FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2008785710> ?p ?o ?g. }

• W2008785710 endingPage "25863" @default.
• W2008785710 startingPage "25854" @default.
• W2008785710 abstract "Smooth muscle cells arise from different populations of precursor cellsduring embryonic development. The mechanisms that specify the smooth musclecell phenotype in each of these populations of cells are largely unknown. Inmany tissues and organs, homeodomain transcription factors play a key role indirecting cell specification. However, little is known about how theseproteins regulate smooth muscle differentiation. Using degenerate reversetranscription-PCR coupled to cDNA library screening we identified twohomeodomain proteins, Hoxa10 and Hoxb8, which are expressed in adult mousesmooth muscle tissues. All three of the previously described transcripts ofthe Hoxa10 gene, Hoxa10-1, Hoxa10-2, and Hoxa10-3, were identified. Hoxa10-1directly activated the smooth muscle-specific telokin promoter but did notactivate the SM22α, smooth muscle α-actin, or smooth muscle myosinheavy chain promoters. Small interfering RNA-mediated knock-down of Hoxa10-1demonstrated that Hoxa10-1 is required for high levels of telokin expressionin smooth muscle cells from uterus and colon. On the other hand, Hoxb8inhibited the activity of the telokin, SM22α, and smooth muscleα-actin promoters. Cotransfection of Hoxa10-1 together with Hoxa10-2 orHoxb8 suggested that Hoxa10-2 and Hoxb8 act as competitive inhibitors ofHoxa10-1. Results from gel mobility shift assays demonstrated that Hoxa10-1,Hoxa10-2, and Hoxb8 bind directly to multiple sites in the telokin promoter.Mutational analysis of telokin promoter reporter genes demonstrated that thethree homeodomain protein binding sites located between -80 and -75, +2 and+6, and +14 and +17 were required for maximal promoter activation by Hoxa10-1and maximal inhibition by Hoxb8. Together these data demonstrate that thegenes encoding smooth muscle-restricted proteins are direct transcriptionaltargets of clustered homeodomain proteins and that different homeodomainproteins have distinct effects on the promoters of these genes. Smooth muscle cells arise from different populations of precursor cellsduring embryonic development. The mechanisms that specify the smooth musclecell phenotype in each of these populations of cells are largely unknown. Inmany tissues and organs, homeodomain transcription factors play a key role indirecting cell specification. However, little is known about how theseproteins regulate smooth muscle differentiation. Using degenerate reversetranscription-PCR coupled to cDNA library screening we identified twohomeodomain proteins, Hoxa10 and Hoxb8, which are expressed in adult mousesmooth muscle tissues. All three of the previously described transcripts ofthe Hoxa10 gene, Hoxa10-1, Hoxa10-2, and Hoxa10-3, were identified. Hoxa10-1directly activated the smooth muscle-specific telokin promoter but did notactivate the SM22α, smooth muscle α-actin, or smooth muscle myosinheavy chain promoters. Small interfering RNA-mediated knock-down of Hoxa10-1demonstrated that Hoxa10-1 is required for high levels of telokin expressionin smooth muscle cells from uterus and colon. On the other hand, Hoxb8inhibited the activity of the telokin, SM22α, and smooth muscleα-actin promoters. Cotransfection of Hoxa10-1 together with Hoxa10-2 orHoxb8 suggested that Hoxa10-2 and Hoxb8 act as competitive inhibitors ofHoxa10-1. Results from gel mobility shift assays demonstrated that Hoxa10-1,Hoxa10-2, and Hoxb8 bind directly to multiple sites in the telokin promoter.Mutational analysis of telokin promoter reporter genes demonstrated that thethree homeodomain protein binding sites located between -80 and -75, +2 and+6, and +14 and +17 were required for maximal promoter activation by Hoxa10-1and maximal inhibition by Hoxb8. Together these data demonstrate that thegenes encoding smooth muscle-restricted proteins are direct transcriptionaltargets of clustered homeodomain proteins and that different homeodomainproteins have distinct effects on the promoters of these genes. Smooth muscle cells(SMC) 1The abbreviations used are: SMC, smooth muscle cells; Hox, homeodomain; RT,reverse transcription; siRNA, small interfering RNA; SRF, serum responsefactor; TK, thymidine kinase.1The abbreviations used are: SMC, smooth muscle cells; Hox, homeodomain; RT,reverse transcription; siRNA, small interfering RNA; SRF, serum responsefactor; TK, thymidine kinase. are derivedfrom diverse populations of precursor cells during embryonic development. Forexample, coronary artery SMC are derived from proepicardial cells(1Landerholm T.E. Dong X.R. Lu J. Belaguli N.S. Schwartz R.J. Majesky M.W. Development. 