FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2008890975> ?p ?o ?g. }

• W2008890975 endingPage "20034" @default.
• W2008890975 startingPage "20028" @default.
• W2008890975 abstract "We have used a combination of kinetic measurements and targeted mutations to show that the C-terminal domain is required for high-affinity binding of histone H1 to chromatin, and phosphorylations can disrupt binding by affecting the secondary structure of the C terminus. By measuring the fluorescence recovery after photo-bleaching profiles of green fluorescent protein-histone H1 proteins in living cells, we find that the deletion of the N terminus only modestly reduces binding affinity. Deletion of the C terminus, however, almost completely eliminates histone H1.1 binding. Specific mutations of the C-terminal domain identified Thr-152 and Ser-183 as novel regulatory switches that control the binding of histone H1.1 in vivo. It is remarkable that the single amino acid substitution of Thr-152 with glutamic acid was almost as effective as the truncation of the C terminus to amino acid 151 in destabilizing histone H1.1 binding in vivo. We found that modifications to the C terminus can affect histone H1 binding dramatically but have little or no influence on the charge distribution or the overall net charge of this domain. A comparison of individual point mutations and deletion mutants, when reviewed collectively, cannot be reconciled with simple charge-dependent mechanisms of C-terminal domain function of linker histones. We have used a combination of kinetic measurements and targeted mutations to show that the C-terminal domain is required for high-affinity binding of histone H1 to chromatin, and phosphorylations can disrupt binding by affecting the secondary structure of the C terminus. By measuring the fluorescence recovery after photo-bleaching profiles of green fluorescent protein-histone H1 proteins in living cells, we find that the deletion of the N terminus only modestly reduces binding affinity. Deletion of the C terminus, however, almost completely eliminates histone H1.1 binding. Specific mutations of the C-terminal domain identified Thr-152 and Ser-183 as novel regulatory switches that control the binding of histone H1.1 in vivo. It is remarkable that the single amino acid substitution of Thr-152 with glutamic acid was almost as effective as the truncation of the C terminus to amino acid 151 in destabilizing histone H1.1 binding in vivo. We found that modifications to the C terminus can affect histone H1 binding dramatically but have little or no influence on the charge distribution or the overall net charge of this domain. A comparison of individual point mutations and deletion mutants, when reviewed collectively, cannot be reconciled with simple charge-dependent mechanisms of C-terminal domain function of linker histones. Histone H1 is the fifth histone subtype and is not one of the histones that form the histone octamer of the nucleosome. Rather, histone H1 binds to the surface of the nucleosome and interacts with nucleosomal DNA at the entry and exit points (1Vignali M. Workman J.L. Nat. Struct. Biol. 1998; 5: 1025-1028Crossref PubMed Scopus (66) Google Scholar, 2Deleted in proofGoogle Scholar). In doing so, histone H1 is critical in determining the higher-order folding states of chromatin. Because of this property, histone H1 has traditionally been considered a general repressor of transcription (3Thomas J.O. Curr. Opin. Cell Biol. 1999; 11: 312-317Crossref PubMed Scopus (179) Google Scholar). Consistent with this hypothesis, histone H1 was found to be modestly depleted in transcriptionally active genes (4Kamakaka R.T. Thomas J.O. EMBO J. 1990; 9: 3997-4006Crossref PubMed Scopus (135) Google Scholar, 5Bresnick E.H. Bustin M. Marsaud V. Richard-Foy H. Hager G.L. Nucleic Acids Res. 1992; 20: 273-278Crossref PubMed Scopus (182) Google Scholar, 6Garrard W.T. Bioessays. 1991; 13: 87-88Crossref PubMed Scopus (44) Google Scholar). More recently, genetic studies have revealed contributions of H1 histones to the establishment of epigenetic silencing (7Jedrusik M.A. Schulze E. Development. 