FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2009361993> ?p ?o ?g. }

• W2009361993 endingPage "1467" @default.
• W2009361993 startingPage "1458" @default.
• W2009361993 abstract "Tumor necrosis factor-α (TNFα) is known to inhibit renin gene expression in juxtaglomerular cells, which are the main source of renin in vivo. In the present study we aimed to characterize the intracellular mechanisms of TNFα signaling to renin gene in the mouse juxtaglomerular cell line As4.1. TNFα was found to activate NFκB, which is one of the principal intracellular mediators of TNFα signal transduction. Constitutive activation of NFκB suppressed renin gene transcription, but NFκB appeared not to target the NFκB binding sites in the renin promoter. Thus, NFκB, but not the canonical NFκB binding sequences in the renin promoter, seemed to be involved in the suppression of renin transcription by TNFα. Deletion/mutation analysis revealed that the effect of TNFα on renin gene is transmitted by a cAMP-responsive element (CRE) located at -2697 to -2690. Mobility shift/supershift assays evidenced for the presence of NFκB proteins in the complex that binds to mouse renin CRE. Our results strongly suggest that NFκB mediates the effect of TNFα on renin transcription targeting a CRE in the mouse renin promoter. Tumor necrosis factor-α (TNFα) is known to inhibit renin gene expression in juxtaglomerular cells, which are the main source of renin in vivo. In the present study we aimed to characterize the intracellular mechanisms of TNFα signaling to renin gene in the mouse juxtaglomerular cell line As4.1. TNFα was found to activate NFκB, which is one of the principal intracellular mediators of TNFα signal transduction. Constitutive activation of NFκB suppressed renin gene transcription, but NFκB appeared not to target the NFκB binding sites in the renin promoter. Thus, NFκB, but not the canonical NFκB binding sequences in the renin promoter, seemed to be involved in the suppression of renin transcription by TNFα. Deletion/mutation analysis revealed that the effect of TNFα on renin gene is transmitted by a cAMP-responsive element (CRE) located at -2697 to -2690. Mobility shift/supershift assays evidenced for the presence of NFκB proteins in the complex that binds to mouse renin CRE. Our results strongly suggest that NFκB mediates the effect of TNFα on renin transcription targeting a CRE in the mouse renin promoter. Renin-angiotensin-aldosterone system (RAAS) 1The abbreviations used are: RAAS, renin-angiotensin-aldosterone system; JG, juxtaglomerular; ATII, angiotensin II; CRE, cAMP-responsive element; CREB/ATF, CRE-binding protein/activating transcription factor; TNFα, tumor necrosis factor-α; TNF-R, TNF receptor; siRNA, small interfering RNA; CBP, CREB-binding protein; NFκB, nuclear factor κB; ELISA, enzyme-linked immunosorbent assay; CREM, cAMP-responsive element modulator. 1The abbreviations used are: RAAS, renin-angiotensin-aldosterone system; JG, juxtaglomerular; ATII, angiotensin II; CRE, cAMP-responsive element; CREB/ATF, CRE-binding protein/activating transcription factor; TNFα, tumor necrosis factor-α; TNF-R, TNF receptor; siRNA, small interfering RNA; CBP, CREB-binding protein; NFκB, nuclear factor κB; ELISA, enzyme-linked immunosorbent assay; CREM, cAMP-responsive element modulator. is one of the fundamental regulators of blood pressure. Renin, synthesized in the JG cells of the kidney, is the limiting factor that determines the activity of plasma RAAS (1.Hackenthal E. Paul M. Ganten D. Taugner R. Physiol. Rev. 1990; 70: 1067-1116Crossref PubMed Scopus (557) Google Scholar). Therefore renin production is under the strict control of multiple input signals. These could be divided into systematic factors including sodium load, blood pressure, sympathetic tone, plasma concentration of catecholamines and ATII, and local factors including the macula densa signal, nitric oxide, prostaglandins, endothelins, and cytokines (2.Wagner C. Jensen B.L. Krämer B.K. Kurtz A. Kidney Int. 1998; 54: 78-83Abstract Full Text Full Text PDF Scopus (41) Google Scholar, 3.Wagner C. Kurtz A. Curr. Opin. Nephrol. Hypertens. 1998; 7: 437-441Crossref PubMed Scopus (30) Google Scholar). Recently (4.Jones C.A. Sigmund C.D. McGowan R.A. Kane-Haas C.M. Gross K.W. Mol. Endocrinol. 