1999; 126: 2053-2062Crossref PubMed Google Scholar,2Mikawa T. Gourdie R.G. Dev.Biol. 1996; 174: 221-232Crossref PubMed Scopus (514) Google Scholar), whereas SMC of the aorticarch and thoracic aorta are derived partly from the neural crest(3Ito K. Sieber-Blum M. Dev.Biol. 1993; 156: 191-200Crossref PubMed Scopus (72) Google Scholar, 4Topouzis S. Majesky M.W. Dev. Biol. 1996; 178: 430-445Crossref Scopus (245) Google Scholar, 5Bergwerff M. Verberne M.E. DeRuiter M.C. Poelmann R.E. Gittenberger-de Groot A.C. Circ.Res. 1998; 82: 221-231Crossref PubMed Scopus (240) Google Scholar).In the peripheral vasculature, SMC are recruited from the surroundingmesenchyme by endothelial cells; similarly, in the gut a primitive epithelialtube recruits SMC from the surrounding mesenchyme(6Roberts D.J. Dev.Dyn. 2000; 219: 109-120Crossref PubMed Scopus (171) Google Scholar). With these diverseorigins, it is likely that distinct nuclear factors are involved in regulatingsmooth muscle development and differentiation in different smooth muscletissues. Differentiated smooth muscles are characterized by the presence of a set ofunique isoforms of contractile proteins, ion channels, and signaling moleculesthat are necessary for the contractile properties of the tissue. Severalgroups have investigated the mechanisms regulating the expression of uniquesmooth muscle-specific isoforms of contractile proteins, and experiments usingtransgenic mice have identified minimal promoter regions that are necessary tomediate smooth muscle-specific expression of several of these genes. Forexample, studies have demonstrated that a 16-kb fragment of the smooth musclemyosin heavy chain extending from -4.2 to +11.6 kb(7Madsen C.S. Regan C.P. Hungerford J.E. White S.L. Manabe I. Owens G.K. Circ.Res. 1998; 82: 908-917Crossref PubMed Scopus (117) Google Scholar), a -2,600 to +2,784 bpfragment of the smooth muscle α-actin gene(8Mack C.P. Owens G.K. Circ.Res. 1999; 84: 852-861Crossref PubMed Scopus (202) Google Scholar), a 13.7-kb (-2.7 to +11 bp)fragment of the smooth muscle γ-actin gene(9Qian J. Kumar A. Szucsik J.C. Lessard J.L. Dev. Dyn. 1996; 207: 135-144Crossref PubMed Scopus (36) Google Scholar), and a 370-bp (-190 to +180bp) fragment of the telokin gene(10Herring B.P. Smith A.F. Am.J. Physiol. 1996; 270: C1656-C1665Crossref PubMed Google Scholar,11Hoggatt A.M. Simon G.M. Herring B.P. Circ. Res. 2002; 91: 1151-1159Crossref PubMed Scopus (32) Google Scholar) are required to mimicexpression of the corresponding endogenous genes. In addition, transgenesdriven by 435 bp of the proximal SM22α promoter, although not mimickingendogenous SM22α expression, were restricted to arterial SMC in adultmice(12Li L. Miano J.M. Mercer B. Olson E.N. J. Cell Biol. 1996; 132: 849-859Crossref PubMed Scopus (284) Google Scholar, 13Zhang J.C. Kim S. Helmke B.P. Yu W.W. Du K.L. Lu M.M. Strobeck M. Yu Q. Parmacek M.S. Mol. Cell. Biol. 2001; 21: 1336-1344Crossref PubMed Scopus (137) Google Scholar, 14Xu R. Ho Y.S. Ritchie R. Li L. Am. J. Physiol. 2003; 284: H1398-H1407Crossref PubMed Scopus (41) Google Scholar).Analysis of the pattern of expression of these transgenes and other truncatedconstructs has suggested that there are distinct regulatory modules thatcontrol expression of genes in different smooth muscle tissues(11Hoggatt A.M. Simon G.M. Herring B.P. Circ. Res. 2002; 91: 1151-1159Crossref PubMed Scopus (32) Google Scholar). Progress has also beenmade in identifying some of the major transcription factors that regulate theexpression of smooth muscle-specific genes, although their tissue-specificroles have, thus far, been poorly defined. Transcription factors identified toregulate smooth muscle-specific genes include serum response factor (SRF),myocyte enhancer factor 2B (MEF2B), MEF2C, myocardin, myocardin-relatedfactor-A (MRTFA, MLK1, MAL), GATA family members, GATA 4/5/6, Krupple-likezinc finger proteins such as Sp1/3, BTEB3, single-stranded DNA-bindingproteins Purα and