SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2009074737> ?p ?o ?g. }

Showing items 1 to 89 of 89 with 100 items per page.

W2009074737 endingPage "34138" @default.
W2009074737 startingPage "34134" @default.
W2009074737 abstract "The interaction between bovine pancreatic ribonuclease A (RNase A) and its RNA substrate extends beyond the scissile bond. Enzymic subsites interact with the bases and the phosphoryl groups of a bound substrate. We evaluated the four cationic residues closest to known subsites for their abilities to interact with a bound nucleic acid. Lys-37, Arg-39, Arg-85, and Lys-104 were replaced individually by an alanine residue, and the resulting enzymes were assayed as catalysts of poly(cytidylic acid) (poly(C)) cleavage. The values of K m andk cat/K m for poly(C) cleavage were affected only by replacing Arg-85. Moreover, the contribution of Arg-85 to the binding of the ground state and the transition state was uniform—K m increased by 15-fold and k cat/K mdecreased by 10-fold. The contribution of Arg-85 to binding was also apparent in the values of K d for complexes with oligonucleotides of different length. This contribution was dependent on salt concentration, as expected from a coulombic interaction between a cationic side chain and an anionic phosphoryl group. Together, these data indicate that Arg-85 interacts with a particular phosphoryl group of a bound nucleic acid. We propose that Arg-85 comprises a new distal subsite in RNase A—the P(−1) subsite. The interaction between bovine pancreatic ribonuclease A (RNase A) and its RNA substrate extends beyond the scissile bond. Enzymic subsites interact with the bases and the phosphoryl groups of a bound substrate. We evaluated the four cationic residues closest to known subsites for their abilities to interact with a bound nucleic acid. Lys-37, Arg-39, Arg-85, and Lys-104 were replaced individually by an alanine residue, and the resulting enzymes were assayed as catalysts of poly(cytidylic acid) (poly(C)) cleavage. The values of K m andk cat/K m for poly(C) cleavage were affected only by replacing Arg-85. Moreover, the contribution of Arg-85 to the binding of the ground state and the transition state was uniform—K m increased by 15-fold and k cat/K mdecreased by 10-fold. The contribution of Arg-85 to binding was also apparent in the values of K d for complexes with oligonucleotides of different length. This contribution was dependent on salt concentration, as expected from a coulombic interaction between a cationic side chain and an anionic phosphoryl group. Together, these data indicate that Arg-85 interacts with a particular phosphoryl group of a bound nucleic acid. We propose that Arg-85 comprises a new distal subsite in RNase A—the P(−1) subsite. bovine pancreatic ribonuclease A anisotropy fluorescein 2-(N-morpholino)ethanesulfonic acid poly(cytidylic acid) temperature at the midpoint of a thermal denaturation curve. The efficiency of enzymatic catalysts is a source of continued interest and inspiration as molecular scientists strive to design new catalysts. A distinguishing characteristic of enzymic catalysts is that they bind to their substrates (1Jencks W.P. Catalysis in Chemistry and Enzymology. McGraw-Hill, New York1969Google Scholar, 2Hansen D.E. Raines R.T. J. Chem. Educ. 1990; 67: 483-489Crossref Scopus (22) Google Scholar). Binding energy is necessary to compensate for the loss of translational and rotational entropy and for any destabilization of the substrate required to reach the transition state (3Page M.I. Angew. Chem. Int. Ed. Engl. 1977; 16: 449-459Crossref Scopus (153) Google Scholar, 4Jencks W.P. Proc. Natl. Acad. Sci U. S. A. 1981; 78: 4046-4050Crossref PubMed