FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2008803062> ?p ?o ?g. }

• W2008803062 endingPage "7475" @default.
• W2008803062 startingPage "7469" @default.
• W2008803062 abstract "The addition of sialic acid to T cell surface glycoproteins influences essential T cell functions such as selection in the thymus and homing in the peripheral circulation. Sialylation of glycoproteins can be regulated by expression of specific sialyltransferases that transfer sialic acid in a specific linkage to defined saccharide acceptor substrates and by expression of particular glycoproteins bearing saccharide acceptors preferentially recognized by different sialyltransferases. Addition of α2,6-linked sialic acid to the Galβ1,4GlcNAc sequence, the preferred ligand for galectin-1, inhibits recognition of this saccharide ligand by galectin-1. SAα2,6Gal sequences, created by the ST6Gal I enzyme, are present on medullary thymocytes resistant to galectin-1-induced death but not on galectin-1-susceptible cortical thymocytes. To determine whether addition of α2,6-linked sialic acid to lactosamine sequences on T cell glycoproteins inhibits galectin-1 death, we expressed the ST6Gal I enzyme in a galectin-1-sensitive murine T cell line. ST6Gal I expression reduced galectin-1 binding to the cells and reduced susceptibility of the cells to galectin-1-induced cell death. Because the ST6Gal I preferentially utilizes N-glycans as acceptor substrates, we determined that N-glycans are essential for galectin-1-induced T cell death. Expression of the ST6Gal I specifically resulted in increased sialylation of N-glycans on CD45, a receptor tyrosine phosphatase that is a T cell receptor for galectin-1. ST6Gal I expression abrogated the reduction in CD45 tyrosine phosphatase activity that results from galectin-1 binding. Sialylation of CD45 by the ST6Gal I also prevented galectin-1-induced clustering of CD45 on the T cell surface, an initial step in galectin-1 cell death. Thus, regulation of glycoprotein sialylation may control susceptibility to cell death at specific points during T cell development and peripheral activation. The addition of sialic acid to T cell surface glycoproteins influences essential T cell functions such as selection in the thymus and homing in the peripheral circulation. Sialylation of glycoproteins can be regulated by expression of specific sialyltransferases that transfer sialic acid in a specific linkage to defined saccharide acceptor substrates and by expression of particular glycoproteins bearing saccharide acceptors preferentially recognized by different sialyltransferases. Addition of α2,6-linked sialic acid to the Galβ1,4GlcNAc sequence, the preferred ligand for galectin-1, inhibits recognition of this saccharide ligand by galectin-1. SAα2,6Gal sequences, created by the ST6Gal I enzyme, are present on medullary thymocytes resistant to galectin-1-induced death but not on galectin-1-susceptible cortical thymocytes. To determine whether addition of α2,6-linked sialic acid to lactosamine sequences on T cell glycoproteins inhibits galectin-1 death, we expressed the ST6Gal I enzyme in a galectin-1-sensitive murine T cell line. ST6Gal I expression reduced galectin-1 binding to the cells and reduced susceptibility of the cells to galectin-1-induced cell death. Because the ST6Gal I preferentially utilizes N-glycans as acceptor substrates, we determined that N-glycans are essential for galectin-1-induced T cell death. Expression of the ST6Gal I specifically resulted in increased sialylation of N-glycans on CD45, a receptor tyrosine phosphatase that is a T cell receptor for galectin-1. ST6Gal I expression abrogated the reduction in CD45 tyrosine phosphatase activity that results from galectin-1 binding. Sialylation of CD45 by the ST6Gal I also prevented galectin-1-induced clustering of CD45 on the T cell surface, an initial step in galectin-1 cell death. Thus, regulation of glycoprotein sialylation may control susceptibility to cell death at specific points during T cell development and peripheral activation. P. vulgaris agglutinin deoxymannojirimycin lactosamine Galβ1,4GlcNAc S. nigra agglutinin reverse transcription phosphate-buffered saline protein-tyrosine phosphatase peptide:N-glycosidase Glycosylation of cell surface proteins controls critical T cell processes, including lymphocyte homing, thymocyte selection, the amplitude of an immune response, and T cell death (1Lowe J.B. Cell. 2001; 104: 809-812Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar, 2Tsuboi S. Fukuda M. EMBO J. 1997; 16: 6364-6373Crossref PubMed Scopus (83) Google Scholar, 3Blander J.M. Visintin I. Janeway Jr., C.A. Medzhitov R. J. Immunol. 