Purβ, and homeodomain proteins such as Gax, Hex,Nkx3.1, Nkx3.2, Barx1b, Barx2b, and Hoxb7 (for review, see Refs.15Kumar M.S. Owens G.K. Arterioscler. Thromb. Vasc. Biol. 2003; 23: 737-747Crossref PubMed Scopus (155) Google Scholar and16Oyama Y. Kawai-Kowase K. Sekiguchi K. Sato M. Sato H. Yamazaki M. Ohyama Y. Aihara Y. Iso T. Okamaoto E. Nagai R. Kurabayashi M. Arterioscler. Thromb. Vasc.Biol. 2004; 24: 1602-1607Crossref PubMed Scopus (4) Google Scholar). Homeodomain (Hox)-containing transcription factors play a crucial role inorganogenesis and pattern formation during embryogenesis and regulateproliferation, differentiation, and migration in multiple cell types(17Lorentz O. Duluc I. Arcangelis A.D. Simon-Assmann P. Kedinger M. Freund J.N. J. CellBiol. 1997; 139: 1553-1565Crossref PubMed Scopus (252) Google Scholar). In addition, expressionof these proteins often persists in adult tissues where they play a role incell type specification. Homeobox genes were first identified inDrosophila as genes whose mutations caused body segmenttransformation, or homeotic transformation(18Forlani S. Lawson K.A. Deschamps J. Development. 2003; 130: 3807-3819Crossref PubMed Scopus (133) Google Scholar). Homeobox genes encodeevolutionary conserved transcription factors with a common 60-amino acidDNA-binding motif that folds into three α-helices and is referred to asthe homeodomain (19Santini S. Boore J.L. Meyer A. Genome Res. 2003; 13: 1111-1122Crossref PubMed Scopus (120) Google Scholar). Inaddition to the clustered Hox genes, there are many additional proteins inmammals which contain a homeodomain and play important roles in development.Several of these homeodomain proteins, including Mhox(Prx1), Nkx3.1, Barx1b,and Barx2, have been proposed to play a role in regulating expression ofsmooth muscle genes through their ability to interact with SRF and promote itsDNA binding activity(20Carson J.A. Fillmore R.A. Schwartz R.J. Zimmer W.E. J. Biol. Chem. 2000; 275: 39061-39072Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 21Herring B.P. Kriegel A.M. Hoggatt A.M. J. Biol. Chem. 2001; 276: 14482-14489Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 22Nakamura M. Nishida W. Mori S. Hiwada K. Hayashi K. Sobue K. J. Biol. Chem. 2001; 276: 18313-18320Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 23Hautmann M.B. Thompson M.M. Swartz E.A. Olson E.N. Owens G.K. Circ. Res. 1997; 81: 600-610Crossref PubMed Scopus (105) Google Scholar).The expression of homeodomain-containing proteins has been characterized invascular SMC (for review, see Ref.24Gorski D.H. Walsh K. Circ.Res. 2001; 88: 7-8Crossref PubMed Scopus (5) Google Scholar). For example, thehomeodomain protein Gax is expressed at high levels in differentiated vascularsmooth muscle, and its expression is down-regulated during phenotypicmodulation and dedifferentiation. It has also been shown that Gax is importantto induce cell cycle arrest in vascular SMC through its activation of p21CIP-1(25Smith R.C. Branellec D. Gorski D.H. Guo K. Perlman H. Dedieu J.F. Pastore C. Mahfoudi A. Denefle P. Isner J.M. Walsh K. Genes Dev. 1997; 11: 1674-1689Crossref PubMed Scopus (162) Google Scholar). Several other Hox genes,including HOXA5, HOXA11, HOXB1, HOXB7, and HOXC9 were foundto be expressed in fetal human vascular SMC, of these only Hoxb7 andHoxa11 were detected in adult mouse smooth muscle tissues (inintestine and uterus, respectively)(26Miano J.M. Firulli A.B. Olson E.N. Hara P. Giachelli C.M. Schwartz S.M. Proc. Natl. Acad. Sci.U. S. A. 1996; 93: 900-905Crossref PubMed Scopus (47) Google Scholar). Hoxa2, Hoxa4, Hoxa5, andHoxb7 have been cloned from an adult rat vascular smooth muscle cDNA library,although the functions of these proteins were not determined in this study(27Gorski D.H. Walsh K. Circ.Res. 2000; 87: 865-872Crossref PubMed Scopus (79) Google Scholar). Subsequently, Hoxb7 hasbeen shown to increase expression of SM22α in 10T1/2 cells(28Bostrom K. Tintut Y. Kao S.C. Stanford W.P. Demer L.L. J. Cell. Biochem. 2000; 78: 210-221Crossref PubMed Scopus (45) Google Scholar). Clustered Hox genes havebeen shown to be important for vascular development and have been implicatedin several pathological processes such as arterial restenosis after balloondilatation, and abnormal expression of homeobox genes has also been found tocontribute to infertility and sterility in humans(29Taylor H.S. Bagot C. Kardana A. Olive D. Arici A. Hum. Reprod. 