Scopus (848) Google Scholar). Multivalent contacts between an enzyme and substrate provide much of this required binding energy. Indeed, many enzymes that cleave polymeric substrates have subsites that interact with monomeric units of the substrate. Bovine pancreatic ribonuclease A (RNase A;1 EC 3.1.27.5) is a classic model for revealing the physical, chemical, and biological properties of enzymes (5Cuchillo C.M. Vilanova M. Nogués M.V. D'Alessio G. Riordan J.F. Ribonucleases: Structures and Functions. Academic Press, New York1997: 271-304Crossref Google Scholar, 6Raines R.T. Chem. Rev. 1998; 98: 1045-1065Crossref PubMed Scopus (866) Google Scholar). RNase A is a 13.7-kDa endoribonuclease that binds RNA in a cationic cleft and cleaves on the 3′-side of pyrimidine residues. The cleft contains subsites (B1, B2, and B3) that interact specifically with bases and subsites (P0, P1, and P2) that interact with phosphoryl groups (7Nogués M.V. Vilanova M. Cuchillo C.M. Biochim. Biophys. Acta. 1995; 1253: 16-24Crossref PubMed Scopus (80) Google Scholar, 8Nogués M.V. Moussaoui M. Boix E. Vilanova M. Ribó M. Cuchillo C.M. Cell. Mol. Life Sci. 1998; 54: 766-774Crossref PubMed Scopus (46) Google Scholar). The specificity of RNase A for pyrimidine bases is because of exclusion of the larger purine bases from the B1 subsite (9delCardayré S.B. Raines R.T. Biochemistry. 1994; 33: 6031-6037Crossref PubMed Scopus (110) Google Scholar). The B2 and B3 subsites prefer to bind purine bases. His-12, His-119, and Lys-41 of the P1 subsite are the residues most central to the catalytic function of the enzyme. The amino acid residues that comprise the P0 (Lys-66) and P2 (Lys-7 and Arg-10) subsites increase the affinity with which the substrate binds to the enzyme and participate indirectly in catalysis (10Boix E. Nogués M.V. Schein C.H. Benner S.A. Cuchillo C.M. J. Biol. Chem. 1994; 269: 2529-2534Abstract Full Text PDF PubMed Google Scholar, 11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar, 12Fisher B.M. Schultz L.W. Raines R.T. Biochemistry. 1998; 37 (in press)Google Scholar). Some data portend the existence of additional RNase A binding sites beyond those characterized previously. Three-dimensional structures derived from x-ray diffraction analyses reveal a line of cationic residues stretching well beyond the active site and known subsites (13McPherson A. Brayer G. Cascio D. Williams R. Science. 1986; 232: 765-768Crossref PubMed Scopus (66) Google Scholar) (Fig. 1). In addition, cation titration suggests that RNase A can occlude eleven nucleotides of a single-stranded nucleic acid (16Jensen D.E. von Hippel P.H. J. Biol. Chem. 1976; 251: 7198-7214Abstract Full Text PDF PubMed Google Scholar) and that binding involves seven coulombic interactions (17Record Jr., M.T. Lohman T.M. De Haseth P. J. Mol. Biol. 1976; 107: 145-158Crossref PubMed Scopus (931) Google Scholar). Here, we search for additional RNase A subsites that interact with bound substrates. We determine the steady-state kinetic parameters for RNA cleavage by the wild-type enzyme and variants in which Lys-37, Arg-39, Arg-85, and Lys-104 are replaced individually by an alanine residue. We also dissect the role of Arg-85 in nucleic acid binding by comparing the affinity of different oligonucleotides for wild-type RNase A and the R85A variant. The results enable us to define a new subsite that interacts with a particular phosphoryl group of a bound nucleic acid. All Escherichia coli strains, plasmids, enzymes, and reagents were obtained as described elsewhere (11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar). Ultraviolet and visible absorbance measurements were made with a Cary Model 3 spectrophotometer equipped