1990; 4: 375-383Crossref PubMed Scopus (103) Google Scholar, 5.Sigmund C.D. Jones C.A. Fabian J.R. Mullins J.J. Gross K.W. Biophys. Res. Commun. 1990; 170: 344-350Crossref PubMed Scopus (67) Google Scholar, 6.Jones C.A. Hurley M.I. Black T.A. Kane C.M. Pan L. Pruitt S.C. Gross K.W. Physiol. Genomics. 2000; 4: 75-81Crossref PubMed Scopus (50) Google Scholar, 7.Bader M. Ganten D. J. Mol. Med. 2000; 78: 130-139Crossref PubMed Scopus (73) Google Scholar), the regulatory sequences driving the developmental tissue and cell-specific expression of renin gene have been investigated intensively. However, the intracellular signaling cascades that are utilized by (patho)physiological extracellular factors to regulate the expression of renin gene are still not well understood. It is established that protein kinase A is involved in the stimulation of renin synthesis. Activated protein kinase A phosphorylates CREB/ATF transcription factors that target a cis-acting CRE to trigger renin transcription. Functional CREs were identified in the promoters of human and mouse renin genes (8.Ying L. Morris B.J. Sigmund C.D. J. Biol. Chem. 1997; 272: 2412-2420Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 9.Pan L. Black T.A. Shi Q. Jones C.A. Petrovic N. Loudon J. Kane C. Sigmund C.D. Gross K.W. J. Biol. Chem. 2001; 276: 45530-45538Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 10.Klar J. Sandner P. Müller M.W. Kurtz A. Pflügers Arch. 2002; 444: 335-344Crossref PubMed Scopus (57) Google Scholar). However, there is still relative deficient knowledge about the intracellular signaling and the corresponding cis-regulatory elements, which confer inhibitory signals to renin gene. It is reported that ATII, which is one of the major humoral regulators of renin production, targets the proximal 2.8 kb of the mouse renin promoter to inhibit renin transcription in a protein kinase C-dependent manner (11.Müller M.W.H. Todorov V. Krämer B.K. Kurtz A. Pflügers Arch. 2002; 444: 499-505Crossref PubMed Scopus (32) Google Scholar). The cytokine oncostatin M suppresses renin gene expression by a mechanism involving activation of signal transducers and activators of transcription 5 in As4.1 cells (12.Baumann H. Wang Y. Richards C.D. Jones C.A. Black T.A. Gross K.W. J. Biol. Chem. 2000; 275: 22014-22019Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). The orphan nuclear receptor Ear2 was identified (13.Liu X. Huang X. Sigmund C.D. Circ. Res. 2003; 92: 1033-1040Crossref PubMed Scopus (52) Google Scholar) as a negative regulator of retinoid-induced renin promoter activity also in As4.1 cells. Recently (14.Fuchs S. Philippe J. Corvol P. Pinet F. J. Hypertens. 2003; 21: 327-335Crossref PubMed Scopus (60) Google Scholar), a calcium-dependent inhibition of renin gene via negative calcium response element in human renin promoter was described. We have reported that TNFα is a physiologically relevant inhibitor of renin gene transcription (15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar). The effect of TNFα on renin synthesis seems to be of fundamental importance in the regulation of blood pressure, because enhanced production of TNFα is part of the response of the organism to hypertension (16.Kapadia S.R. Oral H. Lee J. Nakano M. Taffet G.E. Mann D.L. Circ. Res. 1997; 81: 187-195Crossref PubMed Scopus (262) Google Scholar, 17.Dorffel Y. Latsch C. Stuhmüller B. Schreiber S. Scholze S. Burmester G.R. Scholze J. Hypertension. 1999; 34: 113-117Crossref PubMed Scopus (240) Google Scholar). Thus, TNFα might be one humoral mediator of the long negative feedback loop of RAAS, linking the changes in blood pressure to the control of renin production. Moreover, TNF receptor type II (TNF-RII) locus is associated with essential hypertension (18.Glenn C.L. Wang W.Y.S. Benjafield A.V. Morris B.J. Hum. Mol. Genet. 2000; 9: 1943-1949Crossref PubMed Scopus (63) Google Scholar), and we found that TNF-RII, but not TNF-RI, is the predominant TNF receptor type expressed in the JG cells (15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar). As 80% of the patients with essential hypertension have elevated plasma levels of renin it could be speculated that a malfunction of the TNFα signaling in the renin producing JG of the kidney is one of the key events in the etiology and/or pathogenesis of essential hypertension. This hypothesis is supported by data showing that TNFα signaling is impaired in spontaneously hypertensive rats (19.Johns D.G. Webb R.C. Charpie J.R. J. Hypertens. 