FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2009580295> ?p ?o ?g. }

• W2009580295 endingPage "21721" @default.
• W2009580295 startingPage "21718" @default.
• W2009580295 abstract "Oligonucleotides can be used to inhibit the binding of basic fibroblast growth factor to cells. Though standard phosphodiester oligonucleotides show a slight inhibition of binding, the oligonucleotides with phosphorothioate internucleoside linkages have inhibition levels equivalent to that of the polyanion heparin. Variations in sequence of the oligonucleotides does lead to differences in the inhibitory action of the oligonucleotides. This inhibition of basic fibroblast growth factor by phosphorothioate oligonucleotides may account for much of the published data on inhibition of various genes by proposed antisense oligonucleotides and needs to be taken into account when considering the mechanism of action of oligonucleotides in biological systems. Oligonucleotides can be used to inhibit the binding of basic fibroblast growth factor to cells. Though standard phosphodiester oligonucleotides show a slight inhibition of binding, the oligonucleotides with phosphorothioate internucleoside linkages have inhibition levels equivalent to that of the polyanion heparin. Variations in sequence of the oligonucleotides does lead to differences in the inhibitory action of the oligonucleotides. This inhibition of basic fibroblast growth factor by phosphorothioate oligonucleotides may account for much of the published data on inhibition of various genes by proposed antisense oligonucleotides and needs to be taken into account when considering the mechanism of action of oligonucleotides in biological systems. Oligonucleotides have been used extensively in the past several years to inhibit gene expression. Compounds are most often designed as antisense agents and, as such, have shown efficacy in cell culture and in some animal models of disease. Efficacious oligonucleotides have been used against viruses, including human cytomegalovirus, herpes simplex virus, human immunodeficiency virus, and papillomavirus, and against various cellular targets, including the oncogenes c-myc, c-myb, and c-abl(1Milligan J.F. Matteucci M.D. Martin J.C. J. Med. Chem. 1993; 36: 1923-1937Crossref PubMed Scopus (601) Google Scholar, 2Stein C.A. Cheng Y.-C. Science. 1993; 261: 1004-1012Crossref PubMed Scopus (1265) Google Scholar, 3Azad R.F. Driver V.B. Tanaka K. Crooke R.M. Anderson K.P. Antimicrob. Agents Chemother. 1993; 37: 1945-1954Crossref PubMed Scopus (179) Google Scholar, 4Ojwang J. Elbaggari A. Marshall H.B. Jayaraman K. McGrath M.A. Rando R.F. J. AIDS. 1994; 7: 560-570PubMed Google Scholar, 5Goodchild J. Agrawal S. Civeira M.P. Sarin P.S. Sun D. Zamecink P.C. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5507-5511Crossref PubMed Scopus (208) Google Scholar, 6Lisziewicz J. Sun D. Metelev V. Zamecnik P. Gallo R.C. Agrawal S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3860-3864Crossref PubMed Scopus (98) Google Scholar, 7Seth R. Shum L. Wu F. Wuenschell C. Hall F.L. Slavkin H.C. Warburton D. Dev. Biol. 1993; 158: 555-559Crossref PubMed Scopus (53) Google Scholar, 8Gao W.-Y. Hanes R.N. Vazquez-Padua M.A. Stein C.A. Cohen J.S. Cheng Y.-C. Antimicrob. Agents Chemother. 1990; 34: 808-812Crossref PubMed Scopus (67) Google Scholar, 9Fennewald S.M. Mustain S. Ojwang J. Rando R.F. Antiviral Res. 1995; 26: 37-54Crossref PubMed Scopus (21) Google Scholar, 10Cowsert L.M. Fox M.C. Zon G. Mirabelli C.K. Antimicrob. Agents Chemother. 1993; 37: 171-177Crossref PubMed Scopus (88) Google Scholar, 11Degols G. Leonetti J.-P. Mechti N. Lebleu B. Nucleic Acids Res. 1991; 19: 945-948Crossref PubMed Scopus (50) Google Scholar, 12Szczylik C. Skorski T. Nicolaides N.C. Manzella L. Malaguarnera L. Venturelli D. Gewirtz A.M. Calabretta B. Science. 1991; 253: 562-564Crossref PubMed Scopus (319) Google Scholar). In addition investigators have used anti-c-myc/-myb antisense oligonucleotides to prevent restenosis in animal models(13Shi Y. Fard A. Galeo A. Hutchinson H.G. Vermani P. Dodge G.R. Hall D.J. Shaheen F. Zalewski A. Circulation. 