with a Cary temperature controller from Varian (Sugar Land, TX). RNase A concentrations were determined by assuming that ε0.1%= 0.72 at 277.5 nm (18Sela M. Anfinsen C.B. Harrington W.F. Biochim. Biophys. Acta. 1957; 26: 502-512Crossref PubMed Scopus (98) Google Scholar). An electrostatic surface potential map created from a crystalline structure of wild-type RNase A (Brookhaven National Laboratory Protein Data Bank entry 1RPH, Ref.19) highlights the cationic cleft in the enzyme that interacts with a bound nucleic acid (Fig. 1). The active site of the enzyme comprises His-12, His-119, and Lys-41 (and also known as the P1 subsite) and is located in the center of the cleft. The cationic residues that reside closest to the active site are Lys-7 and Arg-10 (P2 subsite) on one side and Lys-66 (the P0 subsite) on the other side. The roles of Lys-7, Arg-10, and Lys-66 have been characterized in detail (11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar, 12Fisher B.M. Schultz L.W. Raines R.T. Biochemistry. 1998; 37 (in press)Google Scholar). Arg-85 and Lys-104 are the next closest cationic residues to Lys-66, and Lys-37 and Arg-39 are the next closest cationic residues to Lys-7 and Arg-10. Hence, we reasoned that one or more of these residues could play a role in catalysis by RNase A. To test this hypothesis, we created variants of RNase A in which Lys-37, Arg-39, Arg-85, and Lys-104 were substituted individually with an alanine residue. pBXR is a plasmid that directs the expression of wild-type RNase A in E. coli (20delCardayré S.B. Ribó M. Yokel E.M. Quirk D.J. Rutter W.J. Raines R.T. Protein Eng. 1995; 8: 261-273Crossref PubMed Scopus (139) Google Scholar). Oligonucleotide-mediated site-directed mutagenesis (21Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4560) Google Scholar) was performed on single-stranded pBXR isolated from E. coli strain CJ236. To produce DNA coding for the K37A, R39A, R85A, and K104A variants, the codon for lysine or arginine was replaced with one for alanine (reverse complement in bold; new restriction endonuclease sites underlined) using oligonucleotides: JG5, CACTGGCTTGCAACGATCCGCGGTCAGGTTCCG; JG1, CACTGGC TTGCATGCTTTGGTCAGG; JG4, GGGGTACTTGGAGGATCCGGTCTCCGCGCAGTCGGTG; and JG3, GTTTCCCTCGCATGCCACATTGATGTGGGCATTCGCCTG, respectively. Mutagenesis reactions were transformed into competent DH5α cells, and cDNA sequences from isolated transformants were determined with an ABI 373 automated sequencer. Wild-type RNase A and the K37A, R39A, R85A, and K104A variants were produced in E. coli strain BL21(DE3) as described elsewhere (11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar). Peak symmetry on chromatography elution profiles, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, andA 280/A 260 ratios greater than 1.8 indicated that the proteins were >99% pure. Purified proteins were dialyzed exhaustively against H2O, lyophilized, and stored at −70 °C. Stabilities of the wild-type and variant proteins were determined by thermal denaturation studies in 0.10 m MES-NaOH buffer, pH 6.0, as described elsewhere (22Eberhardt E.S. Wittmayer P.K. Templer B.M. Raines R.T. Protein Sci. 1996; 5: 1697-1703Crossref PubMed Scopus (37) Google Scholar). Spectrophotometric assays were used to determine steady-state kinetic parameters for the cleavage of poly(C). The Δε for this reaction is 2380m−1 cm−1 at 250 nm (9delCardayré S.B. Raines R.T. Biochemistry. 1994; 33: 6031-6037Crossref PubMed Scopus (110) Google Scholar). Concentrations of poly(C) were determined by assuming that ε = 6200m−1 cm−1 per nucleotide at 268 nm (23Yakovlev G.I. Moiseyev G.P. Bezborodova S.I. Both V. Sevcik J. Eur. J. Biochem. 