1999; 163: 3746-3752PubMed Google Scholar, 4Moody A.M. Chui D. Reche P.A. Priatel J.J. Marth J.D. Reinherz E.L. Cell. 2001; 107: 501-512Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 5Daniels M.A. Devine L. Miller J.D. Moser J.M. Lukacher A.E. Altman J.D. Kavathas P. Hogquist K.A. Jameson S.C. Immunity. 2001; 15: 1051-1061Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 6Demetriou M. Granovsky M. Quaggin S. Dennis J.W. Nature. 2001; 409: 733-739Crossref PubMed Scopus (740) Google Scholar, 7Priatel J.J. Chui D. Hiraoka N. Simmons C.J. Richardson K.B. Page D.M. Fukuda M. Varki N.M. Marth J.D. Immunity. 2000; 12: 273-283Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 8Kelm S. Gerlach J. Brossmer R. Danzer C.P. Nitschke L. J. Exp. Med. 2002; 195: 1207-1213Crossref PubMed Scopus (159) Google Scholar, 9Galvan M. Tsuboi S. Fukuda M. Baum L.G. J. Biol. Chem. 2000; 275: 16730-16737Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). The role of glycosylation in these functions is specific, i.e. the different functions require specific sugars on specific glycoprotein acceptors. Regulated glycosylation of specific acceptor substrates can affect immune function by creating or masking ligands for endogenous lectins. For example, modification of cell surface oligosaccharides by the C2GnT and Fuc TVII glycosyltransferases results in specific selectin-mediated trafficking patterns for Th1 and Th2 subsets (3Blander J.M. Visintin I. Janeway Jr., C.A. Medzhitov R. J. Immunol. 1999; 163: 3746-3752PubMed Google Scholar). Similarly, modification of CD45 by the C2GnT glycosyltransferase regulates thymocyte susceptibility to cell death induced by galectin-1 (10Nguyen J.T. Evans D.P. Galvan M. Pace K.E. Leitenberg D. Bui T.N. Baum L.G. J. Immunol. 2001; 167: 5697-5707Crossref PubMed Scopus (175) Google Scholar). During T cell development, expression of several glycosyltransferases is temporally and spatially controlled (9Galvan M. Tsuboi S. Fukuda M. Baum L.G. J. Biol. Chem. 2000; 275: 16730-16737Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 11Baum L.G. Immunity. 2002; 16: 5-8Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). In the human thymus, different members of the sialyltransferase family are expressed in distinct anatomic compartments, so cells in those compartments bear unique complements of sialylated oligosaccharides. For example, the SAα2,6Gal sequence, the product of the ST6Gal I sialyltransferase, is detected only on mature medullary thymocytes (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). Intriguingly, mature medullary thymocytes displaying SAα2,6Gal sequences are resistant to galectin-1-induced cell death (13Perillo N.L. Uittenbogaart C. Nguyen J. Baum L.G. J. Exp. Med. 1997; 185: 1851-1858Crossref PubMed Scopus (267) Google Scholar, 14Vespa G.N.R. Lewis L.A. Kozak K.R. Moran M. Nguyen J.T. Baum L.G. Miceli M.C. J. Immunol. 1999; 162: 799-806PubMed Google Scholar). Because the addition of sialic acid in the α2,6 linkage to galactose could mask terminal galactose residues required for galectin-1 binding to T cell glycoproteins (15Di Virgilio S. Glushka J. Moremen K. Pierce M. Glycobiology. 1999; 9: 353-364Crossref PubMed Scopus (52) Google Scholar), we asked whether expression of the ST6Gal I would control susceptibility of T cells to galectin-1-induced death. Galectin-1 was prepared as described previously (13Perillo N.L. Uittenbogaart C. Nguyen J. Baum L.G. J. Exp. Med. 1997; 185: 1851-1858Crossref PubMed Scopus (267) Google Scholar). Murine BW5147.3 (BW5147), PhaR2.1, T200−, and human CEM and MOLT-4 cell lines were propagated as previously described (10Nguyen J.T. Evans D.P. Galvan M. Pace K.E. Leitenberg D. Bui T.N. Baum L.G. J. Immunol. 2001; 167: 5697-5707Crossref PubMed Scopus (175) Google Scholar, 16Perillo N.L. Pace K.E. Seilhamer J.J. Baum L.G. Nature. 