1994; 90: 944-951Crossref PubMed Scopus (207) Google Scholar, 14Morishita R. Gibbons G.H. Ellison K.E. Nakajima M. von der Leyen H. Zhang L. Kaneda Y. Ogihara T. Dzauk V.J. J. Clin. Invest. 1994; 93: 1458-1464Crossref PubMed Scopus (267) Google Scholar, 15Becker D. Meier C.B. Herlyn M. EMBO J. 1989; 8: 3685-3691Crossref PubMed Scopus (244) Google Scholar). Several of these compounds are progressing into human drug trials based on their proposed antisense inhibition of viral or oncogene targets in disease. Oligonucleotide therapeutics are targeted to human cytomegalovirus in retinitis, papillomavirus in genital warts, human immunodeficiency virus in AIDS, c-abl in myelogenous leukemia, and c-myc and c-myb in restenosis. At the same time, increased numbers of unexplained, nonspecific effects have been reported especially for the phosphorothioate (PS) 1The abbreviations used are: PSphosphorothioateFGFfibroblast growth factorbFGFbasic FGFODNoligodeoxynucleotide. oligonucleotides(16Yaswen P. Stampfer M.R. Ghosh K. Cohen J.S. Antisense Res. Dev. 1993; 3: 67-77Crossref PubMed Scopus (125) Google Scholar, 17Perez J.R. Li Y. Stein C.A. Majumder S. van Oorschot A. Narayanan R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 5957-5961Crossref PubMed Scopus (131) Google Scholar, 18Stein C.A. Krieg A.M. Antisense Res. Dev. 1994; 4: 67-69Crossref PubMed Scopus (218) Google Scholar, 19Gao W. Han F.S. Storm C. Egan W. Cheng Y.C. Mol. Pharmacol. 1992; 41: 223-229PubMed Google Scholar, 20Praseuth D. Guieysse A.-L. Itkes A.V. Helene C. Antisense Res. Dev. 1993; 3: 33-44Crossref PubMed Scopus (11) Google Scholar). Phosphorothioate oligonucleotides contain internucleoside linkages in which one of the nonbridging oxygen atoms has been replaced by a sulfur atom in order to enhance nuclease resistance. phosphorothioate fibroblast growth factor basic FGF oligodeoxynucleotide. Our own studies progressed from the initial use of oligonucleotides as anti-herpesvirus agents on Vero and MRC-5 cells(9Fennewald S.M. Mustain S. Ojwang J. Rando R.F. Antiviral Res. 1995; 26: 37-54Crossref PubMed Scopus (21) Google Scholar). The action of oligonucleotides against herpes simplex virus and human cytomegalovirus have been reported previously(3Azad R.F. Driver V.B. Tanaka K. Crooke R.M. Anderson K.P. Antimicrob. Agents Chemother. 1993; 37: 1945-1954Crossref PubMed Scopus (179) Google Scholar, 8Gao W.-Y. Hanes R.N. Vazquez-Padua M.A. Stein C.A. Cohen J.S. Cheng Y.-C. Antimicrob. Agents Chemother. 1990; 34: 808-812Crossref PubMed Scopus (67) Google Scholar, 9Fennewald S.M. Mustain S. Ojwang J. Rando R.F. Antiviral Res. 1995; 26: 37-54Crossref PubMed Scopus (21) Google Scholar), but the actual analysis of the data has been complicated by the ability of the oligonucleotides to operate on the exterior of the cell as inhibitors of viral adsorption. The binding of herpes simplex virus to the cell involves an initial attachment to cell surface heparan sulfate molecules and can be competed by the addition of heparin to the media(21WuDunn D. Spear P.G. J. Virol. 1989; 63: 52-58Crossref PubMed Google Scholar). Phosphorothioate oligonucleotides are particularly potent inhibitors of viral adsorption with effective concentrations in the nanomolar range(9Fennewald S.M. Mustain S. Ojwang J. Rando R.F. Antiviral Res. 1995; 26: 37-54Crossref PubMed Scopus (21) Google Scholar, 22Gao W.-Y. Jaroszewski J.W. Cohen J.S. Cheng Y.-C. J. Biol. Chem. 1990; 265: 20172-20178Abstract Full Text PDF PubMed Google Scholar). Because basic fibroblast growth factor (bFGF) binding, like herpes simplex virus adsorption, involves interaction with cell surface heparan sulfate, we investigated whether oligonucleotides would also inhibit the binding of bFGF to cells. bFGF is a member of the heparin binding family of growth factors(23Basilico C. Moscatelli D. Adv. Cancer Res. 1992; 59: 115-165Crossref PubMed Scopus (1057) Google Scholar, 24Burgess W.H. Maciag T. Annu. Rev. Biochem. 