2001; 128: 1069-1080PubMed Google Scholar, 8Gabrilovich D.I. Cheng P. Fan Y. Yu B. Nikitina E. Sirotkin A. Shurin M. Oyama T. Adachi Y. Nadaf S. Carbone D.P. Skoultchi A.I. J. Leukoc. Biol. 2002; 72: 285-296PubMed Google Scholar, 9Jedrusik M.A. Schulze E. Mol. Cell. Biol. 2003; 23: 3681-3691Crossref PubMed Scopus (17) Google Scholar, 10Alami R. Fan Y. Pack S. Sonbuchner T.M. Besse A. Lin Q. Greally J.M. Skoultchi A.I. Bouhassira E.E. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5920-5925Crossref PubMed Scopus (96) Google Scholar). In addition to a structural role, histone H1 also functions in gene-specific regulation. A large number of studies have demonstrated that H1 histones or specific variants are directly involved in the regulation of specific genes (3Thomas J.O. Curr. Opin. Cell Biol. 1999; 11: 312-317Crossref PubMed Scopus (179) Google Scholar, 11Folco H.D. Freitag M. Ramon A. Temporini E.D. Alvarez M.E. Garcia I. Scazzocchio C. Selker E.U. Rosa A.L. Eukaryot. Cell. 2003; 2: 341-350Crossref PubMed Scopus (36) Google Scholar, 12Koop R. Di Croce L. Beato M. EMBO J. 2003; 22: 588-599Crossref PubMed Scopus (66) Google Scholar, 13Takami Y. Nishi R. Nakayama T. Biochem. Biophys. Res. Commun. 2000; 268: 501-508Crossref PubMed Scopus (40) Google Scholar, 14Crane-Robinson C. Bioessays. 1999; 21: 367-371Crossref PubMed Scopus (36) Google Scholar), consistent with the observation of differential gene expression when the sole histone H1 gene was knocked out in Tetrahymena thermophila (15Shen X. Gorovsky M.A. Cell. 1996; 86: 475-483Abstract Full Text Full Text PDF PubMed Scopus (271) Google Scholar).The structure of H1 histones is typically considered to consist of three separate domains (16Allan J. Hartman P.G. Crane-Robinson C. Aviles F.X. Nature. 1980; 288: 675-679Crossref PubMed Scopus (519) Google Scholar). A short stretch of amino acids on the N terminus and a much larger stretch that comprises the C terminus show significant variability between individual subtypes as well as between species. The amino and carboxyl termini have diverged considerably throughout the evolution of metazoans (17Kasinsky H.E. Lewis J.D. Dacks J.B. Ausio J. FASEB J. 2001; 15: 34-42Crossref PubMed Scopus (176) Google Scholar). If we restrict the analysis to mammals, the C termini diverge between individual histone H1 variants, but the sequences of the individual C termini are well conserved between species. When histone H1 sequences are examined in a broader range of species, the centrally located region of the protein, the globular domain, is the most highly conserved region among H1 histone family members (18Ponte I. Vila R. Suau P. Mol. Biol. Evol. 2003; 20: 371-380Crossref PubMed Scopus (33) Google Scholar). The structure of the central region of the protein has been solved by x-ray crystallography (19Ramakrishnan V. Finch J.T. Graziano V. Lee P.L. Sweet R.M. Nature. 1993; 362: 219-223Crossref PubMed Scopus (652) Google Scholar) and is sufficient for binding to the nucleosome in vitro (20Vermaak D. Steinbach O.C. Dimitrov S. Rupp R.A. Wolffe A.P. Curr. Biol. 1998; 8: 533-536Abstract Full Text Full Text PDF PubMed Google Scholar). However, studies with reconstituted systems showed that the C-terminal domain (CTD) 1The abbreviations used are: CTD, C-terminal domain; GFP, green fluorescent protein; FRAP, fluorescence recovery after photobleaching. 1The abbreviations used are: CTD, C-terminal domain; GFP, green fluorescent protein; FRAP, fluorescence recovery after photobleaching. is required to condense chromatin into higher order structures (16Allan J. Hartman P.G. Crane-Robinson C. Aviles F.X. Nature. 1980; 288: 675-679Crossref PubMed Scopus (519) Google Scholar, 23Allan J. Mitchell T. Harborne N. Bohm L. Crane-Robinson C. J. Mol. Biol. 1986; 187: 591-601Crossref PubMed Scopus (259) Google Scholar). This is also consistent with the presence of only C-terminal-like domains in some protists.Because of the high density of positively charged amino acids within the CTD, it is commonly believed that condensation is mediated through charge-neutralization of the negatively charged linker DNA. In a recent study, Lu and Hansen (22Lu X. Hansen J.C. J. Biol. Chem. 2004; 279: 8701-8707Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar) found that the ability of histone H1° to stabilize chromatin folding was not evenly distributed; rather, it was localized to two specific subdomains in the CTD. Because the density of positively charged lysine and arginine amino acids is very similar throughout the ∼100 amino acids of the