1992; 204: 187-190Crossref PubMed Scopus (23) Google Scholar). Assays were performed at 25 °C in 0.10 m MES-NaOH buffer, pH 6.0, containing NaCl (0.10 m), poly(C) (30 μm −1.6 mm), and enzyme (0.75 pm−3.1 nm). Values of k cat,K m, andk cat/K m were determined from initial velocity data with the program HYPERO (24Cleland W.W. Methods Enzymol. 1979; 63: 103-138Crossref PubMed Scopus (1929) Google Scholar). Fluorescence anisotropy assays were used to quantitate the binding of single-stranded DNA to wild-type RNase A and the R85A variant. DNA is a useful analog of RNA because RNase A binds to but does not cleave DNA (25Walz F.G. Biochemistry. 1971; 10: 2156-2162Crossref PubMed Scopus (18) Google Scholar). Fluorescein (Fl), incorporated during the final coupling step of DNA synthesis, was attached to the 5′-end of two oligonucleotides via a six-carbon spacer. These oligonucleotides, Fl∼d(AUAA) and Fl∼d(UAA), were designed to test for the existence of an additional phosphoryl group subsite on the 5′-side of the scissile bond (SchemeFS1). Fluorescein-labeled oligonucleotides were obtained in purified, desalted form from Promega. The oligonucleotide concentrations were determined by assuming that ε = 66250 m−1cm−1 at 260 nm for Fl∼d(AUAA) and ε = 60300m−1 cm−1 at 260 nm for Fl∼d(UAA) (26Wallace R.B. Miyada C.G. Methods Enzymol. 1987; 152: 432-442Crossref PubMed Scopus (134) Google Scholar). Fluorescence anisotropy was measured at room temperature (23 ± 2 °C) in 0.020 m MES-NaOH buffer, pH 6.0, containing NaCl (0.025 m) and oligonucleotide (2.5 nm) on a Beacon Fluorescence Polarization System (Panvera, Madison, WI) as described elsewhere (11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar). Data were fitted to Eq. 5 of Ref. 11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar to obtain values of K d. Steady-state kinetic parameters for the cleavage of poly(C) by wild-type RNase A and the K37A, R39A, R85A, and K104A variants are listed in Table I. Also listed in this table are the values of T m for the five proteins. These values indicate that the kinetic parameters determined at 25 °C are indeed those of the native proteins.Table ISteady-state kinetic parameters for the cleavage of poly(cytidylic acid) by wild-type ribonuclease AaData from Ref. 11., K37A ribonuclease A, R39A ribonuclease A, R85A ribonuclease A, and K104A ribonuclease AbData were obtained at 25 °C in 0.10 mMES-NaOH buffer, pH 6.0, containing NaCl (0.10 m), enzyme (0.75–3.1 nm), and poly(C) (30 μm–1.6 mm).Ribonuclease A (Tm)cValues of T m are reported ± 2 °C.k catK Mk cat/K M° Cs−1mm106m−1Wild Type (62)507 ± 150.089 ± 0.0095.7 ± 0.5K37A (61)539 ± 100.071 ± 0.0047.6 ± 0.4R39A (62)541 ± 280.096 ± 0.0025.7 ± 1.1R85A (62)659 ± 801.42 ± 0.300.46 ± 0.04K104A (62)281 ± 50.042 ± 0.0046.4 ± 0.5a Data from Ref. 11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar.b Data were obtained at 25 °C in 0.10 mMES-NaOH buffer, pH 6.0, containing NaCl (0.10 m), enzyme (0.75–3.1 nm), and poly(C) (30 μm–1.6 mm).c Values of T m are reported ± 2 °C. Open table in a new tab Of the four residues investigated in this study, Arg-85 has the most dramatic effect on the kinetic parameters for the cleavage of poly(C). The k cat value is similar to that of the wild-type enzyme, but the K m value differs dramatically, being >15-fold higher than that for the wild-type enzyme. The value of k cat/K mfor poly(C) cleavage by R85A RNase A is 10-fold lower than that for the wild-type enzyme. Replacing Lys-37, Arg-39, or Lys-104 with alanine has little change on the kinetic parameters for cleavage of poly(C). Thek cat, K m, andk cat/K m values for poly(C) cleavage by K37A RNase A and R39A RNase A are virtually indistinguishable from those of wild-type RNase A. Thek