1989; 58: 575-606Crossref PubMed Google Scholar). It is a widely distributed growth factor found in all organs, solid tissues, tumors, and cultured cells examined(25Rifkin D.B. Moscatelli D. J. Cell Biol. 1989; 109: 1-6Crossref PubMed Scopus (886) Google Scholar). bFGF binds to high affinity protein receptors in association with cellular matrix heparan sulfate. This association, which is competed by the presence of exogenously added heparin, is necessary for the high affinity and functional binding of bFGF. Heparin-induced dimerization of the growth factor/receptor is required for full activity of the growth factor (26Spivak-Kroizman T. Lemmon M.A. Dikic I. Ladbury J.E. Pinchasi D. Huang J. Jaye M. Crumley G. Schlessinger J. Lax I. Cell. 1994; 79: 1015-1024Abstract Full Text PDF PubMed Scopus (596) Google Scholar). Heparin and heparin subfragments can be used to inhibit the biological activity of FGF(27Rapraeger A.C. Krufka A. Olwin B.B. Science. 1991; 252: 1705-1707Crossref PubMed Scopus (1292) Google Scholar, 28Ishihara M. Tyrrell D.J. Stauber G.B. Brown S. Cousens L.S. Stack R.J. J. Biol. Chem. 1993; 268: 4675-4683Abstract Full Text PDF PubMed Google Scholar), although it may not be required for all of the FGF effects(29Moscatelli D. J. Cell. Physiol. 1987; 131: 123-130Crossref PubMed Scopus (532) Google Scholar). The bFGF receptors are members of the group of tyrosine kinase receptors capable of autophosphorylation and dimerization; it is this dimerization that results in an increase in receptor/ligand interaction and signal transduction(30Ullrich A. Schlessinger J. Cell. 1990; 61: 203-212Abstract Full Text PDF PubMed Scopus (4619) Google Scholar, 31Klagsbrun M. Baird A. Cell. 1991; 67: 229-231Abstract Full Text PDF PubMed Scopus (498) Google Scholar). In this model of bFGF receptor activity, exogenously added heparin competes with cell surface heparan sulfate and inhibits bFGF activity through the disruption of the dimerization of the receptor. This is similar in concept to the disruption of ligand binding to receptors by the uncoupling of the receptor and the G protein complex for those receptors, which signal through G protein complex formation(32Gilman A.G. Annu. Rev. Biochem. 1987; 56: 615-624Crossref PubMed Scopus (4728) Google Scholar, 33Huang R.-R.C. Dehaven R.N. Cheung A.H. Diehl R.E. Dixon R.A.F. Strader C.D. Mol. Pharmacol. 1990; 37: 304-310PubMed Google Scholar). FGF binding/dimerization and signaling results in a variety of cellular responses including myc, fos, collagenase, and platelet-derived growth factor receptor up-regulation, increases in intracellular pH, hydrolysis of polyphosphoinositol, and phosphorylation of cellular proteins. It induces growth in various cell types including astrocytes, glioma cells, fibroblasts, and, in synergy with hematopoietic growth factors, stem cells. In animal models it is most directly connected with angiogenesis and wound healing. Our studies show that oligonucleotides, especially PS oligonucleotides, are able to inhibit bFGF binding to cells. These observations on bFGF and oligonucleotides, taken together, indicate that although the oligonucleotides studied to date may have therapeutic potential, their level of biologic activity may not be due to the original rational “antisense” design. 125I-bFGF was obtained from DuPont, unlabeled bFGF was obtained from Life Technologies Inc., Vero cells were obtained from the ATCC, and heparin was obtained from Sigma. Oligonucleotides were synthesized on an Applied Biosystems Inc. DNA synthesizer model 380B or 394, using standard phosphoramidite methods. 5′-protected nucleoside phosphoramidite monomers and other reagents were obtained from Milligen with the exception of acetonitrile, which was obtained from Baxter. All oligonucleotides were synthesized with a 3′ Amino Modifier (Glen Research), which results in the covalent attachment of a propanolamine group to the 3′-hydroxl group(34Nelson P.S. Frye R.A. Liu E. Nucleic Acids Res. 1989; 17: 7187-7191Crossref PubMed Scopus (53) Google Scholar, 35Durland R.H. Kessler D.J. Gunnell S. Duvic M. Pettitt B.M. Hogan M.E. Biochemistry. 