2001; 19: 63-70Crossref PubMed Scopus (23) Google Scholar). However, to date the mechanism of action of TNFα on renin transcription in JG cells is almost unknown. Recently (15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar), we could delimit the target region of TNFα to the proximal 4.2 kb of the mouse renin promoter. The present work aimed to study the signal transduction of TNFα to renin gene in the mouse As4.1 cells. The As4.1 cell line is presently the only clonal cell line of renal origin featured by an endogenous production of renin and thus very similar to the native renin-producing JG cells (20.Sigmund C.D. Okuyama K. Ingelfinger J. Jones C.A. Mullins J.J. Kane C. Kim U. Wu C.Z. Kenny L. Rustum Y. Dzau V.J. Gross K.W. J. Biol. Chem. 1990; 265: 19916-19922Abstract Full Text PDF PubMed Google Scholar). The As4.1 cells are a reliable and well recognized model for studying the regulation of renin transcription (9.Pan L. Black T.A. Shi Q. Jones C.A. Petrovic N. Loudon J. Kane C. Sigmund C.D. Gross K.W. J. Biol. Chem. 2001; 276: 45530-45538Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 10.Klar J. Sandner P. Müller M.W. Kurtz A. Pflügers Arch. 2002; 444: 335-344Crossref PubMed Scopus (57) Google Scholar, 11.Müller M.W.H. Todorov V. Krämer B.K. Kurtz A. Pflügers Arch. 2002; 444: 499-505Crossref PubMed Scopus (32) Google Scholar, 12.Baumann H. Wang Y. Richards C.D. Jones C.A. Black T.A. Gross K.W. J. Biol. Chem. 2000; 275: 22014-22019Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar, 15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar, 21.Todorov V. Müller M. Kurtz A. Kidney Blood Press. Res. 2001; 24: 75-78Crossref PubMed Scopus (9) Google Scholar). Our results show that NFκB is the crucial intracellular mediator of the TNFα signaling to renin gene. We found that NFκB does not target its consensus binding sequences in the mouse renin promoter, but a cAMP-responsive element. Cell Culture—As4.1 cells were obtained from the American Type Culture Collection (ATCC CRL-2193). The cells were cultured in Dulbecco's modified essential medium (Biochrom KG) supplemented with 10% fetal calf serum, l-glutamine, and sodium pyruvate, 100 units/ml penicillin, and 100 μg/ml streptomycin and incubated at 37 °C in a humidified atmosphere containing 10% CO2. TNFα (10 ng/ml; Calbiochem) was applied 20 h before cell harvesting, unless otherwise specified. NFκB Activation Assay—Transcriptional activation of NFκB was measured by transcription factor ELISA. This method determines the binding activity of transcription factors, which gives an indirect estimation of their transcriptional potential. NFκB binding activity was quantified using Trans-AM™ NFκB-p50/NFκB-p65 kits (Active Motif) following the instructions of the manufacturer. Briefly, 3 × 106 As4.1 cells were collected in 100 μl of lysis buffer. After titration, 20 μl were used in the p50 binding assay, and 5 μl were used in the p65 binding assay (at concentration ∼2 μg/μl). The samples (two per condition, in duplicate) were shaken for 1 h at room temperature in 30 μl of binding buffer. After washing, anti-p50 or -p65 antibody diluted 1:1000 was applied to the wells for 1 h at room temperature. Specific binding was estimated by spectrophotometry after incubation with a horseradish peroxidase-conjugated antibody (1 h at room temperature, 1:1000 diluted) at 450-nm wavelength. For competition analysis a 10-fold molar excess of double-stranded oligonucleotide was added. Electrophoretic Mobility Shift Assay—Nuclear protein extracts were obtained according to the protocol of Schreiber et al. (22.Schreiber E. Matthias P. Muller M.M. Schaffner W. Nucleic Acids Res. 1989; 17: 6418Crossref PubMed Scopus (3916) Google Scholar). Aliquots were stored frozen at -80 °C. Complementary oligonucleotides in equimolar amounts were hybridized for 5 min at 95 °C and then were allowed to cool to room temperature. The probes were made