FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2010221489> ?p ?o ?g. }

• W2010221489 endingPage "367" @default.
• W2010221489 startingPage "358" @default.
• W2010221489 abstract "Patt1 is a newly identified protein acetyltransferase that is highly expressed in liver. However, the role of Patt1 in liver is still unclear. We generated Patt1 liver-specific knockout (LKO) mice and mainly measured the effect of hepatic Patt1 deficiency on lipid metabolism. Hepatic Patt1 deficiency in male mice markedly decreases fat mass and dramatically alleviates age-associated accumulation of lipid droplets in liver. Moreover, hepatic Patt1 abrogation in male mice significantly reduces the liver triglyceride and free fatty acid levels, but it has no effect on liver cholesterol level, liver weight, and liver function. Consistently, primary cultured Patt1-deficient hepatocytes are resistant to palmitic acid-induced lipid accumulation, but hepatic Patt1 deficiency fails to protect male mice from high-fat diet-induced hepatic steatosis. Further studies show that hepatic Patt1 deficiency decreases fatty acid uptake, reduces lipid synthesis, and enhances fatty acid oxidation, which may contribute to the attenuated hepatic steatosis in Patt1 LKO mice. These results demonstrate that Patt1 plays an important role in hepatic lipid metabolism and have implications toward resolving age-associated hepatic steatosis. Patt1 is a newly identified protein acetyltransferase that is highly expressed in liver. However, the role of Patt1 in liver is still unclear. We generated Patt1 liver-specific knockout (LKO) mice and mainly measured the effect of hepatic Patt1 deficiency on lipid metabolism. Hepatic Patt1 deficiency in male mice markedly decreases fat mass and dramatically alleviates age-associated accumulation of lipid droplets in liver. Moreover, hepatic Patt1 abrogation in male mice significantly reduces the liver triglyceride and free fatty acid levels, but it has no effect on liver cholesterol level, liver weight, and liver function. Consistently, primary cultured Patt1-deficient hepatocytes are resistant to palmitic acid-induced lipid accumulation, but hepatic Patt1 deficiency fails to protect male mice from high-fat diet-induced hepatic steatosis. Further studies show that hepatic Patt1 deficiency decreases fatty acid uptake, reduces lipid synthesis, and enhances fatty acid oxidation, which may contribute to the attenuated hepatic steatosis in Patt1 LKO mice. These results demonstrate that Patt1 plays an important role in hepatic lipid metabolism and have implications toward resolving age-associated hepatic steatosis. Nonalcoholic fatty liver disease (NAFLD) is recognized increasingly as a major health burden (1Ekstedt M. Franzen L.E. Mathiesen U.L. Thorelius L. Holmqvist M. Bodemar G. Kechagias S. Long-term follow-up of patients with NAFLD and elevated liver enzymes.Hepatology. 2006; 44: 865-873Crossref PubMed Scopus (1792) Google Scholar, 2Farrell G.C. Larter C.Z. Nonalcoholic fatty liver disease: from steatosis to cirrhosis.Hepatology. 2006; 43: S99-S112Crossref PubMed Scopus (1961) Google Scholar–3de Alwis N.M. Day C.P. Non-alcoholic fatty liver disease: the mist gradually clears.J. Hepatol. 2008; 48 (Suppl. 1): S104-S112Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar). It is one of the most common causes of chronic liver disease, including cirrhosis, hepatocellular carcinoma, and liver failure. The prevalence of NAFLD increases with age, obesity, type 2 diabetes, and hypertriglyceridemia (4Bedogni G. Miglioli L. Masutti F. Tiribelli C. Marchesini G. Bellentani S. Prevalence of and risk factors for nonalcoholic fatty liver disease: the Dionysos nutrition and liver study.Hepatology. 