1991; 30: 9246-9255Crossref PubMed Scopus (256) Google Scholar). Phosphorothioate-containing oligonucleotides were prepared using the sulfurizing agent TETD, which produces a random mixture of R and S isomers(36Vu H. Hirschbein B.L. Tetrahedron Lett. 1991; 32: 3005-3008Crossref Scopus (147) Google Scholar). The purity of the oligonucleotides was confirmed by analytical high pressure liquid chromatography, electrophoresis of 32P-labeled oligonucleotide on a polyacrylamide gel, or capillary gel electrophoresis. The oligodeoxynucleotides (ODNs) used were: ODN-1 (GTGGTGGTGGTGTTGGTGGTGGTTTGGGGGGTGGGG), ODN-3 (GATCCATGTCAGTGACACTGCGTAGATCCGATGATC), and ODN-4 (GGGTGGGTGGGG). ODN1, ODN-3 and ODN-4 contain phosphorothioate linkages. ODN-2 has a sequence identical to ODN-1 but contains phosphodiester linkages. ODN-5 (GsGsCsToGoCsCoAsToGoGoTsCsCsC) and ODN-6 (GsGsGsAoCoCsAoTsGoGoCoAsGsCsC) contain both phosphodiester and phosphorothioate linkages (designated “o” and “s” in the sequence, respectively). The binding of 125I-bFGF to Vero cell low and high affinity receptors was assayed according to published protocols(29Moscatelli D. J. Cell. Physiol. 1987; 131: 123-130Crossref PubMed Scopus (532) Google Scholar). Briefly, confluent monolayers of Vero cells in 24-well plates were incubated for 2 h at 4°C with 125I-bFGF. The cells were rinsed twice with phosphate-buffered saline, and the low affinity bound bFGF was removed with 2 M NaCl/20 mM Hepes, pH 7.5, and counted in a Packard liquid scintillation counter. The high affinity receptor bound bFGF was subsequently removed with 2 M NaCl/20 mM sodium acetate, pH 4, and counted. For competition experiments, 125I-bFGF was used at 2.5 ng/ml and mixed with the desired amount of competitor approximately 30 min before addition to cells. For saturation binding of 125I-bFGF to Vero cells in the presence of oligonucleotide and heparin, binding assays were performed using varying amounts of 125I-bFGF and 100 μg/ml heparin, 0.6 μM (7 μg/ml) ODN-1, or 20 μM (78 μg/ml) ODN-4. For high affinity-specific binding, background values obtained from competition with a 100-fold excess of unlabeled bFGF (mixed with 125I-bFGF prior to the addition to cells) were subtracted before further analysis. bFGF binding to cells is assayed by the incubation of radiolabeled bFGF with cell monolayers with subsequent wash conditions able to distinguish the low affinity heparan sulfate binding from the high affinity protein receptor-specific binding(29Moscatelli D. J. Cell. Physiol. 1987; 131: 123-130Crossref PubMed Scopus (532) Google Scholar). The bFGF bound to the heparan sulfate is removed with 2 M NaCl at neutral pH. This heparan sulfate binding is not saturated and is not competed away at 100-fold concentrations of unlabeled bFGF. It is however competed away by exogenous heparin or by the addition of other polyanions such as pentosan polysulfate and suramin. Phosphorothioate oligonucleotides can also act as appropriate polyanions and inhibit the low affinity heparan sulfate binding of bFGF (Fig. 1A) at submicromolar (0.6 μM) concentrations. The bFGF bound to the high affinity receptors is then removed from the cells with a subsequent low pH rinse. It is this high affinity binding that is specific for the bFGF receptor proteins. This high affinity receptor binding is effectively competed away with unlabeled bFGF (Fig. 1B). Heparan sulfate binding is necessary for the dimerization of the bFGF receptor; therefore, an inhibition of the bFGF low affinity heparan sulfate binding results in a change in the binding to the high affinity protein receptor. The binding constant has been reported to shift from 50 pM with heparan sulfate involvement to 175 pM without such involvement (37Roghani M. Mansukhani A. Dell'Era P. Bellosta P. Basilico C. Rifkin D.B. Moscatelli D. J. Biol. Chem. 1994; 269: 3976-3984Abstract Full Text PDF PubMed Google Scholar). If the bFGF concentration is kept low, then only the high affinity receptor binding resulting from dimerization is detected; the concentration of bFGF is not sufficient for the receptor binding that occurs in the absence of dimerization. Both heparin and PS oligonucleotides inhibit high affinity binding under such conditions (Fig. 1B). When a standard saturation curve is plotted, the difference in binding over an increasing range of bFGF concentrations is seen for both the high and low affinity receptors (Fig. 2). The