1999; 14: 1328-1331Crossref PubMed Scopus (337) Google Scholar). Although Hox proteins have been implicated in the regulation of smoothmuscle differentiation, the downstream targets of these proteins are poorlydefined. To elucidate further the role of Hox genes in adult SMC, we useddegenerate RT-PCR and cDNA library screening to identify Hox proteinsexpressed in the smooth muscle of adult mouse bladder and then examine therole of these proteins in regulating smooth muscle-specific genes. Clonesencoding Hoxa10 and Hoxb8 were isolated from this screen. Reporter genecotransfection studies demonstrated that Hoxa10-1 activated the smoothmuscle-specific telokin promoter in fibroblasts. siRNA-mediated knock-down ofHoxa10-1 demonstrated that Hoxa10-1 plays an important physiological role inactivating telokin expression in SMC. In contrast, Hoxb8 repressed the telokinpromoter and several other smooth muscle-specific promoters in vascular SMC.Gel mobility shift assays demonstrated binding of Hoxa10-1, Hoxa10-2, andHoxb8 to four AT-rich regions in the telokin promoter. One of these regionsincludes the CArG box. which binds SRF, and Hox binding to this region isabolished by SRF binding. Mutational analysis of the telokin promoter revealedthat each of the other three AT-rich regions in the telokin promoter isrequired for Hoxa10-1 and Hoxb8 to regulate telokin promoter activity. Takentogether, these data demonstrated a critical role of clustered homeodomainproteins in regulating smooth muscle-specific genes. RT-PCR and cDNA Library Screening—Total RNA was isolatedfrom mouse bladder using a single step guanidinium isothiocyanate procedure.mRNA was isolated from total RNA using magnetic oligo(dT) beads (Invitrogen).Prior to use poly(A)+ mRNA was treated with DNase to remove genomicDNA contamination. cDNA was generated from poly(A)+ mRNA usingrandom primers and murine leukemia virus-reverse transcriptase. Hox cDNA wasthen amplified by PCR using degenerate sense and antisense oligonucleotides(Hox sense, CTRGARCTRGARAARGARTTYCAYTT; and Hox antisense,RTTYTGRAACCARATYTTWACYTG), derived from helix 1 and 3 of the Hox domain. PCRwas carried out for 35 cycles, using an annealing temperature of 51 °C.Gel-purified PCR products were then used as probes to screen a mouse bladdercDNA library in λgt11. Library filters were hybridized overnight at 65°C with a 32P-labeled probe. Filters were washed in 2 ×SSPE (0.36 m NaCl, 0.02 m NaH2PO4,and 0.002 m EDTA, pH 7.7) + 1.0% SDS at room temperature for 15min, 2 × SSPE + 1.0% SDS at 65 °C for 15 min followed by 0.2 ×SSPE + 0.1% SDS at 65 °C for 10 min. λ-DNA was isolated usingLambdasorb (Promega, Madison, WI), digested with EcoRI, and the resultingfragments were subcloned into pGEM 7Z (Promega) and sequenced by automatedsequencing. Construction of Hoxa10, Hoxb8, and Hoxb7 Mammalian ExpressionVectors—The Hoxa10-1 cDNA isolated from the λ libraryextended from base 206 through 2450 and was thus missing 198 bp of5′-coding sequence. To generate a full-length clone, a 603-bp fragmentat the 5′-end of the Hoxa10 gene was amplified from genomic DNA usingPCR. Oligonucleotides were created from the published Hoxa10 sequence. Theamplified 5′-end was joined to the 3′-portion of Hoxa10-1 cDNA ata common SacII restriction site to generate full-length cDNA. The full-lengthHoxa10-1 was ligated into the pcDNA3 HisC mammalian expression vector(Invitrogen). The integrity of cDNA was confirmed by sequencing. The codingregion of Hoxa10-2 was amplified by PCR from the cDNAs isolated from thebladder cDNA library and cloned in-frame into a modified pShuttle vector(Clontech) that included an amino-terminal hemagglutinin epitope tag. Becausethe Hoxb8 clones isolated from our library did not contain the entire codingsequence, a 740-bp fragment of mouse Hoxb8, including the entire codingregion, was isolated by RT coupled to PCR from mouse bladder mRNA. RT wasperformed using random primers and SuperScript reverse transcriptase(Invitrogen). PCR was then performed using Deep Vent DNA polymerase and thefollowing Hoxb8-specific primers: sense, actcagaatgagctcttatttcgtcaactc;antisense, aggatcctacttcttgtcacccttctgcgcatc. After sequence confirmation theHoxb8 coding region was cloned in-frame into pcDNAHisC (Invitrogen) orpShuttle (Clontech) for expression experiments. A Hoxb7 cDNA was amplifiedfrom Image clone 4413080 (Invitrogen) and ligated into the pShuttle expressionvector (Clontech). Reporter Gene Constructs—Promoter-luciferase constructs weregenerated in the pGL2BorpGL3B luciferase vectors(Promega) as described previously(10Herring B.P. Smith A.F. Am.J. Physiol. 