C terminus, binding does not correlate in a simple manner with the abundance of positively charged amino acids within the domain. Lu and Hansen (22Lu X. Hansen J.C. J. Biol. Chem. 2004; 279: 8701-8707Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar) proposed that histone H1 initially binds with low specificity in a charge-dependent manner. Upon binding to the DNA, the C terminus then acquires secondary structure. This feature of protein folding has been described as “intrinsic disorder.” This mechanism of histone H1 binding contrasts with the binding properties that would be expected if histone H1 were to function according to the “charge patch” hypothesis. The charge patch hypothesis proposes that the clustered positively charged lysines in the C-terminal domain bind DNA and facilitate condensation through neutralization of phosphates on the DNA (24Dou Y. Gorovsky M.A. Mol. Cell. 2000; 6: 225-231Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 25Dou Y. Bowen J. Liu Y. Gorovsky M.A. J. Cell Biol. 2002; 158: 1161-1170Crossref PubMed Scopus (79) Google Scholar). Although this mechanism of binding may apply to the evolutionarily divergent H1 of T. thermophila, recent structural studies of histone H1s from mammals indicate that regions within the C-terminal domain adopt an α-helical structure when associated with DNA (26Vila R. Ponte I. Collado M. Arrondo J.L. Suau P. J. Biol. Chem. 2001; 276: 30898-30903Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 27Vila R. Ponte I. Jimenez M.A. Rico M. Suau P. Protein Sci. 2000; 9: 627-636Crossref PubMed Scopus (41) Google Scholar, 28Vila R. Ponte I. Collado M. Arrondo J.L. Jimenez M.A. Rico M. Suau P. J. Biol. Chem. 2001; 276: 46429-46435Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). Molecular modeling techniques also predict the adoption of secondary structure in the C terminus of histone H1 (21Bharath M.M. Chandra N.R. Rao M.R. Nucleic Acids Res. 2003; 31: 4264-4274Crossref PubMed Scopus (65) Google Scholar). More specifically, the modeling studies reveal that the C terminus may adopt an high mobility group-box-like structure, and that the C terminus SPKK motifs are sites of DNA binding and function in the compaction of the DNA (21Bharath M.M. Chandra N.R. Rao M.R. Nucleic Acids Res. 2003; 31: 4264-4274Crossref PubMed Scopus (65) Google Scholar).We and others have previously used fluorescence recovery after photobleaching (FRAP) to quantify the binding of histone H1 proteins in living cells (29Lever M.A. Th'ng J.P. Sun X. Hendzel M.J. Nature. 2000; 408: 873-876Crossref PubMed Scopus (350) Google Scholar, 30Misteli T. Gunjan A. Hock R. Bustin M. Brown D.T. Nature. 2000; 408: 877-881Crossref PubMed Scopus (512) Google Scholar, 31Contreras A. Hale T.K. Stenoien D.L. Rosen J.M. Mancini M.A. Herrera R.E. Mol. Cell. Biol. 2003; 23: 8626-8636Crossref PubMed Scopus (132) Google Scholar). These studies revealed that histone H1 binds transiently to the chromatin of living cells. In this study, we quantify the specific contributions of the N- and C-terminal domains of histone H1.1 as well as the T/SPXK motifs in the CTD to the in vivo chromatin binding affinity of histone H1. We find that the C-terminal domain of histone H1 plays a major role in defining the affinity of histone H1 binding in vivo.EXPERIMENTAL PROCEDURESCell Culture—SK-N-SH cells were cultured in Dulbecco's modified Eagle's medium in the presence of 10% fetal calf serum. The cells were transfected using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instructions. Cells were selected for stable incorporation of the plasmids by selection for 2 weeks in the presence of G418, and cells that stably expressed the fluorescent histone H1.1 were sorted and used in FRAP studies.FRAP Analyses—Fluorescence recovery after photobleaching was performed using a Zeiss LSM 510 confocal microscope as detailed previously (29Lever M.A. Th'ng J.P. Sun X. Hendzel M.J. Nature. 2000; 408: 873-876Crossref PubMed Scopus (350) Google Scholar). Each experiment shows the results of at least 20 nuclei collected from three separate experiments. The standard deviations are not shown but are typically less than 5% for each time point.Site-directed Mutagenesis—Cloning of histone H1.1 (GenBank accession no. X57130) was described by Lever et al. (29Lever M.A. Th'ng J.P. Sun X. Hendzel M.J. Nature. 