cat and K m values for poly(C) cleavage by K104A RNase A are both 2-fold lower than those for the wild-type enzyme, and thek cat/K m value is similar. The specific interaction between Arg-85 and single-stranded DNA was evaluated by fluorescence anisotropy assays. These assays employed two fluorescein-labeled DNA oligonucleotides that differ only by an adenosine 5′-phosphate. The ligands, Fl∼d(UAA) and Fl∼d(AUAA), were modeled after d(ATAAG), which forms a complex with known three-dimensional structure (PDB entry 1RCN; Ref. 15Fontecilla-Camps J.C. de Llorens R. le Du M.H. Cuchillo C.M. J. Biol. Chem. 1994; 269: 21526-21531Abstract Full Text PDF PubMed Google Scholar). The single pyrimidine in d(ATAAG) (and presumably in Fl∼d(UAA) and Fl∼d(AUAA)) binds to RNase A specifically in the B1 subsite. Data for the binding of Fl∼d(UAA) and Fl∼d(AUAA) to wild-type RNase A is shown in Fig. 2 A. Data for the binding of Fl∼d(UAA) and Fl∼d(AUAA) to R85A RNase A is shown in Fig. 2 B. Although the anisotropy values of the bound (A max) and unbound oligomer (A min) varied slightly between experiments, the total change in anisotropy (ΔA) remained constant for all experiments. This value (ΔA = 120 mA) is consistent with that seen previously for the binding of Fl∼d(AUAA) (11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar) and Fl∼d(UAA) (27Kelemen B.R. Raines R.T. Marshak D.R. Techniques in Protein Chemistry VIII. Academic Press, San Diego, CA1997: 565-572Google Scholar) to wild-type RNase A. As shown in Fig. 2, Fl∼d(AUAA) binds to wild-type RNase A to form a complex with a K d value of 3.0 μm. This value is 8-fold lower than that for the complex of Fl∼d(UAA) and wild-type RNase A. This result suggests that there are specific interactions between RNase A and the 5′-phosphoryl group or adenine base of the bound nucleic acid. Fl∼d(AUAA) binds to the R85A variant to form a complex with a K d value of 9.6 μm. This value is 2.4-fold lower than the wild-type RNase A·Fl∼d(UAA) complex, again suggesting that RNase A interacts specifically with the additional adenosine 5′-phosphate. Fl∼d(UAA) binds to wild-type RNase A and the R85A variant with similar affinity. The active site and several other subsites of RNase A have been well characterized (5Cuchillo C.M. Vilanova M. Nogués M.V. D'Alessio G. Riordan J.F. Ribonucleases: Structures and Functions. Academic Press, New York1997: 271-304Crossref Google Scholar, 6Raines R.T. Chem. Rev. 1998; 98: 1045-1065Crossref PubMed Scopus (866) Google Scholar). The goal of this work is to identify additional subsites in RNase A that interact with the RNA substrate during catalysis. Using both kinetic and thermodynamic assays, we find that the side chain of Arg-85 interacts with the phosphoryl group of a bound substrate. In addition, we show that Lys-37, Arg-39, and Lys-104 do not, at least individually, comprise RNase A subsites. Thirty years ago, Takahashi (1968) proposed roles for Arg-39 and Arg-85 based on a loss of ribonucleolytic activity upon covalent modification of these residues (28Takahashi K. J. Biol. Chem. 1968; 243: 6171-6179Abstract Full Text PDF PubMed Google Scholar). Subsequent affinity labeling and molecular modeling studies led Cuchillo and co-workers (29de Llorens R. Arús C. Parés X. Cuchillo C.M. Protein Eng. 1989; 2: 417-429Crossref PubMed Scopus (32) Google Scholar) to predict that Lys-104 and Lys-37 comprise an additional phosphoryl group subsite on the 5′- and 3′-side, respectively, of the scissile bond. After determining the crystalline structure of the RNase A·d(ATAAG) complex, Cuchillo and co-workers (15Fontecilla-Camps J.C. de Llorens R. le Du M.H. Cuchillo C.M. J. Biol. Chem. 1994; 269: 21526-21531Abstract Full Text