1995; 378: 736-739Crossref PubMed Scopus (943) Google Scholar). Expression of cell surface oligosacccharides was detected by flow cytometry with biotinylatedPhaseolus vulgaris agglutinin (PHA)1 and Sambuccus nigra agglutinin (SNA) (E-Y Labs, San Mateo, CA) (10 μg/ml), as described (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). For glycosidase inhibition, the cell lines were cultured for 72 h with 2 mm deoxymannojirimycin (DMNJ) (Oxford GlycoSystems, Inc., Rosedale, NY) or medium alone prior to lectin analysis and cell death assays. Rat ST6Gal I cDNA in the plasmid STTyr-Myc-pcDNA 3.1 (17Weinstein J. de Souza-e-Silva U. Paulson J.C. J. Biol. Chem. 1982; 257: 13845-13853Abstract Full Text PDF PubMed Google Scholar, 18Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) (gift of Dr. Karen Colley, University of Illinois, Chicago, IL) or vector alone were transfected into PhaR2.1 and T200− cells as described (9Galvan M. Tsuboi S. Fukuda M. Baum L.G. J. Biol. Chem. 2000; 275: 16730-16737Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). Following selection in G418, positive PhaR2.1 clones were identified by SNA flow cytometry. Positive T200− clones were identified by RT-PCR, performed essentially according to the protocol provided in the Super ScriptTM One-Step RT-PCR with Platinum Taq (Invitrogen, Carlsbad, CA), using the primers 94 sense (TATGAGGCCCCTTACACTG) and 943A antisense (GCCGGAGGATGGGGGATTTGG) (18Ma J. Qian R. Rausa III, F.M. Colley K.J. J. Biol. Chem. 1997; 272: 672-679Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). 5 × 105 cells were suspended in PBS containing the indicated amount of biotinylated galectin-1 (16Perillo N.L. Pace K.E. Seilhamer J.J. Baum L.G. Nature. 1995; 378: 736-739Crossref PubMed Scopus (943) Google Scholar) at 4 °C for 1 h. After washing, the cells were incubated with streptavidin-fluorescein isothiocyanate (5 μg/ml) (Jackson Immunoresearch Laboratories, West Grove, PA) for 45 min at 4 °C. After washing, the cells were analyzed by flow cytometry. Galectin death assays were performed as described (16Perillo N.L. Pace K.E. Seilhamer J.J. Baum L.G. Nature. 1995; 378: 736-739Crossref PubMed Scopus (943) Google Scholar) with the following modifications. 105 cells were incubated with 20 μmgalectin-1 in 1.6 mm dithiothreitol/Dulbecco's modified Eagle's medium or in 1.6 mm dithiothreitol/Dulbecco's modified Eagle's medium alone as a control for 4–6 h at 37 °C. 0.1m β-lactose (final concentration) was added to dissociate galectin-1, and the cells were washed with PBS. Apoptotic cells were identified using annexin V and propidium iodide as previously described (10Nguyen J.T. Evans D.P. Galvan M. Pace K.E. Leitenberg D. Bui T.N. Baum L.G. J. Immunol. 2001; 167: 5697-5707Crossref PubMed Scopus (175) Google Scholar). The cell lysates from 4–9 × 106 cells were prepared as described (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). To precipitate SNA-binding glycoproteins, the lysates were precleared for 1 h with biotinylated bovine serum albumin (0.25 μg/225 μl cell lysate) and ImmunoPure Immobilized Streptavidin (Pierce). After centrifugation to remove insoluble material, the supernatants were incubated with SNA-biotin (5 μg/300 μl cell lysate) and ImmunoPure Immobilized Streptavidin overnight. The precipitates were washed four times with lysis buffer prior to SDS-PAGE. All of the steps were performed at 4 °C. To precipitate CD45, the supernatants were precleared with purified rat IgG2b,κ (0.25 μg/300 μl cell lysate) (Pharmingen, San Diego, CA) and ImmunoPure Immobilized Protein G (Pierce), and CD45 was precipitated with monoclonal antibody 30-F11 (3 μg/300 μl cell lysate) (Pharmingen) and ImmunoPure Immobilized Protein G overnight. CD45 or SNA precipitates were separated by SDS-PAGE, blotted to nitrocellulose, and probed with polyclonal goat anti-mouse CD45 (0.2 μg/ml) (Research Diagnostics Inc., Flanders, NJ) or SNA-biotin (1 μg/ml). Bound reagent was detected with horseradish peroxidase-labeled rabbit anti-goat IgG (Bio-Rad) or streptavidin-horseradish peroxidase, respectively, and visualized by ECL (Amersham Biosciences). ST6Gal I immunoblotting of whole cell lysates was