1996; 270: C1656-C1665Crossref PubMed Google Scholar). Promoter fragments usedwere -256 to +147 of the rabbit telokin promoter (T400(10Herring B.P. Smith A.F. Am.J. Physiol. 1996; 270: C1656-C1665Crossref PubMed Google Scholar)), -4,200 to +11,600 ofthe smooth muscle myosin heavy chain gene(7Madsen C.S. Regan C.P. Hungerford J.E. White S.L. Manabe I. Owens G.K. Circ.Res. 1998; 82: 908-917Crossref PubMed Scopus (117) Google Scholar), -2,555 to +2,813 of thesmooth muscle α-actin gene(8Mack C.P. Owens G.K. Circ.Res. 1999; 84: 852-861Crossref PubMed Scopus (202) Google Scholar), -435 to +60 of theSM22α gene (11Hoggatt A.M. Simon G.M. Herring B.P. Circ. Res. 2002; 91: 1151-1159Crossref PubMed Scopus (32) Google Scholar), and-113 to +20 of thymidine kinase gene (TK). For mutational analysis of thetelokin promoter, deletion of the AT-rich regions was generated using a -82 to+82 fragment of the mouse telokin promoter as a template. All mutant reportergene constructs were initially generated in pCRBlunt vector (Invitrogen) by aQuikChange mutagenesis kit (Stratagene) and then transferred to thepGL2B luciferase reporter vector. The resultant plasmids weresequenced to verify the integrity of the insert. Cell Transfection and Reporter Gene Assays—Plasmids weretransfected into A10 vascular SMC and 10T1/2 embryonic fibroblast cells usingFuGENE 6 (Roche Applied Science). 10T1/2 cells were grown in high glucoseDulbecco's modified Eagle's medium (Roche Applied Science) containing 5units/ml penicillin, 50 μg/ml streptomycin, and 10% fetal bovine serum. A10cells were grown in the same medium, but fetal bovine serum was increased to20%. A10 smooth muscle and 10T1/2 fibroblast cells were seeded at a density of2.5 × 104/well in a 24-well plate. 16–18 h postseedingcells were washed once with phosphate-buffered saline, pH 7.4, and replacedwith 0.5 ml of complete medium. Cells were then incubated with a total of 1μg of plasmid DNA (0.25 μg of promoter-pGL2B, 0.5 μg ofvarious expression plasmids or empty vectors, and 0.25 μg ofpRLTK-Renilla luciferase as an internal control) and 2 μl ofFuGENE 6 in 50 μl of Dulbecco's modified Eagle's medium. 24 h aftertransfection, extracts (100 μl/well) were prepared for measurement ofluciferase activity using a dual luciferase assay as described by themanufacturer (Promega). The level of firefly luciferase activity wasnormalized to the control Renilla luciferase activity. Measurementswere made from a minimum of six independent transfections, and all assays wererepeated at least twice. Results were reported as the mean ± S.E., andall variables were analyzed by t test, and significance was set atp ≤ 0.01. Gel Mobility Shift Assays—Gel mobility shift assays wereconducted in a 15-μl final volume. 0.2 ng (15 × 103counts/min) of 32P-labeled double-stranded DNA probe was added tothe binding mix. The binding mix also contained 200 ng of poly(dI-dC), 4.5μg of bovine serum albumin, and different amounts of recombinant proteindiluted in binding buffer containing 12 mm HEPES, pH 7.9, 60mm KCl, 4 mm MgCl2, 10% glycerol, and 1mm dithiothreitol, as needed. The mix was incubated for 15 min atroom temperature during the binding reaction. For antibody supershift assays,incubations were extended for 1 additional h on ice, after the addition of theappropriate antibody. Antibodies used were anti-MEF2α, SRF, Omni, andSP1, obtained from Santa Cruz (Santa Cruz, CA), and anti-hemagglutinin,obtained from Covance (Richmond, CA). In addition, unlabeled double-strandedDNA probes were used as competitors in some experiment as indicated in thefigure legends. The sequences of the sense strand of each probe used in gelmobility shift experiments were as follows: -90 to -53 core wild type probethat encompasses the -80 to -67 5′-AT-rich region and -65 to -56 CArGbox, 5′-GCTTTATATAAACTATCCCTTTTATGGGAGCT-3′; -90 to -67 probe thatencompass the -80 to -67 5′-AT-rich region,5′-CGATCTGCAGTTGCTTTATATAAACTAT-3′; -69 to -55 CArG probe,5′-CGATATCCCTTTTATGGG-3′; -2 