2005; 42: 44-52Crossref PubMed Scopus (1022) Google Scholar). Hepatic steatosis is an early stage of NAFLD, and its prevalence also increases with age, obesity, type 2 diabetes, and hyperlipidemia (5Perez-Daga J.A. Santoyo J. Suarez M.A. Fernandez-Aguilar J.A. Ramirez C. Rodriguez-Canete A. Aranda J.M. Sanchez-Perez B. Montiel C. Palomo D. et al.Influence of degree of hepatic steatosis on graft function and postoperative complications of liver transplantation.Transplant. Proc. 2006; 38: 2468-2470Crossref PubMed Scopus (63) Google Scholar, 6Angulo P. Nonalcoholic fatty liver disease.N. Engl. J. Med. 2002; 346: 1221-1231Crossref PubMed Scopus (4149) Google Scholar). Aged mice under standard diet conditions or mice fed a high-fat diet will develop hepatic steatosis (7de Jesus B.B. Schneeberger K. Vera E. Tejera A. Harley C.B. Blasco M.A. The telomerase activator TA-65 elongates short telomeres and increases health span of adult/old mice without increasing cancer incidence.Aging Cell. 2011; 10: 604-621Crossref PubMed Scopus (206) Google Scholar). Hepatic steatosis occurs as a result of excessive triglyceride accumulation in liver cells. The mechanisms of excessive hepatic triglyceride accumulation involve increased fat absorption, enhanced fat synthesis, reduced fat oxidation, and/or reduced fat export (8Postic C. Girard J. Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice.J. Clin. Invest. 2008; 118: 829-838Crossref PubMed Scopus (906) Google Scholar). However, the more detailed molecular mechanisms of hepatic steatosis need further investigation. Many treatments for hepatic steatosis have been studied. Treatment strategies for NAFLD have revolved around identification and treatment of associated metabolic conditions such as diabetes and hyperlipidemia (9Adams L.A. Angulo P. Treatment of non-alcoholic fatty liver disease.Postgrad. Med. J. 2006; 82: 315-322Crossref PubMed Scopus (212) Google Scholar). Increasing evidence suggests that medications used for type 2 diabetes, such as metformin and thiazolidinediones, may confer a therapeutic benefit in NAFLD (10Ahmed M.H. Byrne C.D. Current treatment of non-alcoholic fatty liver disease.Diabetes Obes. Metab. 2009; 11: 188-195Crossref PubMed Scopus (65) Google Scholar). Currently, the known effective treatment for NAFLD is modest calorie restriction and gradual weight loss (11Arendt B.M. Allard J.P. Effect of atorvastatin, vitamin E and C on nonalcoholic fatty liver disease: is the combination required?.Am. J. Gastroenterol. 2011; 106: 78-80Crossref PubMed Scopus (34) Google Scholar, 12Ahmed M.H. Abu E.O. Byrne C.D. Non-alcoholic fatty liver disease (NAFLD): new challenge for general practitioners and important burden for health authorities?.Prim. Care Diabetes. 2010; 4: 129-137Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). New molecular mechanisms targeting the treatment of NAFLD need further investigation (13Musso G. Gambino R. Cassader M. Emerging molecular targets for the treatment of nonalcoholic fatty liver disease.Annu. Rev. Med. 2010; 61: 375-392Crossref PubMed Scopus (78) Google Scholar). Lipid metabolism can be regulated by posttranslational modification, such as phosphorylation, ubiquitination, and acetylation (14van Beekum O. Fleskens V. Kalkhoven E. Posttranslational modifications of PPAR-gamma: fine-tuning the metabolic master regulator.Obesity (Silver Spring). 2009; 17: 213-219Crossref PubMed Scopus (121) Google Scholar, 15Guan K.L. Xiong Y. Regulation of intermediary metabolism by protein acetylation.Trends Biochem. Sci. 2011; 36: 108-116Abstract Full Text Full Text PDF PubMed Scopus (271) Google Scholar). Protein acetylation has emerged as a very important posttranslational modification in cellular metabolism regulation (16Zhao S. Xu W. Jiang W. Yu W. Lin Y. Zhang T. Yao J. Zhou L. Zeng Y. Li H. et al.Regulation of cellular metabolism by protein lysine acetylation.Science. 2010; 327: 1000-1004Crossref PubMed Scopus (1458) Google Scholar); it is a dynamic process catalyzed by deacetylases and acetyltransferases. Liver-specific deletion of SIRT1, an NAD+-dependent deacetylase, impairs fatty acid oxidation and results in hepatic steatosis (17Purushotham A. Schug T.T. Xu Q. Surapureddi S. Guo X. Li X. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation.Cell Metab. 2009; 9: 327-338Abstract Full Text Full Text PDF PubMed Scopus (829) Google Scholar). Mice lacking SIRT3 exhibit hepatic fatty-acid oxidation disorders during fasting (18Hirschey M.D. Shimazu T. Goetzman E. Jing E. Schwer B. Lombard D.B. Grueter C.A. Harris C. Biddinger S. Ilkayeva O.R. et al.SIRT3 regulates mitochondrial fatty-acid oxidation by reversible enzyme deacetylation.Nature. 2010; 464: 121-125Crossref PubMed Scopus (1194) Google Scholar). Hepatic-specific disruption of another deacetylase SIRT6 in mice results in fatty liver formation due to enhanced glycolysis and triglyceride synthesis (19Kim H.S. Xiao C. Wang R.H. Lahusen T. Xu X. Vassilopoulos A. Vazquez-Ortiz G. Jeong W.I. Park O. Ki S.H. et al.Hepatic-specific disruption of SIRT6 in mice results in fatty liver formation due to enhanced glycolysis and triglyceride synthesis.Cell Metab. 2010; 12: 224-236Abstract Full Text Full Text PDF PubMed Scopus (383) Google Scholar). Acetyltransferases are involved in many metabolic processes, including lipid metabolism. The p300 acetyltransferase has been reported to activate lipogenesis through histone acetylation (20Bricambert J. Miranda J. Benhamed F. Girard J. Postic C. Dentin R. Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice.J. Clin. Invest. 2010; 120: 4316-4331Crossref PubMed Scopus (217) Google Scholar). It has been reported that p300 can acetylate and stabilize sterol-regulatory element binding protein (SREBP), a key regulator in lipid metabolism (21Giandomenico V. Simonsson M. Gronroos E. Ericsson J. Coactivator-dependent acetylation stabilizes members of the SREBP family of transcription factors.Mol. Cell. Biol. 2003; 23: 2587-2599Crossref PubMed Scopus (188) Google Scholar, 22You M. Liang X. Ajmo J.M. Ness G.C. Involvement of mammalian sirtuin 1 in the action of ethanol in the liver.Am. J. Physiol. Gastrointest. Liver Physiol. 2008; 294: G892-G898Crossref PubMed Scopus (162) Google Scholar), and can acetylate peroxisome proliferator-activated receptor (PPAR)γ, which activates the transcription of multiple genes involved in lipid metabolism (23Gelman L. Zhou G. Fajas L. Raspe E. Fruchart J.C. Auwerx J. p300 interacts with the N- and C-terminal part of PPARgamma2 in a ligand-independent and -dependent manner, respectively.J. Biol. Chem. 1999; 274: 7681-7688Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). The acetyltransferase GCN5 has been reported to acetylate peroxisome proliferative activated receptor γ, coactivator 1 β (PGC-1β) and repress the expression of its target genes involved in glucose and lipid metabolism (24Kelly T.J. Lerin C. Haas W. Gygi S.P. Puigserver P. GCN5-mediated transcriptional control of the metabolic coactivator PGC-1beta through lysine acetylation.J. Biol. Chem. 2009; 284: 19945-19952Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Another study reported that glucocorticoid treatment induces the acetylation of C/EBPβ by PCAF/GCN5 and thus switches on the transcription of genes involved in preadipocyte differentiation (25Wiper-Bergeron N. Salem H.A. Tomlinson J.J. Wu D. Hache R.J. Glucocorticoid-stimulated preadipocyte differentiation is mediated through acetylation of C/EBPbeta by GCN5.Proc. Natl. Acad. Sci. USA. 2007; 104: 2703-2708Crossref PubMed Scopus (96) Google Scholar). Acetyltransferase PCAF has also been reported to acetylate and stabilize β-catenin (26Ge X. Jin Q. Zhang F. Yan T. Zhai Q. PCAF acetylates {beta}-catenin and improves its stability.Mol. Biol. Cell. 2009; 20: 419-427Crossref PubMed Scopus (94) Google Scholar), and the hepatic β-catenin activity affects lipid metabolism and hepatic triglyceride concentration (27Liu H. Fergusson M.M. Wu J.J. Rovira I.I. Liu J. Gavrilova O. Lu T. Bao J. Han D. Sack M.N. et al.Wnt signaling regulates hepatic metabolism.Sci. Signal. 