performed as described in Ref. 12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, with rabbit anti-rat ST6Gal I antiserum (gift of Dr. K. Colley). Cell lysates (106 cells) were separated by SDS-PAGE, blotted to nitrocellulose and probed with polyclonal goat anti-mouse CD45 (M-20) (Santa Cruz Biotechnology, Santa Cruz, CA). The band corresponding to CD45 was excised from the nitrocellulose, and the bound antibody was stripped with Restore buffer (Pierce). After washing two times with 25 mm Tris, 150 mm NaCl, 0.05% Tween, pH 7.5 (TBS-T) followed by two washes with 50 mm sodium phosphate, pH 7.5, the membrane was incubated with 1.5 ml of 50 mmsodium phosphate containing 10,000 units of PNGase F (New England BioLabs, Beverly, MA) overnight at 37 °C with rocking. The enzyme-treated membrane was washed with TBS-T and probed with SNA-biotin, as described above. The cells were lysed in 50 mm sodium cacodylate, pH 6.5, 100 mm NaCl, 1 mm MgCl2, 1% Nonidet P-40, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 1 mmphenylmethylsulfonyl fluoride. 100 μl of lysates (3 × 106 cells) were incubated with 1.5 μmCMP-β-d-sialic acid (Calbiochem, San Diego, CA) and 500 μg of asialofetuin (Sigma) in 50 mm sodium cacodylate, pH 6.5, 1 mm MgCl2, for 2 h at 37 °C. To stop the reaction, the mixtures were incubated for 10 min on ice. Fetuin was precipitated with anti-fetuin antibody (Accurate Chemical Co., Westbury, NY) (5 μl/150 μl lysate), and immunoprecipitates were separated by SDS-PAGE, blotted to nitrocellulose, and probed with SNA-biotin, as described above. Band intensity was determined using the MultiImage Light Cabinet, model 2.1.1 (Alpha Innotech Corp., San Leandro, CA) with ChemiImager 5500 software. The cells were treated with or without galectin-1 as in the death assays. After treatment, the cells were washed with PBS and fixed with 2% paraformaldehyde for 30 min at 4 °C. The reaction was quenched with 0.2 m glycine for 5 min at 4 °C, and the cells were blocked with in 10% goat serum for 1.5 h at room temperature. The cells were washed with PBS and incubated with polyclonal goat anti-mouse CD45 conjugated to fluorescein isothiocyanate (Pharmingen) in 2% goat serum for 1.5 h at room temperature in the dark. After washing, the cells were mounted on slides with Prolong Anti-fade medium (Molecular Probes, Eugene OR). CD45 cell surface localization was analyzed on a Fluoview laser scanning confocal microscope (Olympus America Inc, Melville, NY), at 100×. The number of cells demonstrating CD45 segregation or clustering and the total number of cells were counted for six randomly selected fields for each experiment. Approximately 50 cells were counted in six fields. Percent CD45 segregation was calculated as [100 × (number of CD45 segregated cells/total number of cells)]. 4 × 106 cells were incubated at 37 °C in 400 μl of medium containing PBS as a control (0 min) or 30 μg of galectin-1 for 1, 5, 15, or 30 min. At the indicated times, the cells were cooled on ice, washed in PBS at 4 °C, and lysed (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar), and the protein concentrations of the cell lysates were determined (protein assay kit; Bio-Rad). Protein-tyrosine phosphatase (PTP) activity was measured using p-nitrophenyl phosphate (Calbiochem) as a substrate in the presence of okadaic acid to inhibit protein Ser/Thr phosphatases. Cell lysate (20 μg/25 μl) was incubated at room temperature for 4 h in 475 μl of PTP assay buffer (100 mm Hepes, pH 7.2, 150 mm NaCl, 1 mm EDTA, 1 mmdithiothreitol, 10 mm p-nitrophenyl phosphate, 50 nm okadaic acid) either in the absence or presence of 50 μm bpV (phen) (potassium bisperoxo (1,10-phenanthraline)oxo-vanadate(v)) as a specific PTP inhibitor (10Nguyen J.T. Evans D.P. Galvan M. Pace K.E. Leitenberg D. Bui T.N. Baum L.G. J. Immunol. 2001; 167: 5697-5707Crossref PubMed Scopus (175) Google Scholar). The reaction was stopped by adding 500 μl of 1 n NaOH, and released p-nitrophenol was measured atA 415 against appropriate blanks. Galectin-1 preferentially recognizes Galβ1,4GlcNAc (LacNAc) sequences that can be presented on N- or O-linked glycans (15Di Virgilio S. Glushka J. Moremen K. Pierce M. Glycobiology. 