from double-stranded oligonucleotides containing 5′-AATT overhangs at both sides, which were filled using Klenow polymerase with [α-32P]dATP or [α-33P]dATP and three other cold nucleotides. The renCRE (m30) probe sequence was 5′-GTTCCTTCTGTAATCCTCCCAATGACATCA-3′, which corresponds to bases -2719 to -2690 of the mouse renin promoter (GenBank™ accession number L78789; the CRE is underlined). The renCREmut (m30mut) probe, 5′-GTTCCTTCTGTAATCCTCCCAAccgttctg-3′, had mutated CRE (changed bases are lowercase). Typically 5 μg of nuclear extract was subjected to bandshift analysis. The binding reaction was performed for 15 min on ice in 1× gel shift binding buffer (0.1% Nonidet P-40, 4% glycerol, 1 mm MgCl2, 0.5 mm EDTA, 0.5 mm dithiothreitol, 50 mm NaCl, 10 mm Tris·HCl, pH 7.5, 0.05 g/liter poly(dI-dC)·poly(dI-dC)) containing 40,000 cpm labeled probe in 10 μl total volume. For competition assays unlabeled double-stranded oligonucleotide in 100-fold molar excess (unless otherwise specified) was preincubated with the nuclear extracts for 15 min before the addition of the probe. Supershift analysis was performed by adding 3-5 μl from the indicated antibody to the reactions followed by incubation on ice for 1 h after the addition of the labeled probe. Anti-p50 and -p65 antibodies were from Active Motif, whereas anti-cRel and -p52 were from Santa Cruz Biotechnology, Inc. The binding reactions were resolved on a 5% nondenaturing polyacrylamide gel in 0.5× TBE buffer at 4 °C. Plasmids—The 4.2- and the 2.8-kb mouse renin promoter-firefly luciferase constructs were already described (11.Müller M.W.H. Todorov V. Krämer B.K. Kurtz A. Pflügers Arch. 2002; 444: 499-505Crossref PubMed Scopus (32) Google Scholar, 15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar). The deletion constructs 2.8kbΔ2866-2625, 2.8kbΔ2866-2689, 2.8kbΔ2866-2797, 2.8kbΔ2797-2767, and 2.8kbΔ2797-2719 were obtained from the 2.8-kb renin promoter (see Fig. 6A) as described previously (10.Klar J. Sandner P. Müller M.W. Kurtz A. Pflügers Arch. 2002; 444: 335-344Crossref PubMed Scopus (57) Google Scholar). In brief, the flanking sequences of the regions aimed to be deleted were mutated using site-directed mutagenesis (QuikChange kit; Stratagene) to SacII restriction sites. The mutated plasmids were digested with SacII and relegated to generate the desired deletion constructs. The region from -2719 to -2690 bp in the 4.2-kb fragment was mutated (QuikChange site-directed mutagenesis kit; Stratagene) to generate new renin promoter-luciferase constructs as follows (changed bases are in bold, and CRE is underlined): 4.2 kb, GTTCCTTCTGTAATCCTCCCAATGACATCA; 4.2 kb-μ1, CCCTCGGGTGTAATCCTCCCAATGACATCA; 4.2 kb-μ2, GTTCCTTCTCCCCTCCTCCCAATGACATCA; 4.2 kb-μ3, GTTCCTTCTGTAAGAAGACCAATGACATCA; 4.2 kb-μ4, GTTCCTTCTGTAATCCTCTTGGTGACATCA; 4.2 kb-μ5, GTTCCTTCTGTAATCCTCCCAACCGTATCA; 4.2 kb-μ6, GTTCCTTCTGTAATCCTCCCAATGACTCTG; 4.2 kb-CRE, GTTCCTTCTGTAATCCTCCCAATGACGTCA; 4.2 kb-NFκB, GTTCCTTCTGTAATCCTCCCAAGGGACTTTCC. The four identified NFκB binding sequences in the 4.2-kb renin promoter fragment were mutated using site-directed mutagenesis as shown in Fig. 3A to generate 4.2 kb of 4× NFκB Mut firefly luciferase construct. pRL-SV40-Renilla luciferase vector (used as internal control for the efficiency of transfection) was from Promega. The pCRE-Luc vector (Clontech) contains firefly luciferase reporter under the control of multiple CRE sequences, whereas in the pNFκB-Luc vector (Clontech) the firefly luciferase was driven by four NFκB binding sequences. RNA Interference—Ready-to-use double-stranded 21-nucleotide RNAs (siRNAs) were synthesized by IBA (Germany). The siRNA targeting IκBα (GenBank™ accession number NM_010907) corresponded to positions 111-131 relative to the first nucleotide of the start codon; siRNA targeting CBP (GenBank™ accession number S66385) corresponded to positions 79-99 relative to the first nucleotide of the start codon. Single-stranded sense RNAs (used as control) or siRNAs (200 nm), together with 0.5 μg of the indicated firefly luciferase vector (Luc1) and 0.005 μg of Renilla luciferase vector (Luc2), were transfected into As4.1 cells with Oligofectamine (Invitrogen) according to the manufacturer's protocol. Cells were harvested 72 h after transfection. Transient Transfection—Transfection was performed using FuGENE 6 transfection reagent (Roche Applied Science) essentially as described (15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar). 