2000; 408: 873-876Crossref PubMed Scopus (350) Google Scholar). Mutations of threonine and serine sites on histone H1.1 was performed by sequential PCR as described in the Current Protocols in Molecular Biology. Primers for PCR were synthesized by Sigma Genosys. The sequences of the primers employed to generate mutations were: T152A, CGTCAAGGCTCCGAAAAAGG and CCTTTTTCGGAGCCTTGACGC; T152E, GCGTCAAGGAACCGAAAAAGG and CCTTTTTCGGTTCCTTGACGC; T152K, GCGTCAAGAAACCGAAAAAGG and CCTTTTTCGGTTTCTTGACGC; S183A, GTAGCTAAAGCCCCTGCTAAAGC and GCTTTAGCAGGGGCTTTAGCTAC; S183E, GTAGCTAAAGAACCTGCTAAAGC and GCTTTAGCAGGTTCTTTAGCTAC; and S183K, GTAGCTAAAAAACCTGCTAAAGC and GCTTTAGCAGGTTTTTTAGCTAC. The PCR products were first cloned into pCR2.1 vector using the TA Cloning kit (Invitrogen) and then directionally subcloned into pEGFP-N1 or pEGFP-C1 (BD Biosciences Clontech). Sequencing of PCR products to verify the mutations were performed by Guelph Molecular Supercenter and the Paleo-DNA Laboratory (Lakehead University).RESULTSVariation in Amino Acid Sequence among Human Histone H1 Subtypes—The conserved features of all of the histone H1 variants include: 1) a central domain, 2) a large carboxyl terminus rich in proline, lysine, and arginine, and 3) serine/threonine kinase phosphorylation sites within the carboxyl-terminal domain. The C-terminal domain, which constitutes more than half of the total mass of the H1 protein, accounts for most of the sequence heterogeneity between histone H1 variants (18Ponte I. Vila R. Suau P. Mol. Biol. Evol. 2003; 20: 371-380Crossref PubMed Scopus (33) Google Scholar), and this domain was shown to be essential for high affinity in vivo binding to chromatin (29Lever M.A. Th'ng J.P. Sun X. Hendzel M.J. Nature. 2000; 408: 873-876Crossref PubMed Scopus (350) Google Scholar, 30Misteli T. Gunjan A. Hock R. Bustin M. Brown D.T. Nature. 2000; 408: 877-881Crossref PubMed Scopus (512) Google Scholar). Fig. 1 shows the amino acid alignment of the C-terminal domains of individual histone H1 subtypes of human and mouse. Each subtype has multiple cyclin-dependent kinase-specific motifs, up to five in histones H1.4 and H1.5 (four in the C-terminal tail and one at the N terminus). The specific lysines predicted to bind and compact the “linker” DNA (21Bharath M.M. Chandra N.R. Rao M.R. Nucleic Acids Res. 2003; 31: 4264-4274Crossref PubMed Scopus (65) Google Scholar) are highlighted in green.To define the role of phosphorylation in regulating histone H1 binding in vivo, we chose to examine histone H1.1 (also named histone H1a and histone H1S5 (32Parseghian M.H. Hamkalo B.A. Biochem. Cell Biol. 2001; 79: 289-304Crossref PubMed Scopus (106) Google Scholar)). This H1 subtype has only two C-terminal cyclin-dependent kinase-specific sites, which reduces the complexity of determining the effects of phosphorylation on histone H1 binding to chromatin binding in vivo. Recent studies of rat histone H1d binding to chromatin in vitro (33Bharath M.M. Ramesh S. Chandra N.R. Rao M.R. Biochemistry. 2002; 41: 7617-7627Crossref PubMed Scopus (42) Google Scholar) and a number of recent structural and molecular modeling studies now predict that the C-terminal domain of histone H1 is structured when bound to DNA and chromatin (26Vila R. Ponte I. Collado M. Arrondo J.L. Suau P. J. Biol. Chem. 2001; 276: 30898-30903Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 27Vila R. Ponte I. Jimenez M.A. Rico M. Suau P. Protein Sci. 2000; 9: 627-636Crossref PubMed Scopus (41) Google Scholar). The lysines predicted by molecular modeling (21Bharath M.M. Chandra N.R. Rao M.R. Nucleic Acids Res. 2003; 31: 4264-4274Crossref PubMed Scopus (65) Google Scholar) to interact with the DNA within the chromatosome are highlighted as red dots in Fig. 1. In this instance, the Thr-152 site aligns with a conserved TPKK site in which both lysines are predicted to binding extranucleosomal DNA. The conserved SPAK site at Ser-183 in histone H1.1 is four amino acids away from the last two lysines mapped as DNA contacts in the molecular model. If histone H1 adopts a more structured C terminus, the phosphorylation of either or both sites within the C terminus of histone H1.1 may have a much greater impact on histone H1 binding in vivo. The substantial increase in histone H1.1 residency time on chromatin after treatment with the general kinase inhibitor, staurosporine, is consistent with a phosphorylation-dependent destabilization of chromatin binding in living cells (29Lever M.A. Th'ng J.P. Sun X. Hendzel M.J. Nature. 