2011; 4: ra6Crossref PubMed Scopus (138) Google Scholar). Although some acetyltransferases have been shown to be involved in the regulation of lipid metabolism, acetyltransferases involved in hepatic lipid metabolism remain to be identified. Patt1 is a newly identified acetyltransferase belonging to the GCN5-related N-acetyltransferase (GNAT) family, and it is highly expressed in mouse liver (28Liu Z. Liu Y. Wang H. Ge X. Jin Q. Ding G. Hu Y. Zhou B. Chen Z. Zhang B. et al.Patt1, a novel protein acetyltransferase that is highly expressed in liver and downregulated in hepatocellular carcinoma, enhances apoptosis of hepatoma cells.Int. J. Biochem. Cell Biol. 2009; 41: 2528-2537Crossref PubMed Scopus (30) Google Scholar). To investigate the role of Patt1 in liver, we used a Cre-loxP strategy to delete Patt1 specifically in liver. Our results show that liver-specific Patt1 knockout in male mice decreases fatty acid uptake, reduces lipid synthesis, enhances fatty acid oxidation, and protects mice from age-associated hepatic steatosis. All animals were maintained and used in accordance with the guidelines of the Institutional Animal Care and Use Committee of the Institute for Nutritional Sciences. C57BL/6 mice were purchased from Slac (Shanghai, China). Animals had free access to water and were fed chow with 10% kcal% fat (D12450B, Research Diets) or high-fat diet (HFD) with 45% kcal% fat (D12491, Research Diets). Mice with an albumin promoter–driven Cre transgene were obtained from Jackson Laboratory and genotyped as described by Jackson Laboratory. For HFD-induced hepatic steatosis, male mice at the age of 8 weeks were fed HFD for 14 weeks. After fasting for 6 h, animals at the indicated age were euthanized. The livers were quickly removed, snap-frozen in liquid nitrogen, and stored at −80°C for various measurements. Blood samples were obtained simultaneously for serum measurements. The Patt1 genomic DNA was isolated from a 129/SvJ mouse genomic library and used to construct the Patt1 targeting vector by standard techniques. The Patt1+/lox mice have two loxP sites inserted flanking exons 5–8 of Patt1 gene, which encode part of the Patt1 acetyltransferase domain. The Patt1+/lox lines from ES cells of 129/SvJ mouse strain were crossed with C57BL/6 mice for at least five generations. Then the Patt1+/lox mice were interbred to generate homozygous mice Patt1lox/lox, which were crossed with the mice carrying an albumin promoter–driven Cre transgene to get the double heterozygous mice Patt1+/lox, Cre+/−. Subsequently, the Patt1+/lox, Cre+/− mice were interbred to obtain Patt1lox/lox, Cre+/− mice, and which were crossed with Patt1lox/lox mice to obtain sufficient Patt1 liver-specific knockout (LKO) mice Patt1lox/lox, Cre+/− and littermate control mice Patt1lox/lox for this study. The primers for Patt1 transgenic genotyping were AATCATGGCGCCTATCAGTT and GTTTGGCTCCCTGAGTCAAG. Total body fat and lean mass of mice were measured by an NMR spectroscopy (Minispec Mq7.5; Bruker). Body weight was monitored from the age of 5 to 17 weeks, and food intake was monitored from the age of 15 to 17 weeks. Glucose and insulin tolerance tests were performed as previously described (29Sun C. Zhang F. Ge X. Yan T. Chen X. Shi X. Zhai Q. SIRT1 improves insulin sensitivity under insulin-resistant conditions by repressing PTP1B.Cell Metab. 