to +23 region that encompasses the +2to +6 3′-AT-rich region and the +14 to +17 region,5′-ACTGTCACATTAACTCGCACATCAGTTCCA-3′; -2 to +23 region with +14 to+17 deleted, 5′-CATGCACATTAACTCGCACGTTCCA-3′; -2 to +23 regionwith +2 to +6 deleted, 5′-CATGCACCTCGCACATCAGTTCCA-3′; -2 to +35region with +2 to +6 and +14 to +17 mutations,5′-ACTGTCACGCGCGCTCGCACGTCGGTTCCAGAACCCATTCCA-3′; AP2,5′-CCGATCGAACTGACCGCCCGCGGCCCGT-3′; core wild type CArG mut (-90to -53), 5′-GCTTTATATAAACTATCCCTTTTCTACGAGCT-3′; -68 to -48 probewith CArG mut, 5′-CGATATCCCTTTTCTACGAGCTGAA-3′. Annealedoligonucleotides were labeled with [α-32P]-dCTP by Klenow DNApolymerase. Free [α-32P]dCTP was removed by agarose gelelectrophoresis. The DNA-protein complexes were resolved by electrophoresisthrough 4% polyacrylamide gels containing 6.5 mm Tris, pH 7.9, 3.3mm sodium acetate, pH 7.9, 1 mm EDTA, and 2.5% glycerol.The gel was then dried and exposed to photographic film with intensifyingscreens at -80 °C. Protein Expression and Western Blotting—For preparation ofextracts for gel mobility shift assays COS cells were plated at a density of1.8 × 106/100-mm dish. 16–20 h postplating, cells weretransfected with appropriate expression plasmids using FuGENE 6. 16 μg ofplasmid and 32 μl of FuGENE 6 were used for each dish of cells. 24 hpost-transfection cells were washed three times on ice with rinsing buffercontaining 40 mm Tris, pH 7.5, 1 mm EDTA, and 0.15m NaCl. COS cells were then scraped in 1 ml of rinsing buffer andtransferred to microcentrifuge tubes. Cells were collected by centrifugationand resuspended in 200 μl of resuspension buffer mix containing 40mm HEPES, 0.4 m KCl, 1 mm dithiothreitol, 0.1mg/ml phenylmethylsulfonyl fluoride, 0.1 mg/ml aprotinin, and 0.02 mg/mlleupeptin. The cells were then lysed by freeze thawing three times, thelysates clarified by centrifugation for 5 min, and the supernatant was storedat -80 °C in aliquots. Protein concentrations were determined using theBradford protein determination method. The expression of recombinant proteinswas verified by Western blotting as described previously(21Herring B.P. Kriegel A.M. Hoggatt A.M. J. Biol. Chem. 2001; 276: 14482-14489Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Reverse Transcription Coupled to PCR—Total RNA was isolatedas described previously (30Zhou J. Herring B.P. J.Biol. Chem. 2005; 280: 10861-10869Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar).400 ng of RNA template was used for RT and PCR with specific primers using theSuperScript One-step RT-PCR system (Invitrogen). Unique primers were designedfor Hoxa10-1, telokin, and glyceraldehyde-3-phosphate dehydrogenase asfollows: Hoxa10-1 sense, 5′-AGCGAGTCCTAGACTCCACGCCACC-3′, andantisense, 5′-TCACTTGTCTGTCCGTGAGGTGGACG-3′, yielding a 339-bpproduct; telokin sense, 5′-GACACCGCCTGAGTCCAACCTCCG-3′, andantisense, 5′-GGCTTTTCCTCAGCAACAGCCTCC-3′, yielding a 214-bpproduct; glyceraldehyde-3-phosphate dehydrogenase sense,5′-GCAGTGGCAAAGTGGAGATTGTTGCC-3′, and antisense,5′-GGAGATGATGACCCTTTTGGCTCCAC-3′, yielding a 294-bp product. Adenovirus-mediated Expression of siRNA Directed against Hoxa10—A plasmid-based system for the production of siRNA was generatedby inserting oligonucleotides specific to Hoxa10-1 CAATGTCATGCTCGGAGAGdownstream of an H1 promoter in the adenoviral shuttle vectorpRNAT-H1.1/Shuttle (GenScript, Piscataway, NJ). This shuttle vector iscompatible with the Adeno-X adenoviral system Clontech and was used togenerate adenovirus expressing the siRNA as described previously(30Zhou J. Herring B.P. J.Biol. Chem. 2005; 280: 10861-10869Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). For adenoviralinfection, primary mouse uterine and colonic SMC were prepared as describedpreviously (31Yin F. Herring B.P. J. Biol.Chem. 2005; 280: 4745-4752Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar), seeded in6-well plates, and allow to grow to a density of 2–2.5 ×105 cells/well. Primary cells were washed with phosphate-bufferedsaline and infected with Hoxa10-1 siRNA or control siRNA adenovirus inphosphate-buffered saline for 4 h at 37 °C. 72 h after infection proteinextracts were prepared using radioimmune precipitation assay buffer (1%Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 0.15 m NaCl, 2mm EDTA, 0.01 m sodium phosphate, pH 7.2) containingprotease inhibitors. Protein concentrations