PDF PubMed Google Scholar) included Arg-85 as a possible subsite residue. The oligonucleotide in the crystalline complex lacked a 5′-phosphoryl group, and no interaction between Arg-85 or Lys-104 and d(ATAAG) was apparent. Likewise, disorder in the crystalline complex precluded detection of new interactions on the 3′-side of the P2 subsite. Still, an electrostatic potential map of the RNase A surface concurred with prior speculations—Lys-37, Arg-39, Arg-85, and Lys-104 were good candidates for additional enzymic subsites (Fig.1). Replacing Lys-37 or Arg-39 with an alanine residue has little effect on the kinetic parameters for the cleavage of poly(C). As listed in Table I,k cat, K m, andk cat/K m are all within 2-fold of the values for wild-type RNase A. Despite the proximity of Lys-37 and Arg-39 to the P2 subsite and their cationic side chains, which could interact with a phosphoryl group of RNA, these data suggest that Lys-37 and Arg-39 do not contribute to catalysis. Lys-37 is not conserved by evolution. Of the 41 pancreatic ribonucleases of known sequence, only those from bovine, eland, rat, and guinea pig have a lysine residue at position 37 (30Beintema J.J. Life Chem. Rep. 1987; 4: 333-389Google Scholar) (glutamine is most prevalent at this position). Likewise, Arg-39 is not conserved. Of the 41 pancreatic ribonucleases of known sequence, only 30 have an arginine residue at position 39 (30Beintema J.J. Life Chem. Rep. 1987; 4: 333-389Google Scholar). Replacing Lys-104 with an alanine residue has a small effect on catalysis. Although the value of bothk cat and K m for K104A RNase A are 2-fold lower than those of the wild-type enzyme, the change to the value of k cat/K m is not significant. These results suggest that Lys-104 has little importance in the RNase A-catalyzed cleavage of RNA. The similarity in the kinetic parameters for poly(C) cleavage by K104A RNase A and the wild-type enzyme was not anticipated from a consideration of phylogenetics. In contrast to Lys-37 and Arg-39, Lys-104 is conserved highly. The side chain of residue 104 is cationic in 39 of 40 pancreatic ribonucleases whose sequences have been determined, with all but four of these residues being lysine (30Beintema J.J. Life Chem. Rep. 1987; 4: 333-389Google Scholar). Residue 85 is the most conserved residue of the four investigated herein. An arginine is present at position 85 in 40 of 41 pancreatic ribonucleases (30Beintema J.J. Life Chem. Rep. 1987; 4: 333-389Google Scholar). The single exception is mouse pancreatic ribonuclease, which has a histidine at this position. Based on its conservation by evolution and its proximity to the active site, Arg-85 appeared likely to play a role in substrate binding. The impaired kinetic parameters for the cleavage of poly(C) by R85A RNase A suggest a significant role for residue 85. Although the value of k cat for poly(C) cleavage remains essentially unchanged, those of K m andk cat/K m differ dramatically (Table I). Interestingly, the >15-fold increase in the value ofK m is larger than that for K41A RNase A, which has the largest K m value observed previously for an RNase A variant. 2J. M. Messmore and R. T. Raines, unpublished results. In addition, the value ofk cat/K m for poly(C) cleavage by R85A RNase A is 10-fold lower than that of the wild-type enzyme. Thus, Arg-85 makes a uniform contribution toward binding the ground state and the rate-limiting transition state during catalysis. Coulombic interactions can form between the cationic side chains of a protein and the anionic phosphoryl groups of a nucleic acid. The driving force for complex formation is the release of cations from the nucleic acid upon complex formation (17Record Jr., M.T. Lohman