binding to the high affinity receptors increases more slowly in the presence of the oligonucleotides or heparin, approaching a plateau only at higher concentrations. The concentrations are too low to saturate the binding in the presence of heparin or PS oligonucleotides. At higher bFGF concentrations the bFGF may bind in the presence of heparin, but this binding is not expected to result in signal transduction due to the inability of the receptors to dimerize. It has been shown that although cell surface heparan sulfate is not required for receptor specific binding, it does increase the affinity of basic bFGF for its receptor and facilitates dimerization and activity of FGF (37Roghani M. Mansukhani A. Dell'Era P. Bellosta P. Basilico C. Rifkin D.B. Moscatelli D. J. Biol. Chem. 1994; 269: 3976-3984Abstract Full Text PDF PubMed Google Scholar, 38Ornitz D.M. Yayon A. Flanagan J.G. Svahn C.M. Levi E. Leder P. Mol. Cell. Biol. 1992; 12: 240-247Crossref PubMed Scopus (562) Google Scholar Because a variation in the effect of different antisense oligonucleotides is seen when they are assayed for efficacy in the various systems employed, we tested a variety of different oligonucleotides to determine if this variability could be attributed to differences in bFGF binding inhibition. A series of competition experiments was performed in which the concentration of 125I-bFGF was kept constant while the dose of oligonucleotide used in competition was varied. In this way the relative binding affinities of the various oligonucleotides could be compared. Representative results are shown (Fig. 3). Though unlabeled bFGF competed for binding at only the high affinity receptors, as expected, the oligonucleotides and heparin showed similar competition at both the low and the high affinity binding sites. Although the oligonucleotides varied in their ability to block bFGF binding, we were unable to distinguish any sequence or structure that was responsible. The concentration at which 50% of the high affinity binding was inhibited (ID50) was calculated for several representative oligonucleotides and in several conditions (Table 1). The PS oligonucleotides were consistently competitive at lower concentrations than the phosphodiester or partial phosphorothioate oligonucleotides, though the phosphodiester oligonucleotides did have some effect at concentrations greater than 10 μM. A comparison of PS oligonucleotides of various lengths (12-36 bases) showed no direct correlation of length to ID50, but the exact sequence did influence bFGF binding inhibition; two PS oligonucleotides (ODN-1 and ODN-3) of identical length but different sequence both diminish bFGF binding, but the ID50 values differ by 10-fold. The oligonucleotides we used that were composed of G's and T's were generally more effective than mixed sequences, but no firm rules could be established for predicting the relative binding inhibition of the phosphorothioates. The oligonucleotides and heparin are both polymeric anions, but the phosphorothioate modification of the oligonucleotide backbone presumably causes a change in charge or secondary structure that renders the oligonucleotides even more effective in their inhibition of bFGF binding.Tabled 1 Open table in a new tab In an effort to more closely mimic the various antisense experiments, we also varied the time of addition and incubation of the oligonucleotide. In the standard protocol, the oligonucleotides were mixed with the bFGF prior to the addition to the cells. If the oligonucleotide was preincubated with the cells, instead of with the growth factor, the ID50 was only slightly higher (Table 1). The ID50 was significantly higher if the oligonucleotide was removed prior to the addition of the bFGF but was still less than 5 μM. Although there is some variation in the extent of bFGF inhibition depending on whether the growth factor or the cells are preincubated with oligonucleotide, there is a significant level of activity against bFGF under the conditions of most antisense assays. It should be kept in mind that many cell lines synthesize and secrete bFGF and that endogenously produced bFGF may have significant effect