2007; 6: 307-319Abstract Full Text Full Text PDF PubMed Scopus (618) Google Scholar). In brief, glucose tolerance tests were performed on mice fasted for 12 h, and insulin tolerance tests on mice fasted for 6 h. After fasting, the mice were injected with either 2 g/kg of glucose or 0.75 U/kg of human insulin (Lilly) into the peritoneal cavity. Blood glucose levels were measured at the indicated time points from tail blood using the FreeStyle blood glucose monitoring system (TheraSense). Serum alanine transaminase (ALT) and aspartate transaminase (AST) were determined using enzymatic assay kits (Shensuo Unf Medical Diagnostics Articles Co., Shanghai, China). Acetyl-CoA carboxylase (ACC) activity was measured by coupling with pyruvate kinase and lactate dehydrogenase to monitor the formation of NAD as previously described (30Blanchard C.Z. Lee Y.M. Frantom P.A. Waldrop G.L. Mutations at four active site residues of biotin carboxylase abolish substrate-induced synergism by biotin.Biochemistry. 1999; 38: 3393-3400Crossref PubMed Scopus (64) Google Scholar). Briefly, 2 µl of liver lysates at the protein concentration of 10 µg/µl were incubated with 50 µl reaction buffer containing 10 mM NaHCO3, 0.4 mM NADH, 3 mM ATP, 0.4 mM acetyl-CoA, 20 U/ml pyruvate kinase (Sigma), 40 U/ml lactate dehydrogenase (Sigma), 0.5 mM phosphoenolpyruvate, 8 mM MgCl2, and 100 mM HEPES at pH 8.0. The absorbance at 340 nm was monitored in a 384-well plate at 37°C for 15 min. Carnitine palmitoyltransferase-1 (CPT-1) activity was measured by coupling to CoASH release and its reaction with 4,4’-dipyridyldisulfide as previously described (31Ramsay R.R. Derrick J.P. Friend A.S. Tubbs P.K. Purification and properties of the soluble carnitine palmitoyltransferase from bovine liver mitochondria.Biochem. J. 1987; 244: 271-278Crossref PubMed Scopus (32) Google Scholar). In brief, liver mitochondria were isolated from fresh mouse liver using a tissue mitochondria isolation kit (Beyotime Institute of Biotechnology, China). Briefly, 4 µl of the isolated liver mitochondria at the protein concentration of 5 µg/µl were incubated with 50 µl reaction buffer containing 25 mM palmitoyl-CoA, 2 mM L-carnitine, 125 µM 4, 4’-dipyridyldisulfide, and 2 mM KH2PO4 at pH 7.5. The absorbance at 324 nm was monitored in a 384-well plate at 37°C for 15 min. The long chain acyl-CoA synthetase (ACS) activity was also measured by coupling with pyruvate kinase and lactate dehydrogenase to monitor the formation of NAD (32Kasuya F. Igarashi K. Fukui M. Participation of a medium chain acyl-CoA synthetase in glycine conjugation of the benzoic acid derivatives with the electron-donating groups.Biochem. Pharmacol. 1996; 51: 805-809Crossref PubMed Scopus (34) Google Scholar). Briefly, 4 µl of liver lysates at the protein concentration of 10 µg/µl were mixed with 96 µl of the reaction mixture containing 0.5 mM oleate, 1 mM phosphoenolpyruvate, 14 mM MgCl2, 1.4 mM EDTA, 0.18% Triton-X 100, 0.5 mM ATP, 2.5 mM CoA, 0.4 mM NADH, 20 U/ml myokinase, 20 U/ml pyruvate kinase, and 30 U/ml lactate dehydrogenase in a 96-well plate. The absorbance at 340 nm was monitored at 37°C for 15 min. All the hepatic enzyme activities were normalized to the respective protein concentration. Serum VLDL was isolated by rapid ultracentrifugation as described previously with minor modifications (33McEneny J. McMaster C. Trimble E.R. Young I.S. Rapid isolation of VLDL subfractions: assessment of composition and susceptibility to copper-mediated oxidation.J. Lipid Res. 2002; 43: 824-831Abstract Full Text Full Text PDF PubMed Google Scholar). In brief, 200 µl serum was added to a 1 ml ultracentrifuge tube, and then was gently overlaid with 100 µl of 0.196 M NaCl. Ultracentrifugation was performed in a Hitachi ultracentrifuge (CS150GX) using a fixed angle rotor (S140AT) at 140,000 rpm for 50 min at 4°C. The VLDL layer, which was located at the top of the ultracentrifuge tube, was carefully transferred to a new tube for measurement of triglyceride in VLDL. Hepatic triglyceride, cholesterol, and free fatty acids were extracted as previously described (34Chung C. Doll J.A. Gattu A.K. Shugrue C. Cornwell M. Fitchev P. Crawford S.E. Anti-angiogenic pigment epithelium-derived factor regulates hepatocyte triglyceride content through adipose triglyceride lipase (ATGL).J. Hepatol. 