2000; 408: 873-876Crossref PubMed Scopus (350) Google Scholar). To address these unresolved questions related to histone H1 structure and function, we designed experiments to further define the specific contributions of individual regions of histone H1 protein to chromatin binding in living cells.C-terminal GFP Fusion Reduces the Affinity of Histone H1 Binding—Fluorescence recovery after photobleaching was used to measure the binding affinity of green fluorescent protein (GFP)-tagged histone H1 bound to chromatin in living cells. We began by measuring the fluorescence recovery rates of histones containing N- or C-terminal tails modified by fusion to GFP and by introducing specific deletions. Fig. 2 shows the relative recovery rates of GFP-tagged histone H1.1 protein stably expressed in SK-N-SH neuroblastoma cells. The two full-length forms of histone H1.1 bound with the highest affinity to the endogenous chromatin. However, when the GFP tag was placed on the C terminus, the recovery rate was faster than when the tag was at the N terminus. The reduction of binding caused by the C-terminal fusion was almost as great as that seen when the N-terminal domain was deleted. Deletion of the N terminus significantly reduced the binding affinity of the histone H1.1; the C-terminal placement of the GFP bound with a lower affinity than that obtained when the GFP was placed at the N terminus. When staurosporine was added to inhibit kinase activity, the recovery time was increased by about 2-fold (see also Fig. 5). When the C terminus was deleted, the GFP-histone H1.1 deletion protein did not bind well and recovered at rates approaching diffusion. Based on these findings, subsequent studies were done with the histone H1.1 cloned into pEGFP-C1, placing the GFP at the N terminus to minimize possible interference.Fig. 2Influence of flanking domains on the relative rates of recovery of histone H1.1. Individual constructs of GFP-tagged histone H1.1 were transfected into SK-N-SH cells, and stable transfectants were used to measure fluorescence recovery after photobleaching (FRAP) of the fluorescent histone. The time in seconds required to achieve 50% fluorescence recovery (T(1/2)) was plotted in the presence and absence of staurosporine. Constructs of histone H1.1 employed in the study had the GFP fused at either the N terminus (gfpH1.1) or the C terminus (H1.1gfp). H1.1DCgfp, histone H1, where histone H1.1 has its CTD replaced by the green fluorescent protein; gfpH1.1DC, histone H1 with the GFP fused to the N terminus of a histone H1.1 construct with the C terminus deleted; DNH1.1gfp, histone H1.1 with a deleted N terminus and the GFP fused to the C terminus; GfpDNH1.1, histone H1.1 with its N terminus replaced by the GFP.View Large Image Figure ViewerDownload (PPT)Fig. 5The effect of double mutations to alanine or glutamic acid on histone H1.1 mobility. FRAP measurements of the mobility of histone H1.1 containing Thr-152 and Ser-183 mutated to either glutamic acid (T152ES183E) or alanine (T152AS183A). The plot shows the relative recovery of fluorescence versus time after photobleaching for each mutant. The full-length histone H1.1 is included as a reference for evaluating relative mobilities.View Large Image Figure ViewerDownload (PPT)FRAP Analysis of C-terminal Deletions of Histone H1.1—To further define the contribution of the C terminus to histone H1.1 binding in vivo, we initiated a series of FRAP experiments to quantitatively define the contributions of the two C-terminal phosphorylation sites. Within this C-terminal region of histone H1.1, there reside two S/TPXK sites that are phosphorylated by cyclin-dependent kinases (34Hill C.S. Rimmer J.M. Green B.N. Finch J.T. Thomas J.O. EMBO J. 1991; 10: 1939-1948Crossref PubMed Scopus (90) Google Scholar). These motifs are of particular interest because the commonly repeated sequence SPKK is known to bind DNA in vitro (35Suzuki M. EMBO J. 1989; 8: 797-804Crossref PubMed Scopus (202) Google Scholar). The possibility that these motifs might be ideally positioned to play a critical role in both DNA binding and histone H1-dependent condensation of the chromatin can be inferred from computational predictions of the structure of both the C-terminal domain in association with DNA and the C-terminal domain positioned within the chromatosome (21Bharath M.M. Chandra N.R. Rao M.R. Nucleic Acids Res. 2003; 31: 4264-4274Crossref PubMed Scopus (65) Google Scholar, 33Bharath M.M. Ramesh S. Chandra N.R. Rao M.R. Biochemistry. 