T.M. De Haseth P. J. Mol. Biol. 1976; 107: 145-158Crossref PubMed Scopus (931) Google Scholar). Accordingly, proteins often bind more strongly to nucleic acids in solutions that have a lower concentration of cations. Indeed, the affinity of Fl∼d(AUAA) for RNase A increases with decreasing sodium concentration (11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar). The K d values for the RNase A·Fl∼d(AUAA) and RNase A·Fl∼d(UAA) complexes in the solution used in the poly(C) cleavage assays (0.10 m MES-NaOH, pH 6.0, containing NaCl (0.10 m)) are 88 μm (11Fisher B.M. Ha J.-H. Raines R.T. Biochemistry. 1998; 37: 12121-12132Crossref PubMed Scopus (61) Google Scholar) and 130 μm (27Kelemen B.R. Raines R.T. Marshak D.R. Techniques in Protein Chemistry VIII. Academic Press, San Diego, CA1997: 565-572Google Scholar), respectively. TheseK d values differ by only 1.5-fold. Yet, in the low salt concentration solution used in our binding experiments (0.020m MES-NaOH buffer, pH 6.0, containing NaCl (0.025m)), the K d values for the RNase A·Fl∼d(AUAA) and RNase A·Fl∼d(UAA) complexes are 3.0 and 24 μm, respectively, differing by 8-fold (Figs.2 and 3). These salt-concentration effects are consistent with the existence of a coulombic interaction between the cationic side chain of Arg-85 and the additional anionic phosphoryl group of Fl∼d(AUAA). Why is the affinity of R85A RNase A for Fl∼d(AUAA) greater than that for Fl∼d(UAA)? In the crystalline RNase A·d(ATAAG) complex (15Fontecilla-Camps J.C. de Llorens R. le Du M.H. Cuchillo C.M. J. Biol. Chem. 1994; 269: 21526-21531Abstract Full Text PDF PubMed Google Scholar), the side chain of Arg-85 is directed toward the 5′-hydroxyl group of d(ATAAG), which is in the position that would be occupied by the 5′-phosphoryl group of Fl∼d(AUAA). This interaction is removed upon replacing Arg-85 with alanine. Still, Cβ and Cγ of Pro-42 make van der Waals contact with the 5′-adenine base of d(ATAAG). This interaction could be responsible for the additional binding energy upon complex formation with the longer oligonucleotide. The cationic residues of RNase A that are known to interact with RNA are distributed evenly about the active site (Fig. 4). Arg-85 and Lys-66 are on the 5′-side, and Lys-7 and Arg-10 (P2) are on the 3′-side. In contrast to the substrate, the products of RNA cleavage each interact with only two of these four residues. This symmetric disposition of the phosphoryl group binding subsites is thus optimal for maximizing the binding of substrate while minimizing the binding of products. RNase A has known subsites that enable the multivalent interaction with the bases (B1, B2, and B3) and phosphoryl groups (P0, P1, and P2) of an RNA substrate. The results of kinetic and thermodynamic experiments indicate that Arg-85 has an important role in nucleic acid binding by RNase A. Based on the proximity of Arg-85 to the P0 subsite, the dramatic change in the K m value for poly(C) cleavage, and the differential binding affinities of Fl∼d(AUAA) and Fl∼d(UAA) for the wild-type protein and R85A variant, we conclude that the side chain of Arg-85 constitutes a new enzymic subsite, which we call “P(−1)” (Fig. 4)." @default.
W2009074737 created "2016-06-24" @default.
W2009074737 creator A5019213891 @default.
W2009074737 creator A5047551226 @default.
W2009074737 creator A5056727716 @default.
W2009074737 date "1998-12-01" @default.
W2009074737 modified "2023-09-30" @default.
W2009074737 title "A New Remote Subsite in Ribonuclease A" @default.
W2009074737 cites W105515906 @default.
W2009074737 cites W110457946 @default.
W2009074737 cites W1508943571 @default.
W2009074737 cites W1587011352 @default.
W2009074737 cites W1592939302 @default.