1999; 9: 353-364Crossref PubMed Scopus (52) Google Scholar). Although prior work from our lab demonstrated that O-glycans participate in galectin-1 T cell death (9Galvan M. Tsuboi S. Fukuda M. Baum L.G. J. Biol. Chem. 2000; 275: 16730-16737Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar), the role ofN-glycans in galectin-1 cell death is not clear. In addition, the ST6Gal I enzyme preferentially sialylates terminal galactose residues on N-glycans (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 17Weinstein J. de Souza-e-Silva U. Paulson J.C. J. Biol. Chem. 1982; 257: 13845-13853Abstract Full Text PDF PubMed Google Scholar); if the ST6Gal I participated in regulating galectin-1 cell death in vivo, it would likely occur through the modification ofN-glycans. To determine whether N-glycans are necessary for galectin-1 induced death, human and murine T cell lines were treated with the mannosidase I inhibitor DMNJ, to block trimming of terminal mannose residues and subsequent elongation of N-glycans with LacNAc sequences. The effectiveness of DMNJ treatment was determined by analyzing treated cells with the PHA, because inhibition of mannosidase I activity would prevent elongation of the N-glycan chain recognized by PHA (19Cummings R.D. Trowbridge I.S. Kornfeld S. J. Biol. Chem. 1982; 257: 13421-13427Abstract Full Text PDF PubMed Google Scholar). Cells treated with DMNJ showed a marked reduction in PHA binding compared with cells cultured in medium alone; importantly, DMNJ treatment did not affect the level of cell surface expression of galectin-1 receptors CD43 or CD45, as determined by flow cytometric analysis using the relevant antibodies (data not shown). DMNJ-treated cells were examined for susceptibility to galectin-1-induced cell death (Fig. 1). The PhaR2.1, CEM, and MOLT-4 cell lines are all susceptible to galectin-1-induced cell death, whereas the BW5147 cells are resistant to galectin-1 because of the lack of core 2O-glycans on cell surface glycoproteins (9Galvan M. Tsuboi S. Fukuda M. Baum L.G. J. Biol. Chem. 2000; 275: 16730-16737Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 10Nguyen J.T. Evans D.P. Galvan M. Pace K.E. Leitenberg D. Bui T.N. Baum L.G. J. Immunol. 2001; 167: 5697-5707Crossref PubMed Scopus (175) Google Scholar, 16Perillo N.L. Pace K.E. Seilhamer J.J. Baum L.G. Nature. 1995; 378: 736-739Crossref PubMed Scopus (943) Google Scholar). DMNJ treatment resulted in a dramatic reduction in galectin-1-induced cell death of the galectin-1-susceptible murine (PhaR2.1) and human (CEM, MOLT-4) T cell lines. Although previous studies demonstrated that the glycosylation inhibitors benzyl-α-GalNAc and swainsonine reduced T cell susceptibility to galectin-1 (9Galvan M. Tsuboi S. Fukuda M. Baum L.G. J. Biol. Chem. 2000; 275: 16730-16737Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 16Perillo N.L. Pace K.E. Seilhamer J.J. Baum L.G. Nature. 1995; 378: 736-739Crossref PubMed Scopus (943) Google Scholar), neither benzyl-α-GalNAc nor swainsonine had the dramatic inhibitory effect on cell death that we observed with DNMJ treatment. These results demonstrated that N-linked glycans are essential for galectin-1-mediated T cell death. The addition of terminal α2,6-linked sialic acid can block galectin-1 binding to the preferred saccharide ligand LacNAc. This has been demonstrated for individual LacNAc units and for poly-LacNAc chains (15Di Virgilio S. Glushka J. Moremen K. Pierce M. Glycobiology. 1999; 9: 353-364Crossref PubMed Scopus (52) Google Scholar, 20Sparrow C.P. Leffler H. Barondes S.H. J. Biol. Chem. 1987; 262: 7383-7390Abstract Full Text PDF PubMed Google Scholar, 21Barondes S.H. Cooper D.N. Gitt M.A. Leffler H. J. Biol. Chem. 1994; 269: 20807-20810Abstract Full Text PDF PubMed Google Scholar, 22Merkle R.K. Cummings R.D. J. Biol. Chem. 1988; 263: 16143-16149Abstract Full Text PDF PubMed Google Scholar). The ability of a terminal SAα2,6Gal sequence to block galectin-1 binding suggested that the addition of α2,6-linked sialic acid to T cell surface glycoproteins (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar) could regulate the susceptibility of thymocytes and T cells to galectin-1. To directly examine whether addition of α2,6-linked sialic acid would affect susceptibility to