2002; 41: 7617-7627Crossref PubMed Scopus (42) Google Scholar, 36Bharath M.M. Chandra N.R. Rao M.R. Proteins. 2002; 49: 71-81Crossref PubMed Scopus (33) Google Scholar).We first examined the contributions of the individual regions of the C-terminal tail using partial deletion mutants of human histone H1.1. Deletion of amino acids 183–214 resulted in a protein that has reduced binding affinity and allows the photobleached region to be replaced in approximately half the time (Fig. 3B), showing that this terminal region of the CTD contributes to the binding to chromatin. Further C-terminal deletions up to lysine 151 resulted in a protein that bound to chromatin with much less affinity and recovered in less than 10% of the time required for the full-length protein (Fig. 3B). When these recovery curves were re-plotted using the log of time of recovery, the largest deletion had a recovery profile that presented as a straight line (Fig. 3C). In contrast, both the 183 deletion and the full-length protein resolved into two kinetic populations in these plots. This may reflect the kinetic footprints of two distinct binding events involved in stabilizing the association of the globular domain with the surface of the nucleosome.Fig. 3Reduction in chromatin binding of histone H1.1 with truncated CTD. A, sequence alignment of the C-terminal regions of rat histone H1d and human histone H1.1. The lysines highlighted in yellow are predicted to make specific contacts with the DNA. The motifs highlighted in green represent the conserved phosphorylation sequences, except for the conserved SPAK site, which is highlighted in blue. The position of an additional lysine predicted in the histone H1d chromatosome model to specifically contact the DNA is highlighted in red. B, FRAP recovery curves obtained from cells stably transfected with full-length histone H1.1 or histone H1.1 containing deletions up to and including the phosphorylation sites at Thr-152 (Del152) and Ser183 (Del183). The plot shows the relative recovery of fluorescence in the photobleached region versus time. C, the data from B is re-plotted versus the log of time. The error bars show 1 S.D.View Large Image Figure ViewerDownload (PPT)Glutamic Acid Mutation of Thr-152 and Ser-183—Although the deletion analyses showed that the regions from Thr-152 and Ser-183 to the end of the C-terminal domain augment the binding of histone H1.1 in vivo, they did not reveal the roles that the cyclin-dependent kinase-dependent phosphorylation sites may play in chromatin binding. To assess the specific contributions of phosphorylation of each of these sites, we generated GFP-histone H1.1 hybrid proteins in which the Thr-152 was switched to Glu-152 or the Ser-183 was switched to Glu-183. These substitutions introduce negative charges to mimic phosphorylation at these sites.Fig. 4 shows the results of FRAP experiments performed on cells stably expressing these mutated histone H1.1 proteins. The results show that either mutation has a significant effect on binding of the histone H1.1 protein to chromatin. The recovery profiles of the deletion mutants are included in this graph to contrast the magnitude of the change in binding relative to the change seen in the deletion mutants. Mutation of Ser-183 to glutamic acid produced binding properties very similar to those of the mutant that was truncated at this same site. This suggests that this SPAK motif, which was not implicated in DNA binding according to the molecular modeling predictions of Bharath et al. (21Bharath M.M. Chandra N.R. Rao M.R. Nucleic Acids Res. 2003; 31: 4264-4274Crossref PubMed Scopus (65) Google Scholar), is located in a region in which a phosphorylation event will disrupt DNA binding of the lysines that are C-terminal to Ser-183. The insertion of a glutamic acid in position 152 has a much greater effect on the affinity of histone H1.1 binding in vivo than does the Ser-183. It is notable that the replacement of Thr-152 with glutamic acid destabilizes histone H1.1 binding more than truncation of