of the extracts were determinedusing the BCA protein assay. For RT-PCR analysis total RNA was extracted usingTRIzol reagent as described previously(30Zhou J. Herring B.P. J.Biol. Chem. 2005; 280: 10861-10869Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). Hoxa10 and Hoxb8 Are Expressed in Adult Mouse Bladder—RT-PCR, using degenerate oligonucleotides prepared to the first and thirdα-helixes of the conserved homeodomain of mouse Hox genes, amplified a110-bp fragment from mRNA isolated from mouse bladder. The cDNAs present inthis fragment were gel purified and used as probes to screen a λgt11cDNA library generated from mouse bladder. Five different positive clones wereobtained from the library screen, three represented Hoxa10, and tworepresented Hoxb8. Each of the Hoxa10 clones represented a distinct isoform.The Hoxa10-1 clone obtained was 2,244 bp and extended from 206–2450 ofthe published mouse Hoxa10-1 sequence. This clone was missing 198 bp of the5′-coding sequence, hence, PCR was used to obtain the missing5′-end and generate a full-length Hoxa10-1 expression construct asdescribed under “Experimental Procedures.” A 1,600-bp cloneencoding the entire coding sequence of Hoxa10-2 and a 752-bp fragment ofHoxa10-3 was obtained. Hoxb8 clones were 317 bp and ∼1,067 bp, extendingfrom 1,539 to 1,856 and from 1,440 to 2,507 bp, respectively, of the publishedHoxb8 cDNA. A full-length Hoxb8 coding region (1,059–1,787) was isolatedby RT-PCR using mouse bladder mRNA as a template as described under“Experimental Procedures.” Hoxa10 and Hoxb8 mRNA Are Expressed at a High Level in Adult SmoothMuscle Tissues and Cells—RNase protection analysis of total RNAisolated from adult mouse tissues revealed expression of Hoxa10-1 at highlevels in uterus and bladder and at lower levels in colon, kidney, skeletalmuscle, and aorta (Fig.1A). Hoxa10-1 was also detected in intestinal SMC (colonSMC) (Fig. 1A). RNaseprotection analysis of Hoxa10-2 expression showed that Hoxa10-2 is expressedin a pattern similar to that of Hoxa10-1 with the exception that Hoxa10-2 butnot Hoxa10-1 was detected in A10 vascular SMC(Fig. 1, A andB). RNase protection analysis revealed high levels ofHoxb8 mRNA in uterus, colon, and kidney and lower levels in bladder and aorta(Fig. 1C). Inaddition, RT-PCR data indicated that Hoxb8 is also expressed in primaryuterine SMC and a colon smooth muscle cell line(Fig. 1D). Hoxa10-1 Activates and Hoxb8 Represses Smooth Muscle-specificPromoters—To determine whether Hoxa10 and Hoxb8 directly regulatethe expression of smooth muscle-restricted proteins, expression constructswere cotransfected together with smooth muscle-specific promoter reportergenes into A10 vascular smooth muscle and 10T1/2 fibroblast cells, and theeffects on luciferase activity were determined. Results from these experimentsdemonstrated that in 10T1/2 cells Hoxa10-1 increased the activity of thetelokin promoter 3-fold without affecting the activity of the other promotersanalyzed (Fig. 2A).Similar results were also observed in A10 SMC (data not shown). In contrast,Hoxb8 significantly repressed the activity of the telokin, smooth muscleα-actin, and SM22α promoters by 70, 50, and 70%, respectively,without significantly altering the activity of the smooth muscle myosin or TKkinase promoters in A10 cells (Fig.2B). Hoxb8 had little effect on the activity of thesepromoters in 10T1/2 cells (data not shown). In contrast to Hoxa10-1, Hoxa10-2had no significant effect on telokin promoter activity in 10T1/2 cells(Fig. 2C) and resultedin a 30% reduction of promoter activity in A10 cells(Fig. 2D). Sequenceanalysis indicated that Hoxa10-3 does not encode for a homeodomain protein,and the protein product of this mRNA has not been defined, hence Hoxa10-3 wasnot pursued further in this study. Because Hoxb7 has also been suggested toplay a role in regulating smooth muscle-specific genes we also examined theef" @default.
• W2008785710 created "2016-06-24" @default.
• W2008785710 creator A5012096156 @default.
• W2008785710 creator A5074182524 @default.
• W2008785710 creator A5084638544 @default.
• W2008785710 creator A5015596099 @default.
• W2008785710 date "2005-07-01" @default.
• W2008785710 modified "2023-10-13" @default.
• W2008785710 title "Regulation of Smooth Muscle-specific Gene Expression by HomeodomainProteins, Hoxa10 andHoxb8" @default.