galectin-1, we expressed the ST6Gal I in the galectin-1-susceptible murine T cell line PhaR2.1. The plant lectin SNA recognizes the SAα2,6Gal sequence (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 23Shibuya N. Goldstein I.J. Broekaert W.F. Nsimba-Lubaki M. Peeters B. Peumans W.J. J. Biol. Chem. 1987; 262: 1596-1601Abstract Full Text PDF PubMed Google Scholar). We used SNA binding, detected by flow cytometry, to screen for clones expressing the ST6Gal I. Two SNA+ clones, SNA.1 and SNA.9, demonstrated increased SNA binding compared with a control clone transfected with vector alone (C.2) (Fig.2 A). Both RT-PCR and immunoblot analysis with anti-ST6Gal I serum demonstrated abundant expression of ST6Gal I mRNA and protein in SNA.9 cells (Fig.2 B) and SNA.1 cells (data not shown), whereas no reactivity was observed in control C.2 cells (Fig. 2 B). ST6Gal I expression did not affect the level of expression of galectin-1 receptors CD43 or CD45 on the SNA.1 and SNA.9 cells, determined by flow cytometric analysis, nor the level of CD7 expression, detected by immunoblotting (data not shown). We then determined whether addition of cell surface sialic acid by the ST6Gal I enzyme would reduce galectin-1 binding to T cells. As shown in Fig. 2 C, galectin-1 binding to the SNA.9 cells (closed circles) was markedly reduced compared with the level of binding observed for the C.2 control cells transfected with vector alone (open circles). However, the reduced, but not absent, binding of galectin-1 to SNA.9 cells indicated that some of the potential binding sites on these cells were not modified by the ST6Gal I enzyme. For both SNA.9 and C.2 cells, galectin-1 binding was completely inhibited in the presence of 100 mm lactose (squares), demonstrating that binding was saccharide-dependent. The SNA.1, SNA.9, and C.2 cells were examined for susceptibility to galectin-1-induced death. As shown in Fig.2 D, the C.2 cells transfected with vector alone were susceptible to galectin-1; ∼50% of the cells underwent cell death, determined by annexin V binding and PI uptake. In contrast, the SNA.1 and SNA.9 cells demonstrated only 10 and 18% galectin-1-induced death, respectively. The resistance of the SNA.1 and SNA.9 cells to galectin-1 did not appear to result from a complete block of galectin-1 binding, as demonstrated by the binding curve in Fig. 2 C; in addition, all of the clones demonstrated cell agglutination when galectin-1 was added, and the cell agglutinates were dispersable by the addition of lactose (data not shown). These data demonstrated that expression of the ST6Gal I, resulting in creation of SAα2,6Gal sequences on cell surface glycoproteins, reduced susceptibility to galectin-1-induced T cell death and suggested that sialylation of specific glycoproteins was responsible for resistance to galectin-1-induced cell death. Our laboratory has demonstrated that the T cell surface glycoproteins CD7, CD43, and CD45 are receptors for galectin-1 (24Pace K.E. Lee C. Stewart P.L. Baum L.G. J. Immunol. 1999; 163: 3801-3811Crossref PubMed Google Scholar). To determine whether these glycoproteins were specifically modified by the ST6Gal I, we examined CD7, CD43, and CD45 for increased sialylation ofN-glycans by SNA and antibody precipitation. Total SNA-binding proteins were precipitated and probed with SNA. As shown in Fig. 3 A, there was only one significant difference in the pattern of SNA-binding glycoproteins precipitated from cells expressing the ST6Gal I (SNA.1) compared with vector-transfected controls (C.2, C.4). In extracts of SNA.1 cells, there was an obvious increase in SNA binding to a band of approximate molecular mass of 200 kDa. Other SNA reactive bands of various sizes were occasionally seen in different experiments (data not shown), but these other bands were not consistently observed. In contrast, the 200-kDa SNA+ band was consistently observed in ST6Gal I-expressing clones. The relative mobility of the 200-kDa band suggested that it could be CD45, a highly glycosylated protein that is known to bear SAα2,6Gal sequences on both murine and human T cells (12Baum L.G. Derbin K. Perillo N.L. Pang M. Wu T. Uittenbogaart C. J. Biol. Chem. 1996; 271: 10793-10799Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 24Pace K.E. Lee C. Stewart P.L. Baum L.G. J. Immunol. 