the C terminus at Lys-182, which deletes 12 lysines and an arginine.Fig. 4The effects of glutamic acid substitutions at positions 152 and 183 of the H1.1 C terminus. Histone H1.1 constructs that contain either a single glutamic acid substitution of Thr-152 (T152E) or a single glutamic acid substitution of Ser-183 (S183E) were stably expressed in SK-N-SH cells, and the mobility was then measured using FRAP. The recovery profiles of the histone H1.1 constructs containing the corresponding C-terminal deletions are included for comparison.View Large Image Figure ViewerDownload (PPT)The Effects of Other Point Mutations of Thr-152 and Ser-183 on Histone H1.1 Binding—To further evaluate the contribution of these phosphorylated amino acids in the binding of histone H1.1 in vivo, we generated double glutamic acid and double alanine mutants. Fig. 5 shows the recovery profiles of Thr-152 and Ser-183 mutated to either glutamic acid or alanine. For comparison, the single point mutations to glutamic acid are also shown in this plot. It is remarkable that the mutation of both amino acids to glutamic acid generated a histone H1.1 protein with a FRAP recovery profile almost identical to that of the single glutamic acid substitution at amino acid position 152.The mutation of Thr-152 and Ser-183 to alanines would prevent phosphorylation, and this would reduce the mobility of histone H1.1, if phosphorylation merely functions to disrupt binding by charge repulsion. When the recovery profile of histone H1 containing double alanine mutations was determined, we observed a destabilization of histone H1.1 binding in vivo relative to the wild-type histone H1. The resulting mutated histone H1.1 has a binding affinity that is midway between the Ser-183 glutamic acid (S183E) mutant and the parent histone H1.1 protein.Lysine Substitutions of Thr-152 and Ser-183 Increase the Stability of Binding of Histone H1.1—To determine whether the addition of more positive charges to the highly basic C terminus had a direct influence on the binding of histone H1.1 to chromatin in living cells, we substituted Thr-152 or Ser-183 with lysines and measured the binding affinities of these mutant histone H1.1 proteins. Fig. 6 shows that the introduction of a lysine at either position increased the stability of histone H1.1 binding in vivo. This is consistent with the idea that overall net positive charge of these regions is important in regulating histone H1.1 binding. However, when both positions are mutated, the resulting protein bound with lower affinity than either single mutation alone.Fig. 6The effect of lysine substitutions at positions 152 and 183 on histone H1.1 mobility. Histone H1.1 constructs with mutations that converted either Thr-152 (T152K), Ser-183 (S183K), or both amino acids (T152KS183K) to lysines were stably expressed in human SK-N-SH cells, and their mobility was examined by FRAP. The plot shows the relative recovery versus time in seconds after photobleaching.View Large Image Figure ViewerDownload (PPT)DISCUSSIONUntil the recent development of fluorescence-tagged proteins for use in FRAP, studies relating functions to the structure of histone H1 in chromatin had been limited to in vitro reconstituted systems. Using GFP-tagged histone H1.1 and its mutated variants, we have defined the contribution of the amino- and carboxyl-terminal tail domains to the binding of histone H1.1 to chromatin in living cells. The principal conclusio" @default.
• W2008890975 created "2016-06-24" @default.
• W2008890975 creator A5034560773 @default.
• W2008890975 creator A5037715725 @default.
• W2008890975 creator A5065477061 @default.
• W2008890975 creator A5073472372 @default.
• W2008890975 date "2004-05-01" @default.
• W2008890975 modified "2023-10-16" @default.
• W2008890975 title "The C-terminal Domain Is the Primary Determinant of Histone H1 Binding to Chromatin in Vivo" @default.
• W2008890975 cites W1568313174 @default.
• W2008890975 cites W1572088192 @default.
• W2008890975 cites W1897686051 @default.
• W2008890975 cites W1971238108 @default.
• W2008890975 cites W1975239693 @default.
• W2008890975 cites W1978607217 @default.
• W2008890975 cites W1981417999 @default.
• W2008890975 cites W1981831332 @default.
• W2008890975 cites W1987804879 @default.
• W2008890975 cites W1993633154 @default.
• W2008890975 cites W1998659546 @default.