0.5 μg of the indicated firefly luciferase vector (Luc1) were co-transfected with 0.005 μg of a plasmid containing an SV40 promoter driving Renilla luciferase (Luc2). RNA Isolation—Total RNA cells was isolated from As4.1 using Qiagen RNeasy Spin Columns. Reverse Transcription-Quantitative LightCycler PCR—Reverse transcription was performed as described (15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar). cDNAs were amplified on a Roche Applied Science LightCycler using the Fast Start SYBR Green I Kit from Roche Applied Science. The primers for renin and β-actin are described elsewhere (23.Jensen B.L. Schmid C. Kurtz A. Am. J. Physiol. 1996; 271: F659-F669Crossref PubMed Google Scholar). The sequences of the primers used for the amplification of IκBα and CBP are available upon request. Luciferase Assay—Luciferase activity was measured with the Dual Luciferase Assay Kit from Promega, according to the manufacturer's instructions. Relative luciferase activity was calculated as firefly luciferase to Renilla luciferase ratio (Luc1/Luc2). Immunoblotting—Total protein was extracted from As4.1 cells, and Western blotting was performed as described (21.Todorov V. Müller M. Kurtz A. Kidney Blood Press. Res. 2001; 24: 75-78Crossref PubMed Scopus (9) Google Scholar). Anti-IκBα antibody was purchased from Santa Cruz Biotechnology, Inc. Immunofluorescence—As4.1 cells were washed with ice-cold phosphate-buffered saline and fixed in methanol. Anti-IκBα or anti-CBP antibody (Santa Cruz Biotechnology, Inc.) was applied at 1:200 dilution for 1 h at room temperature. After washing cells were incubated with fluorescein isothiocyanate-conjugated antibody (dilution 1:100) and 0.5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI) for 45 min at room temperature. Statistics—All experiments were carried out in triplicate with three samples per condition unless otherwise indicated. Levels of significance were estimated by analysis of variance, followed by Student's unpaired t test. p < 0.05 was considered significant. TNFα Activates NFκB in As4.1 Cells—Transcription factor NFκB is the classical intracellular mediator of TNFα action. NFκB is activated upon release from its cytoplasm inhibitors IκB-α, -β, -ϵ, Bcl-3, p100, and p105 (24.Baldwin Jr, A.S. Annu. Rev. Immunol. 1996; 14: 649-683Crossref PubMed Scopus (5563) Google Scholar, 25.Whiteside S.T. Israel A. Semin. Cancer Biol. 1997; 8: 75-82Crossref PubMed Scopus (300) Google Scholar). IκBα is the prototypical NFκB inhibitor protein. Upon stimulation it is phosphorylated on Ser-32 and Ser-36 and thus is targeted to ubiquitin-dependent degradation (26.Karin M. Ben-Neriah Y. Annu. Rev. Immunol. 2000; 18: 621-663Crossref PubMed Scopus (4073) Google Scholar). We used Western blot to assess the abundance of IκBα. It was considerably decreased after 16 h of incubation with TNFα, which is the earliest time point at which TNFα produces a marked decrease in renin mRNA (15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar) (Fig. 1A). Thus, NFκB signaling was proved to be functional in As4.1 cells upon prolonged incubation with TNFα. NFκB is a dimeric complex consisting of the Rel-like proteins RelA (p65), RelB, cRel, p50, and p52 (24.Baldwin Jr, A.S. Annu. Rev. Immunol. 1996; 14: 649-683Crossref PubMed Scopus (5563) Google Scholar, 26.Karin M. Ben-Neriah Y. Annu. Rev. Immunol. 2000; 18: 621-663Crossref PubMed Scopus (4073) Google Scholar). We used transcription factor ELISA (DNA binding assay) to study the TNFα-mediated activation of p50 and p65, which is the canonical inducible NFκB binding activity (27.Dobrzanski P. Ryseck R.P. Bravo R. EMBO J. 1994; 13: 4608-4616Crossref PubMed Scopus (106) Google Scholar, 28.Weih F. Carrasco D. Bravo R. Oncogene. 1994; 9: 3289-3297PubMed Google Scholar). TNFα increased p50 and p65 activity up to 4-fold (Fig. 1B). While p65 activity displayed two peaks 30 min and 8 h after TNFα application, p50 activity increased within the course of treatment (Fig. 1C). NFκB Does Not Target the NFκB Binding Sequences in the Mouse Renin Promoter to Suppress Renin Transcription—TNFα was found to suppress renin promoter activity (15.Todorov V. Müller M. Schweda F. Kurtz A. Am. J. Physiol. 