1999; 163: 3801-3811Crossref PubMed Google Scholar). To specifically determine whether the band exhibiting increased SNA binding was CD45, both SNA and CD45 antibody were used to precipitate material from vector transfected (C.4) and SNA.1 cells, and the precipitates were probed with CD45 (Fig. 3 B). The 200-kDa band exhibiting increased SNA binding reacted with CD45 antibody, demonstrating that CD45 was selectively hypersialylated in the SNA.1 cells. In addition, this band migrated with the same mass as immunoprecipitated CD45. To determine whether the increased sialylation of CD45 occurred on N-glycans, the preferred glycan acceptor for the ST6Gal I, SNA.1 cells were pretreated with DMNJ prior to SNA or CD45 precipitation. DMNJ treatment reduced SNA binding to protein precipitated from SNA.1 cells to the level observed for control cells (C.4) transfected with vector alone (Fig. 3 B). PNGase F treatment confirmed that, in cells overexpressing the ST6Gal I, sialic acid addition to CD45 occurred on N-glycans. Whole cell lysates of SNA.9 cells were probed with antibody to CD45. The CD45 bands were excised from the blot and incubated with or without PNGase F, and the bands were reprobed with SNA. As shown in Fig.3 C, PNGase F dramatically reduced SNA binding to CD45 from SNA.9 cells. Thus, the increased SNA binding to CD45 on cells expressing the ST6Gal I resulted from the specific addition of α2,6-linked sialic acid to N-glycans on CD45. The background level of binding of SNA to CD45 on control cells and on DMNJ-treated cells may reflect SNA recognition of SAα2,6GalNAc sequences on O-glycans on CD45 (23Shibuya N. Goldstein I.J. Broekaert W.F. Nsimba-Lubaki M. Peeters B. Peumans W.J. J. Biol. Chem. 1987; 262: 1596-1601Abstract Full Text PDF PubMed Google Scholar). As mentioned above, the three primary receptors for galectin-1 on T cells are CD7, CD43, and CD45 (24Pace K.E. Lee C. Stewart P.L. Baum L.G. J. Immunol. 1999; 163: 3801-3811Crossref PubMed Google Scholar). We specifically precipitated CD7 and CD43 from SNA.9, SNA.1, and C.2 cells and saw no difference in SNA binding to CD7 or CD43 (data not shown), indicating that the inhibitory effect on galectin-1 cell death was not due to sialylation of CD7 or CD43. We also did not detect CD7 or CD43 by immunoblotting SNA precipitates with the respective antibodies (data not shown). To further examine the acceptor substrate preference of the ST6Gal I, we expressed the ST6Gal I in the murine T200− cell line, a mutant of the BW5147 line that does not express CD45. Despite repeated attempts, we could not isolate SNA+ clones from T200− cells transfected with ST6Gal I cDNA (SNA.T1), nor could we detect any increase in SNA binding to whole cell lysates of SNA.T1 cells (Fig. 4, A andB). Although RT-PCR analysis demonstrated that the ST6Gal I mRNA was present in nine independent clones of ST6Gal I transfected T200− cells (Fig. 4 C), every clone was SNA− by flow cytometry (Fig. 4 A). In addition, we detected ST6Gal I protein by immunoblotting in the ST6Gal I transfected T200− cells (Fig. 4 C), although the cells were SNA−. Finally, to confirm that the ST6Gal I expressed in T200− cells was enzymatically active, we used asialofetuin as an acce" @default.
• W2008803062 created "2016-06-24" @default.
• W2008803062 creator A5001614742 @default.
• W2008803062 creator A5032937993 @default.
• W2008803062 creator A5036928260 @default.
• W2008803062 creator A5075010941 @default.
• W2008803062 date "2003-02-01" @default.
• W2008803062 modified "2023-10-08" @default.
• W2008803062 title "The ST6Gal I Sialyltransferase Selectively ModifiesN-Glycans on CD45 to Negatively Regulate Galectin-1-induced CD45 Clustering, Phosphatase Modulation, and T Cell Death" @default.
• W2008803062 cites W1498617433 @default.
• W2008803062 cites W1538147293 @default.
• W2008803062 cites W1541131175 @default.
• W2008803062 cites W1567197932 @default.
• W2008803062 cites W1570727420 @default.
• W2008803062 cites W1598208068 @default.
• W2008803062 cites W1603050454 @default.
• W2008803062 cites W1638424324 @default.
• W2008803062 cites W171613518 @default.
• W2008803062 cites W1964506731 @default.