2008; 48: 471-478Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 35Wang Q. Jiang L. Wang J. Li S. Yu Y. You J. Zeng R. Gao X. Rui L. Li W. et al.Abrogation of hepatic ATP-citrate lyase protects against fatty liver and ameliorates hyperglycemia in leptin receptor-deficient mice.Hepatology. 2009; 49: 1166-1175Crossref PubMed Scopus (157) Google Scholar). Briefly, 40–50 mg of liver tissues or 4 × 105 cells were homogenized in 1 ml of methanol/chloroform (1:2, v/v), followed by shaking at room temperature for 2 h. Subsequently, 200 µl of 0.1 M NaCl was added, and the sample was vortexed and centrifuged at 3,000 g for 10 min. Then 200 µl of the organic phase was transferred to a new tube and air-dried in a fume hood overnight at room temperature. Completely dried samples were finally dissolved in 100 µl isopropanol. The triglyceride and cholesterol in serum or the samples were dissolved in isopropanol, and the triglyceride in VLDL was determined using enzymatic assay kits (Shensuo Unf Medical Diagnostics Articles Co.). The free fatty acids in serum or the samples dissolved in isopropanol were determined by a free fatty acid quantification kit (Biovision). Mouse primary hepatocytes were prepared from 10- to 15-week-old male mice as described previously with minor modifications (36Mathijs K. Kienhuis A.S. Brauers K.J. Jennen D.G. Lahoz A. Kleinjans J.C. van Delft J.H. Assessing the metabolic competence of sandwich-cultured mouse primary hepatocytes.Drug Metab. Dispos. 2009; 37: 1305-1311Crossref PubMed Scopus (56) Google Scholar). Male Patt1 LKO mice or their littermate controls were anesthetized, and the liver was perfused with Krebs Ringer buffer with glucose (120 mM NaCl, 4.8 mM KCl, 1.2 mM MgSO4, 1.2 mM KH2PO4, 24 mM NaHCO3, 20 mM glucose, and 5 mM HEPES, pH 7.45) containing 100 µM EGTA at a flow rate of 3 ml/min for 15 min. Then the perfusate was switched to Krebs Ringer buffer with glucose containing 5 mM CaCl2 and 100 U/ml collagenase I (Sigma), and the perfusion was continued for another 15 min. Both perfusion buffers were prewarmed in a 37°C water bath. Subsequently, the liver was removed, minced, and dissociated in DMEM (GIBCO) on ice. The dissociated cells were then filtered through a 70 µm cell strainer and centrifuged at 50 g for 2 min at 4°C. Hepatocytes were washed three times with DMEM, followed by centrifugation at 50 g for 2 min at 4°C, and then seeded in 12-well plates precoated with mouse tail collagen (Millipore) at a concentration of 2 × 105 cells/well in DMEM with 10% FBS (GIBCO). Primary hepatocytes were treated with the indicated concentrations of palmitic acid (Sigma) for 18 h, and then the primary hepatocytes were washed twice with PBS and incubated for 15 min with 2 μg/ml Nile red in PBS at 37°C. After washing twice with PBS, hepatocytes were photographed under a fluorescence microscope and then read by a microfluorometer to detect the cellular triglyceride levels as previously described (37Donato M.T. Lahoz A. Jimenez N. Perez G. Serralta A. Mir J. Castell J.V. Gomez-Lechon M.J. Potential impact of steatosis on cytochrome P450 enzymes of human hepatocytes isolated from fatty liver grafts.Drug Metab. Dispos. 2006; 34: 1556-1562Crossref PubMed Scopus (116) Google Scholar). Protein samples of whole cell lysates or nuclear extracts prepared using Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, China) were analyzed with antibodies against Patt1 (28Liu Z. Liu Y. Wang H. Ge X. Jin Q. Ding G. Hu Y. Zhou B. Chen Z. Zhang B. et al.Patt1, a novel protein acetyltransferase that is highly expressed in liver and downregulated in hepatocellular carcinoma, enhances apoptosis of hepatoma cells.Int. J. Biochem. Cell Biol. 2009; 41: 2528-2537Crossref PubMed Scopus (30) Google Scholar): ATP-citrate lyase (ACL), Ser79-phosphorylated ACC, ACC, FASN, C/EBPα, acetyl-lysine, and acetyl-histone H4 (Lys8) (Cell Signaling); stearoyl-Coenzyme A desaturase 1 (SCD1) and elongation of long-chain fatty