on cell growth and gene expression even in the absence of exogenously added growth factor. Under such conditions there is no possibility of separating the presence of oligonucleotide and bFGF by washing, and the full effect of the binding inhibition may be seen. Inhibition of bFGF binding by phosphorothioate oligonucleotides may account for some of the experimental results attributed in the literature to antisense mechanisms. Antisense experiments often report results using concentrations of PS oligonucleotides in the range of 0.1-50 μM, which we would expect to influence bFGF binding. The 10-fold variation in the activity of the PS oligonucleotides is in the same range as the specific/nonspecific activity of antisense and control oligonucleotides reported for gene disruption experiments. This would be especially true when the assays are for those activities known to be influenced by bFGF, including myc and fos regulation, platelet-derived growth factor and bFGF receptor regulation, hematopoiesis, and cell growth, especially that of vascular smooth muscle cells. Other cellular factors known to interact with polymers include granulocyte macrophage-stimulating factor, interleukin-3, pleitrophin, and platelet factor 4(39Ruoslahti E. Yamaguchi Y. Cell. 1991; 64: 867-869Abstract Full Text PDF PubMed Scopus (1171) Google Scholar), as well the entire family of heparin binding growth factors. Any or all of these (and other factors) may be affected in their interaction with cells by polyanions such as PS oligonucleotides. Recently, it has been reported that at least some PS oligonucleotides exert their effect by inhibiting the extracellular binding of interferon gamma (40Ramanathan M. Lantz M. MacGregor R.D. Garavoy M.R. Hunt C.A. J. Biol. Chem. 1994; 269: 24564-24574Abstract Full Text PDF PubMed Google Scholar) or by inhibiting the autophosphorylation of the bcr-abl tyrosine kinase(41Bergan R.A. Connell Y. Fahmy B. Kyle E. Neckers L. Nucleic Acids Res. 1994; 22: 2150-2154Crossref PubMed Scopus (56) Google Scholar). Interpretation of antisense data must be made in light of this effect of polyanions on extracellular binding. In particular, the inhibition of vascular smooth muscle cell growth by antisense oligonucleotides has progressed rapidly into the effective use of these molecules in animal models of restenosis. Although the proposed mechanism of action of these compounds has been as antisense inhibitors of myc or myb, the simpler explanation is that they are acting, like heparin, as growth factor inhibitors. Heparin and its low molecular weight subfragments have been shown to be potent vascular smooth muscle cell growth inhibitors in vitro(42Clowes A.W. Karnovsky M.J. Nature. 1977; 265: 625-626Crossref PubMed Scopus (625) Google Scholar), are active in animal models of restenosis, and have been used in human clinical trials (43Schmid K.M. Preisack M. Voelker W. Sujatta M. Karsch K.R. Semin. Thromb. Hemostasis. 1993; 19: 155-159PubMed Google Scholar, 44More R.S. Brack M.J. Gershlick A.H. Eur. Heart J. 1993; 14: 1543-1547Crossref PubMed Scopus (7) Google Scholar, 45Edelman E.R. Karnovsky M.J. Circulation. 1994; 89: 770-776Crossref PubMed Scopus (94) Google Scholar). The interpretation of the results of these cell culture and animal trials of antisense therapeutics for restenosis and other indications should be made in light of the similarity in action between polyanions, heparin, and PS oligonucleotides on the action of growth factors" @default.
• W2009580295 created "2016-06-24" @default.
• W2009580295 creator A5027059891 @default.
• W2009580295 creator A5088289645 @default.
• W2009580295 date "1995-09-01" @default.
• W2009580295 modified "2023-09-29" @default.
• W2009580295 title "Inhibition of High Affinity Basic Fibroblast Growth Factor Binding by Oligonucleotides" @default.
• W2009580295 cites W1234513633 @default.
• W2009580295 cites W1458660061 @default.
• W2009580295 cites W1486918734 @default.
• W2009580295 cites W1502851840 @default.
• W2009580295 cites W1504197390 @default.
• W2009580295 cites W1636802518 @default.
• W2009580295 cites W1686153396 @default.
• W2009580295 cites W1854803455 @default.