2002; 283: R1046-R1051Crossref PubMed Scopus (45) Google Scholar), and at the same time it activates NFκB in As4.1 cells (Fig. 1). Therefore, we checked whether NFκB is principally involved in the mechanism of suppression of renin transcription by TNFα. Constitutive activation of NFκB via RNA interference-mediated knock-down of the central NFκB inhibitory protein IκBα (Fig. 2, A and B) decreased drastically renin mRNA abundance and renin 4.2-kb fragment promoter activity in As4.1 cells (Fig. 2, C and D). Next, we examined the 4.2-kb proximal promoter of the mouse renin gene (GenBank™ accession number L78789) for putative NFκB binding sites with MatSearch Professional (29.Quandt K. Frech K. Karas H. Wingender E. Werner T. Nucleic Acids Res. 1995; 23: 4878-4884Crossref PubMed Scopus (2423) Google Scholar). Four possible NFκB binding sequences were identified (Fig. 3A). DNA binding assays proved that these sequences bind NFκB p50 and p65 and that after mutations these sequences do not compete the binding of p50 or p65 to a consensus NFκB binding sequence (Fig. 3, B and C). To examine the functional significance of the identified NFκB binding sites, mutations were generated in the four NFκB renin promoter sequences (Fig. 3A), changing the critical bases conferring the cis-activation, to generate a 4.2-kb 4× NFκB Mut renin promoter construct. Transient transfections of the 4.2-kb 4× NFκB Mut in As4.1 cells revealed no change in the inhibition by TNFα, suggesting that NFκB does not target the four identified NFκB binding sites in the 4.2-kb renin promoter (Fig. 4). On the other hand when IκBα was knocked down, TNFα had no effect on the 4.2-kb 4× NFκB Mut construct suggesting that activated NFκB, but not renin promoter NFκB binding sequences, are necessary for the effect of TNFα (Fig. 5).Fig. 4Mutation of the NFκB binding sites in the 4.2-kb mouse renin promoter does not change the effect of TNFα As4.1 cells were transiently transfected with the proximal 4.2 kb of the mouse renin promoter containing the wild-type (4.2 kb) or the mutated (4.2 kb 4× NFκB Mut) NFκB binding sites. Cells were treated with TNFα where indicated. Luc1, firefly luciferase activity; Luc2, Renilla luciferase activity. Data are means ± S.E.; *, p < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 5Activated NFκB, but not renin promoter NFκB sequences, are involved in mechanism of suppression of renin transcription by TNFα IκBα was knocked down as described under “Materials and Methods,” and As4.1 cells were simultaneously transfected with the proximal 4.2 kb of the mouse renin promoter, containing mutations in the four NFκB sequences (4.2 kb 4× NFκB Mut). Cells were treated with TNFα where indicated. Luc1, firefly luciferase activity; Luc2, Renilla luciferase activity. Data are means ± S.E.; *, p < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT) TNFα Targets a CRE in the Mouse Renin Promoter—Next we look for the regulatory sequence in the mouse renin gene that transmits the effect of TNFα. We performed a series of pilot deletion analyses of the 4.2-kb mouse renin promoter with constructs that were already used for the identification of the target sequence for cAMP (Fig. 6A) (10.Klar J. Sandner P. Müller M.W. Kurtz A. Pflügers Arch. 2002; 444: 335-344Crossref PubMed Scopus (57) Google Scholar). First we could delimit the target region of TNFα to the proximal 2.8 kb of the renin promoter (Fig. 6B). An enhancer element (located at -2866 to -2625 relative to transcription starting site) flanks the 5′-end of the 2.8-kb fragment (30.Petrovic N. Black T.A. Fabian J.R. Kane C. Jones C.A. Loudon J.A. Abonia J.P. Sigmund C.D. Gross K.W. J. Biol. Chem. 1996; 271: 22499-22505Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Deletions of different portions of the enhancer indicated that a sequence between -2797 and -2689 is targeted by TNFα (Fig. 6B). Further fractional deletions in the region from -2797 to -2689 lead to the identification of 30 bp (m30), in position -2917 to -2689, which were absolutely necessary for the inhibition