• W2008785710 cites W1484426117 @default.
• W2008785710 cites W1510530195 @default.
• W2008785710 cites W1843334120 @default.
• W2008785710 cites W1941286715 @default.
• W2008785710 cites W1969642416 @default.
• W2008785710 cites W1973110404 @default.
• W2008785710 cites W1982499150 @default.
• W2008785710 cites W1986338378 @default.
• W2008785710 cites W2002751390 @default.
• W2008785710 cites W2005152193 @default.
• W2008785710 cites W2013915043 @default.
• W2008785710 cites W2016361087 @default.
• W2008785710 cites W2017992194 @default.
• W2008785710 cites W2028442951 @default.
• W2008785710 cites W2034640099 @default.
• W2008785710 cites W2034873700 @default.
• W2008785710 cites W2036329770 @default.
• W2008785710 cites W2052487490 @default.
• W2008785710 cites W2056315093 @default.
• W2008785710 cites W2056611245 @default.
• W2008785710 cites W2061731694 @default.
• W2008785710 cites W2063679739 @default.
• W2008785710 cites W2065528132 @default.
• W2008785710 cites W2069915481 @default.
• W2008785710 cites W2072840911 @default.
• W2008785710 cites W2074538034 @default.
• W2008785710 cites W2100540802 @default.
• W2008785710 cites W2107621463 @default.
• W2008785710 cites W2109778315 @default.
• W2008785710 cites W2112873780 @default.
• W2008785710 cites W2119470055 @default.
• W2008785710 cites W2124219264 @default.
• W2008785710 cites W2131921016 @default.
• W2008785710 cites W2138569805 @default.
• W2008785710 cites W2141384566 @default.
• W2008785710 cites W2146161663 @default.
• W2008785710 cites W2150404274 @default.
• W2008785710 cites W2162507144 @default.
• W2008785710 cites W2253989424 @default.
• W2008785710 cites W2337013501 @default.
• W2008785710 cites W2339849938 @default.
• W2008785710 cites W2398889230 @default.
• W2008785710 cites W4295689030 @default.
• W2008785710 cites W2027906040 @default.
• W2008785710 doi "https://doi.org/10.1074/jbc.m501044200" @default.
• W2008785710 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15886193" @default.
• W2008785710 hasPublicationYear "2005" @default.
• W2008785710 type Work @default.
• W2008785710 sameAs 2008785710 @default.
• W2008785710 citedByCount "17" @default.
• W2008785710 countsByYear W20087857102016 @default.
• W2008785710 countsByYear W20087857102019 @default.
• W2008785710 countsByYear W20087857102020 @default.
• W2008785710 countsByYear W20087857102023 @default.
• W2008785710 crossrefType "journal-article" @default.
• W2008785710 hasAuthorship W2008785710A5012096156 @default.
• W2008785710 hasAuthorship W2008785710A5015596099 @default.
• W2008785710 hasAuthorship W2008785710A5074182524 @default.
• W2008785710 hasAuthorship W2008785710A5084638544 @default.
• W2008785710 hasBestOaLocation W20087857101 @default.
• W2008785710 hasConcept C104317684 @default.
• W2008785710 hasConcept C150194340 @default.
• W2008785710 hasConcept C153911025 @default.
• W2008785710 hasConcept C165864922 @default.
• W2008785710 hasConcept C54355233 @default.
• W2008785710 hasConcept C70721500 @default.
• W2008785710 hasConcept C86803240 @default.
• W2008785710 hasConcept C95444343 @default.
• W2008785710 hasConceptScore W2008785710C104317684 @default.
• W2008785710 hasConceptScore W2008785710C150194340 @default.
• W2008785710 hasConceptScore W2008785710C153911025 @default.
• W2008785710 hasConceptScore W2008785710C165864922 @default.
• W2008785710 hasConceptScore W2008785710C54355233 @default.
• W2008785710 hasConceptScore W2008785710C70721500 @default.
• W2008785710 hasConceptScore W2008785710C86803240 @default.
• W2008785710 hasConceptScore W2008785710C95444343 @default.
• W2008785710 hasIssue "27" @default.
• W2008785710 hasLocation W20087857101 @default.
• W2008785710 hasOpenAccess W2008785710 @default.
• W2008785710 hasPrimaryLocation W20087857101 @default.
• W2008785710 hasRelatedWork W1581778452 @default.
• W2008785710 hasRelatedWork W1930517486 @default.
• W2008785710 hasRelatedWork W2009966535 @default.
• W2008785710 hasRelatedWork W2053053668 @default.
• W2008785710 hasRelatedWork W2059282377 @default.
• W2008785710 hasRelatedWork W2098137384 @default.
• W2008785710 hasRelatedWork W2118011066 @default.
• W2008785710 hasRelatedWork W2125934144 @default.
• W2008785710 hasRelatedWork W2132444137 @default.

• next