• W2008890975 cites W2003727007 @default.
• W2008890975 cites W2004202908 @default.
• W2008890975 cites W2016925279 @default.
• W2008890975 cites W2029199250 @default.
• W2008890975 cites W2032970638 @default.
• W2008890975 cites W2046615335 @default.
• W2008890975 cites W2056447070 @default.
• W2008890975 cites W2058448711 @default.
• W2008890975 cites W2063433107 @default.
• W2008890975 cites W2071478793 @default.
• W2008890975 cites W2074602883 @default.
• W2008890975 cites W2078943658 @default.
• W2008890975 cites W2084634779 @default.
• W2008890975 cites W2087736942 @default.
• W2008890975 cites W2128240046 @default.
• W2008890975 cites W2132152323 @default.
• W2008890975 cites W2145543625 @default.
• W2008890975 cites W2148347504 @default.
• W2008890975 cites W2152703461 @default.
• W2008890975 cites W2155905761 @default.
• W2008890975 cites W2162105808 @default.
• W2008890975 cites W2164433039 @default.
• W2008890975 cites W2187574057 @default.
• W2008890975 cites W3164715 @default.
• W2008890975 cites W4313133073 @default.
• W2008890975 cites W86385217 @default.
• W2008890975 doi "https://doi.org/10.1074/jbc.m400070200" @default.
• W2008890975 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14985337" @default.
• W2008890975 hasPublicationYear "2004" @default.
• W2008890975 type Work @default.
• W2008890975 sameAs 2008890975 @default.
• W2008890975 citedByCount "205" @default.
• W2008890975 countsByYear W20088909752012 @default.
• W2008890975 countsByYear W20088909752013 @default.
• W2008890975 countsByYear W20088909752014 @default.
• W2008890975 countsByYear W20088909752015 @default.
• W2008890975 countsByYear W20088909752016 @default.
• W2008890975 countsByYear W20088909752017 @default.
• W2008890975 countsByYear W20088909752018 @default.
• W2008890975 countsByYear W20088909752019 @default.
• W2008890975 countsByYear W20088909752020 @default.
• W2008890975 countsByYear W20088909752021 @default.
• W2008890975 countsByYear W20088909752022 @default.
• W2008890975 countsByYear W20088909752023 @default.
• W2008890975 crossrefType "journal-article" @default.
• W2008890975 hasAuthorship W2008890975A5034560773 @default.
• W2008890975 hasAuthorship W2008890975A5037715725 @default.
• W2008890975 hasAuthorship W2008890975A5065477061 @default.
• W2008890975 hasAuthorship W2008890975A5073472372 @default.
• W2008890975 hasBestOaLocation W20088909751 @default.
• W2008890975 hasConcept C101152365 @default.
• W2008890975 hasConcept C185592680 @default.
• W2008890975 hasConcept C207001950 @default.
• W2008890975 hasConcept C2779664074 @default.
• W2008890975 hasConcept C41008148 @default.
• W2008890975 hasConcept C54355233 @default.
• W2008890975 hasConcept C552990157 @default.
• W2008890975 hasConcept C55493867 @default.
• W2008890975 hasConcept C64927066 @default.
• W2008890975 hasConcept C76155785 @default.
• W2008890975 hasConcept C83640560 @default.
• W2008890975 hasConcept C86803240 @default.
• W2008890975 hasConcept C95444343 @default.
• W2008890975 hasConceptScore W2008890975C101152365 @default.
• W2008890975 hasConceptScore W2008890975C185592680 @default.
• W2008890975 hasConceptScore W2008890975C207001950 @default.
• W2008890975 hasConceptScore W2008890975C2779664074 @default.
• W2008890975 hasConceptScore W2008890975C41008148 @default.
• W2008890975 hasConceptScore W2008890975C54355233 @default.
• W2008890975 hasConceptScore W2008890975C552990157 @default.
• W2008890975 hasConceptScore W2008890975C55493867 @default.
• W2008890975 hasConceptScore W2008890975C64927066 @default.
• W2008890975 hasConceptScore W2008890975C76155785 @default.
• W2008890975 hasConceptScore W2008890975C83640560 @default.
• W2008890975 hasConceptScore W2008890975C86803240 @default.
• W2008890975 hasConceptScore W2008890975C95444343 @default.
• W2008890975 hasIssue "19" @default.
• W2008890975 hasLocation W20088909751 @default.

• next