of renin promoter activity by TNFα (Fig. 6B). The 30-bp sequence is featured by a TTCC motif at -2718 to -2715 and a CRE at -2697 to -2690 (9.Pan L. Black T.A. Shi Q. Jones C.A. Petrovic N. Loudon J. Kane C. Sigmund C.D. Gross K.W. J. Biol. Chem. 2001; 276: 45530-45538Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 10.Klar J. Sandner P. Müller M.W. Kurtz A. Pflügers Arch. 2002; 444: 335-344Crossref PubMed Scopus (57) Google Scholar). TTCC is the 3′-flank of the consensus NFκB binding site. This is also the core sequence for NFκB-p65 and -cRel, unlike NFκB-p50, which interacts preferentially with the 5′-flank of the NFκB consensus sequence (31.Kunsch C. Ruben S.M. Rosen C.A. Mol. Cell. Biol. 1992; 12: 4412-4421Crossref PubMed Google Scholar). CRE is the DNA target for the CREB/ATF transcription factors (32.Ziff E.B. Trends Genet. 1990; 6: 69-72Abstract Full Text PDF PubMed Scopus (188) Google Scholar, 33.Lalli E. Sassone-Corsi P. J. Biol. Chem. 1994; 269: 17359-17362Abstract Full Text PDF PubMed Google Scholar). Sequential mutations were introduced in the m30 sequence, and the effect of TNFα was tested on the mutated constructs (4.2 kb-μ1-μ6; see “Materials and Methods”). The activity of constructs 4.2 kb-μ1 to -μ4, which contained mutations in positions from -2719 to -2698, was clearly decreased upon application of TNFα (Fig. 6C). These results suggested that the TTCC sequence at -2718 to -2715 is not targeted by TNFα. The effect of TNFα on construct 4.2 kb-μ5 was abrogated and on construct 4.2 kb-μ6, significantly attenuated (Fig. 6C). Notably, the core sequence of CRE is mutated in renin promoter construct 4.2 kb-μ5, and the 3′-half of CRE is mutated in renin promoter construct 4.2 kb-μ6. Moreover, the activity of 4.2 kb-μ5 was not influenced by constitutive activation of NFκB (Fig. 6D). Mouse renin CRE (TGACaTCA) differs from the consensus CRE sequence (TGACgTCA) by a single nucleotide (shown in lowercase). Therefore, we checked whether TNFα would have an effect on a 4.2-kb fragment in which renin CRE was mutated to consensus CRE sequence (plasmid 4.2 kb-CRE). The activity of 4.2 kb and 4.2 kb-CRE renin promoter constructs was similarly down-regulated by TNFα (Fig. 6E). Hence, it seems that the action of TNFα should be attributed generally to CRE rather than especially to the alternative form of CRE, which is present in the mouse renin promoter. We mutated mouse renin CRE also to a consensus NFκB binding site (GGGACTTTCC; plasmid 4.2 kb-NFκB). Unlike the constructs carrying a CRE sequence (4.2 kb and 4.2 kb-CRE) and similarly to the constructs carrying a mutated CRE sequence (4.2 kb-μ5 and 4.2 kb-μ6), the activity of the 4.2 kb-NFκB construct was almost unaffected by TNFα (Fig. 6E). We studied the effect of TNFα also on luciferase reporters driven by synthetic CRE or NFκB binding sequences. Thus, the activity of both 4.2-kb and CRE-luciferase constructs decreased about 2-fold after 8 h and was ∼3-fold suppressed after 20 h of treatment with TNFα (Fig. 7A). In contrast, the NFκB-luciferase was more than 4-fold up-regulated after 8 h and just 1.5-fold-stimulated after 20 h of incubation with TNFα (Fig. 7B), following the time course pattern of p65, which substantially determines the transcriptional activation of NFκB (compare Fig. 7B and Fig. 1C, right panel). CBP Is Not Involved in the Mechanism of Suppression of Renin Transcription by TNFα—NFκB and the CREB/ATF transcription factors, which are the consensus CRE-binding proteins, may compete for the transcriptional co-activator CBP. Therefore we knocked down CBP using RNA interference (Fig. 8," @default.
• W2009361993 created "2016-06-24" @default.
• W2009361993 creator A5017544451 @default.
• W2009361993 creator A5019250344 @default.
• W2009361993 creator A5058364242 @default.
• W2009361993 creator A5059017498 @default.
• W2009361993 creator A5070999479 @default.
• W2009361993 creator A5075333464 @default.
• W2009361993 creator A5083988482 @default.
• W2009361993 creator A5085816723 @default.
• W2009361993 date "2004-01-01" @default.
• W2009361993 modified "2023-10-18" @default.
• W2009361993 title "Tumor Necrosis Factor-α Activates NFκB to Inhibit Renin Transcription by Targeting cAMP-responsive Element" @default.