W2009074737 cites W1967948506 @default.
W2009074737 cites W1968966912 @default.
W2009074737 cites W1975827677 @default.
W2009074737 cites W1981168662 @default.
W2009074737 cites W1981197890 @default.
W2009074737 cites W2007272508 @default.
W2009074737 cites W2017618114 @default.
W2009074737 cites W2028231353 @default.
W2009074737 cites W2034968376 @default.
W2009074737 cites W2079009158 @default.
W2009074737 cites W2087657004 @default.
W2009074737 cites W2094227697 @default.
W2009074737 cites W2095385679 @default.
W2009074737 cites W2100045416 @default.
W2009074737 cites W2112737336 @default.
W2009074737 cites W2115912427 @default.
W2009074737 cites W2139310281 @default.
W2009074737 cites W2888511473 @default.
W2009074737 cites W2969273703 @default.
W2009074737 cites W4211216439 @default.
W2009074737 cites W4230118768 @default.
W2009074737 doi "https://doi.org/10.1074/jbc.273.51.34134" @default.
W2009074737 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9852072" @default.
W2009074737 hasPublicationYear "1998" @default.
W2009074737 type Work @default.
W2009074737 sameAs 2009074737 @default.
W2009074737 citedByCount "53" @default.
W2009074737 countsByYear W20090747372012 @default.
W2009074737 countsByYear W20090747372013 @default.
W2009074737 countsByYear W20090747372015 @default.
W2009074737 countsByYear W20090747372018 @default.
W2009074737 countsByYear W20090747372019 @default.
W2009074737 countsByYear W20090747372021 @default.
W2009074737 countsByYear W20090747372023 @default.
W2009074737 crossrefType "journal-article" @default.
W2009074737 hasAuthorship W2009074737A5019213891 @default.
W2009074737 hasAuthorship W2009074737A5047551226 @default.
W2009074737 hasAuthorship W2009074737A5056727716 @default.
W2009074737 hasBestOaLocation W20090747371 @default.
W2009074737 hasConcept C104317684 @default.
W2009074737 hasConcept C166703698 @default.
W2009074737 hasConcept C185592680 @default.
W2009074737 hasConcept C2778976237 @default.
W2009074737 hasConcept C55493867 @default.
W2009074737 hasConcept C67705224 @default.
W2009074737 hasConcept C71240020 @default.
W2009074737 hasConcept C79750893 @default.
W2009074737 hasConceptScore W2009074737C104317684 @default.
W2009074737 hasConceptScore W2009074737C166703698 @default.
W2009074737 hasConceptScore W2009074737C185592680 @default.
W2009074737 hasConceptScore W2009074737C2778976237 @default.
W2009074737 hasConceptScore W2009074737C55493867 @default.
W2009074737 hasConceptScore W2009074737C67705224 @default.
W2009074737 hasConceptScore W2009074737C71240020 @default.
W2009074737 hasConceptScore W2009074737C79750893 @default.
W2009074737 hasIssue "51" @default.
W2009074737 hasLocation W20090747371 @default.
W2009074737 hasOpenAccess W2009074737 @default.
W2009074737 hasPrimaryLocation W20090747371 @default.
W2009074737 hasRelatedWork W1599950955 @default.
W2009074737 hasRelatedWork W189071255 @default.
W2009074737 hasRelatedWork W1996356285 @default.
W2009074737 hasRelatedWork W2027085730 @default.
W2009074737 hasRelatedWork W2034736863 @default.
W2009074737 hasRelatedWork W2068507694 @default.
W2009074737 hasRelatedWork W2083739864 @default.
W2009074737 hasRelatedWork W2086855538 @default.
W2009074737 hasRelatedWork W2126100091 @default.
W2009074737 hasRelatedWork W2523904082 @default.
W2009074737 hasVolume "273" @default.
W2009074737 isParatext "false" @default.
W2009074737 isRetracted "false" @default.
W2009074737 magId "2009074737" @default.
W2009074737 workType "article" @default.