcept C104317684 @default.
• W2008778493 hasConcept C105580179 @default.
• W2008778493 hasConcept C149364088 @default.
• W2008778493 hasConcept C178790620 @default.
• W2008778493 hasConcept C185592680 @default.
• W2008778493 hasConcept C2777106986 @default.
• W2008778493 hasConcept C544778455 @default.
• W2008778493 hasConcept C55493867 @default.
• W2008778493 hasConcept C69305403 @default.
• W2008778493 hasConcept C86803240 @default.
• W2008778493 hasConcept C95444343 @default.
• W2008778493 hasConceptScore W2008778493C104317684 @default.
• W2008778493 hasConceptScore W2008778493C105580179 @default.
• W2008778493 hasConceptScore W2008778493C149364088 @default.
• W2008778493 hasConceptScore W2008778493C178790620 @default.
• W2008778493 hasConceptScore W2008778493C185592680 @default.
• W2008778493 hasConceptScore W2008778493C2777106986 @default.
• W2008778493 hasConceptScore W2008778493C544778455 @default.
• W2008778493 hasConceptScore W2008778493C55493867 @default.
• W2008778493 hasConceptScore W2008778493C69305403 @default.

• next