• W2009361993 cites W1485104973 @default.
• W2009361993 cites W1516457342 @default.
• W2009361993 cites W1577865037 @default.
• W2009361993 cites W1823710748 @default.
• W2009361993 cites W1978068747 @default.
• W2009361993 cites W1989558843 @default.
• W2009361993 cites W1990181136 @default.
• W2009361993 cites W1990423948 @default.
• W2009361993 cites W1993280443 @default.
• W2009361993 cites W1993583152 @default.
• W2009361993 cites W1995746843 @default.
• W2009361993 cites W1999489269 @default.
• W2009361993 cites W2000496244 @default.
• W2009361993 cites W2003306808 @default.
• W2009361993 cites W2005396212 @default.
• W2009361993 cites W2006491153 @default.
• W2009361993 cites W2016730049 @default.
• W2009361993 cites W2029209670 @default.
• W2009361993 cites W2033529039 @default.
• W2009361993 cites W2058024551 @default.
• W2009361993 cites W2064879068 @default.
• W2009361993 cites W2066836624 @default.
• W2009361993 cites W2070840393 @default.
• W2009361993 cites W2073545236 @default.
• W2009361993 cites W2073548049 @default.
• W2009361993 cites W2074297244 @default.
• W2009361993 cites W2081957169 @default.
• W2009361993 cites W2086197156 @default.
• W2009361993 cites W2109399660 @default.
• W2009361993 cites W2131864694 @default.
• W2009361993 cites W2135442422 @default.
• W2009361993 cites W2137291142 @default.
• W2009361993 cites W2137570167 @default.
• W2009361993 cites W2140446943 @default.
• W2009361993 cites W2141655045 @default.
• W2009361993 cites W2143580305 @default.
• W2009361993 cites W2147921405 @default.
• W2009361993 cites W2154907025 @default.
• W2009361993 cites W2166781237 @default.
• W2009361993 cites W2169025417 @default.
• W2009361993 cites W2171716457 @default.
• W2009361993 cites W2176899369 @default.
• W2009361993 cites W2180837906 @default.
• W2009361993 cites W2324922763 @default.
• W2009361993 cites W293684771 @default.
• W2009361993 doi "https://doi.org/10.1074/jbc.m308697200" @default.
• W2009361993 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14563845" @default.
• W2009361993 hasPublicationYear "2004" @default.
• W2009361993 type Work @default.
• W2009361993 sameAs 2009361993 @default.
• W2009361993 citedByCount "47" @default.
• W2009361993 countsByYear W20093619932012 @default.
• W2009361993 countsByYear W20093619932013 @default.
• W2009361993 countsByYear W20093619932014 @default.
• W2009361993 countsByYear W20093619932015 @default.
• W2009361993 countsByYear W20093619932018 @default.
• W2009361993 countsByYear W20093619932020 @default.
• W2009361993 countsByYear W20093619932021 @default.
• W2009361993 countsByYear W20093619932022 @default.
• W2009361993 countsByYear W20093619932023 @default.
• W2009361993 crossrefType "journal-article" @default.
• W2009361993 hasAuthorship W2009361993A5017544451 @default.
• W2009361993 hasAuthorship W2009361993A5019250344 @default.
• W2009361993 hasAuthorship W2009361993A5058364242 @default.
• W2009361993 hasAuthorship W2009361993A5059017498 @default.
• W2009361993 hasAuthorship W2009361993A5070999479 @default.
• W2009361993 hasAuthorship W2009361993A5075333464 @default.
• W2009361993 hasAuthorship W2009361993A5083988482 @default.
• W2009361993 hasAuthorship W2009361993A5085816723 @default.
• W2009361993 hasBestOaLocation W20093619931 @default.
• W2009361993 hasConcept C101762097 @default.
• W2009361993 hasConcept C104317684 @default.
• W2009361993 hasConcept C132376346 @default.
• W2009361993 hasConcept C134018914 @default.
• W2009361993 hasConcept C150194340 @default.
• W2009361993 hasConcept C1629964 @default.
• W2009361993 hasConcept C17991360 @default.
• W2009361993 hasConcept C185592680 @default.
• W2009361993 hasConcept C198710026 @default.
• W2009361993 hasConcept C2777730290 @default.
• W2009361993 hasConcept C502942594 @default.
• W2009361993 hasConcept C55493867 @default.
• W2009361993 hasConcept C62478195 @default.
• W2009361993 hasConcept C84393581 @default.
• W2009361993 hasConcept C86339819 @default.

• next