• W2008803062 cites W1969266059 @default.
• W2008803062 cites W1970697917 @default.
• W2008803062 cites W1975555235 @default.
• W2008803062 cites W1976790385 @default.
• W2008803062 cites W1977130298 @default.
• W2008803062 cites W1985998548 @default.
• W2008803062 cites W1992137936 @default.
• W2008803062 cites W2005119441 @default.
• W2008803062 cites W2007671824 @default.
• W2008803062 cites W2021820035 @default.
• W2008803062 cites W2033211447 @default.
• W2008803062 cites W2036458764 @default.
• W2008803062 cites W2037821829 @default.
• W2008803062 cites W2069079409 @default.
• W2008803062 cites W2080380130 @default.
• W2008803062 cites W2093876508 @default.
• W2008803062 cites W2107812434 @default.
• W2008803062 cites W2111536196 @default.
• W2008803062 cites W2138875176 @default.
• W2008803062 cites W2144218935 @default.
• W2008803062 cites W2148050927 @default.
• W2008803062 cites W2155654394 @default.
• W2008803062 cites W2160077908 @default.
• W2008803062 cites W2165673571 @default.
• W2008803062 cites W2168667586 @default.
• W2008803062 doi "https://doi.org/10.1074/jbc.m209595200" @default.
• W2008803062 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12499376" @default.
• W2008803062 hasPublicationYear "2003" @default.
• W2008803062 type Work @default.
• W2008803062 sameAs 2008803062 @default.
• W2008803062 citedByCount "198" @default.
• W2008803062 countsByYear W20088030622012 @default.
• W2008803062 countsByYear W20088030622013 @default.
• W2008803062 countsByYear W20088030622014 @default.
• W2008803062 countsByYear W20088030622015 @default.
• W2008803062 countsByYear W20088030622016 @default.
• W2008803062 countsByYear W20088030622017 @default.
• W2008803062 countsByYear W20088030622018 @default.
• W2008803062 countsByYear W20088030622019 @default.
• W2008803062 countsByYear W20088030622020 @default.
• W2008803062 countsByYear W20088030622021 @default.
• W2008803062 countsByYear W20088030622022 @default.
• W2008803062 countsByYear W20088030622023 @default.
• W2008803062 crossrefType "journal-article" @default.
• W2008803062 hasAuthorship W2008803062A5001614742 @default.
• W2008803062 hasAuthorship W2008803062A5032937993 @default.
• W2008803062 hasAuthorship W2008803062A5036928260 @default.
• W2008803062 hasAuthorship W2008803062A5075010941 @default.
• W2008803062 hasBestOaLocation W20088030621 @default.
• W2008803062 hasConcept C11960822 @default.
• W2008803062 hasConcept C156293190 @default.
• W2008803062 hasConcept C178666793 @default.
• W2008803062 hasConcept C181199279 @default.
• W2008803062 hasConcept C185592680 @default.
• W2008803062 hasConcept C203014093 @default.
• W2008803062 hasConcept C2776336362 @default.
• W2008803062 hasConcept C2778322149 @default.
• W2008803062 hasConcept C2778735756 @default.
• W2008803062 hasConcept C55493867 @default.
• W2008803062 hasConcept C86803240 @default.
• W2008803062 hasConcept C95444343 @default.
• W2008803062 hasConceptScore W2008803062C11960822 @default.
• W2008803062 hasConceptScore W2008803062C156293190 @default.
• W2008803062 hasConceptScore W2008803062C178666793 @default.
• W2008803062 hasConceptScore W2008803062C181199279 @default.
• W2008803062 hasConceptScore W2008803062C185592680 @default.
• W2008803062 hasConceptScore W2008803062C203014093 @default.
• W2008803062 hasConceptScore W2008803062C2776336362 @default.
• W2008803062 hasConceptScore W2008803062C2778322149 @default.
• W2008803062 hasConceptScore W2008803062C2778735756 @default.
• W2008803062 hasConceptScore W2008803062C55493867 @default.
• W2008803062 hasConceptScore W2008803062C86803240 @default.
• W2008803062 hasConceptScore W2008803062C95444343 @default.
• W2008803062 hasIssue "9" @default.
• W2008803062 hasLocation W20088030621 @default.
• W2008803062 hasOpenAccess W2008803062 @default.
• W2008803062 hasPrimaryLocation W20088030621 @default.
• W2008803062 hasRelatedWork W1836000002 @default.
• W2008803062 hasRelatedWork W1965920153 @default.

• next