• W2009580295 cites W1927596245 @default.
• W2009580295 cites W1968673310 @default.
• W2009580295 cites W1970650788 @default.
• W2009580295 cites W1977798903 @default.
• W2009580295 cites W1979403186 @default.
• W2009580295 cites W1980891114 @default.
• W2009580295 cites W1988369548 @default.
• W2009580295 cites W1988460287 @default.
• W2009580295 cites W1998919839 @default.
• W2009580295 cites W2003601107 @default.
• W2009580295 cites W2006641366 @default.
• W2009580295 cites W2006776801 @default.
• W2009580295 cites W2008980811 @default.
• W2009580295 cites W2011938900 @default.
• W2009580295 cites W2014096646 @default.
• W2009580295 cites W2032359283 @default.
• W2009580295 cites W2033702973 @default.
• W2009580295 cites W2038870579 @default.
• W2009580295 cites W2050014764 @default.
• W2009580295 cites W2054703329 @default.
• W2009580295 cites W2058525519 @default.
• W2009580295 cites W2078571233 @default.
• W2009580295 cites W2080875376 @default.
• W2009580295 cites W2083862437 @default.
• W2009580295 cites W2090394485 @default.
• W2009580295 cites W2092356678 @default.
• W2009580295 cites W2099543104 @default.
• W2009580295 cites W2135948311 @default.
• W2009580295 cites W2152855538 @default.
• W2009580295 cites W2156730019 @default.
• W2009580295 cites W2159380570 @default.
• W2009580295 cites W2184197616 @default.
• W2009580295 doi "https://doi.org/10.1074/jbc.270.37.21718" @default.
• W2009580295 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7665590" @default.
• W2009580295 hasPublicationYear "1995" @default.
• W2009580295 type Work @default.
• W2009580295 sameAs 2009580295 @default.
• W2009580295 citedByCount "77" @default.
• W2009580295 countsByYear W20095802952013 @default.
• W2009580295 countsByYear W20095802952014 @default.
• W2009580295 countsByYear W20095802952015 @default.
• W2009580295 countsByYear W20095802952016 @default.
• W2009580295 countsByYear W20095802952017 @default.
• W2009580295 countsByYear W20095802952018 @default.
• W2009580295 crossrefType "journal-article" @default.
• W2009580295 hasAuthorship W2009580295A5027059891 @default.
• W2009580295 hasAuthorship W2009580295A5088289645 @default.
• W2009580295 hasBestOaLocation W20095802951 @default.
• W2009580295 hasConcept C129312508 @default.
• W2009580295 hasConcept C185592680 @default.
• W2009580295 hasConcept C552990157 @default.
• W2009580295 hasConcept C55493867 @default.
• W2009580295 hasConcept C86803240 @default.
• W2009580295 hasConcept C95444343 @default.
• W2009580295 hasConceptScore W2009580295C129312508 @default.
• W2009580295 hasConceptScore W2009580295C185592680 @default.
• W2009580295 hasConceptScore W2009580295C552990157 @default.
• W2009580295 hasConceptScore W2009580295C55493867 @default.
• W2009580295 hasConceptScore W2009580295C86803240 @default.
• W2009580295 hasConceptScore W2009580295C95444343 @default.
• W2009580295 hasIssue "37" @default.
• W2009580295 hasLocation W20095802951 @default.
• W2009580295 hasOpenAccess W2009580295 @default.
• W2009580295 hasPrimaryLocation W20095802951 @default.
• W2009580295 hasRelatedWork W1531601525 @default.
• W2009580295 hasRelatedWork W2023215337 @default.
• W2009580295 hasRelatedWork W2034979205 @default.
• W2009580295 hasRelatedWork W2038780389 @default.
• W2009580295 hasRelatedWork W2083486663 @default.
• W2009580295 hasRelatedWork W2793178632 @default.
• W2009580295 hasRelatedWork W2899084033 @default.
• W2009580295 hasRelatedWork W2950980724 @default.
• W2009580295 hasRelatedWork W4308616295 @default.
• W2009580295 hasRelatedWork W2778153218 @default.
• W2009580295 hasVolume "270" @default.
• W2009580295 isParatext "false" @default.
• W2009580295 isRetracted "false" @default.
• W2009580295 magId "2009580295" @default.
• W2009580295 workType "article" @default.