acids, family member 6 (ELOVL6) (Abcam); CPT-1 (Alpha Diagnostics); SREBP1 (Santa Cruz); PGC-1β (Novus); and tubulin and actin (Sigma). The immune complexes were detected using a horseradish peroxidase-conjugated secondary antibody and visualized with a chemiluminescence reagent (Pierce). Protein quantification was performed by Quantity One software (Bio-Rad), and the intensity values were normalized to actin. Mouse liver lysates were immunoprecipitated with antibodies against SREBP1 (Santa Cruz) and PGC-1β (Novus) as described previously (26Ge X. Jin Q. Zhang F. Yan T. Zhai Q. PCAF acetylates {beta}-catenin and improves its stability.Mol. Biol. Cell. 2009; 20: 419-427Crossref PubMed Scopus (94) Google Scholar). Fatty acid uptake assay was performed as previously described (38Park S.G. Kang Y.S. Kim J.Y. Lee C.S. Ko Y.G. Lee W.J. Lee K.U. Yeom Y.I. Kim S. Hormonal activity of AIMP1/p43 for glucose homeostasis.Proc. Natl. Acad. Sci. USA. 2006; 103: 14913-14918Crossref PubMed Scopus (54) Google Scholar). Briefly, primary hepatocytes in 12-well plates were incubated with 300 µl/well assay buffer (Hanks’ balanced buffer containing 1% BSA and 5 µCi/ml 3H-palmitic acid) for 5 min at 37°C. Then the cells were washed twice with ice cold PBS and lysed with 0.3 M NaOH. The radioactivity of the cell lysates was measured by liquid scintillation counting. Lipid synthesis was measured as described previously (39Joost H.G. Steinfelder H.J. Modulation of insulin sensitivity by adenosine. Effects on glucose transport, lipid synthesis, and insulin receptors of the adipocyte.Mol. Pharmacol. 1982; 22: 614-618PubMed Google Scholar). Briefly, hepatocytes were incubated for 60 min at 37°C in DMEM with 10% FBS and 6 µCi/ml 3H-glucose. Then the hepatocytes were washed twice with PBS, and lipid was extracted as described previously (34Chung C. Doll J.A. Gattu A.K. Shugrue C. Cornwell M. Fitchev P. Crawford S.E. Anti-angiogenic pigment epithelium-derived factor regulates hepatocyte triglyceride content through adipose triglyceride lipase (ATGL).J. Hepatol. 2008; 48: 471-478Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 35Wang Q. Jiang L. Wang J. Li S. Yu Y. You J. Zeng R. Gao X. Rui L. Li W. et al.Abrogation of hepatic ATP-citrate lyase protects against fatty liver and ameliorates hyperglycemia in leptin receptor-deficient mice.Hepatology. 2009; 49: 1166-1175Crossref PubMed Scopus (157) Google Scholar). The extracted lipid was dissolved in 1% Triton-X100, and the radioactivity of the lipid was measured by liquid scintillation counting. Fatty acid oxidation was performed as described previously (40Abu-Elheiga L. Oh W. Kordari P. Wakil S.J. Acetyl-CoA carboxylase 2 mutant mice are protected against obesity and diabetes induced by high-fat/high-carbohydrate diets.Proc. Natl. Acad. Sci. USA. 2003; 100: 10207-10212Crossref PubMed Scopus (326) Google Scholar). Briefly, primary hepatocytes were cultured in 12-well plates for 24 h, and then washed twice with PBS. Subsequently, 300 µl assay buffer (Hanks’ balanced buffer containing 10 mg/ml BSA and 3.3 µCi/ml 3H-palmitic acid) was added to each well and incubated at 37°C for 1 h. Then 150 µl of the assay buffer from each well was transferred to a new tube, and 400 µl methanol/chloroform (2:1, v/v) and 400 µl 2 M KCl/2 M HCl were added. After vortexing, the mixtures were centrifuged at 3,000 g for 5 min, and the aqueous phase containing 3H2O was transferred to a new tube to treat once more with the methanol/chloroform and KCl/HCl mixture. Finally, the aqueous phase was used to measure radioactivity. The liver total RNA was prepared using TRIzol reagent (Invitrogen) and treated with RNase-free DNase I (Takara). Then the RNA was reverse-transcribed using M-MLV Reverse Transcriptase (Promega). Real-time PCR was performed on an ABI Prism 7900 Sequence Detection System using Power SYBR Green (Applied Biosystems). The primers used for real-time PCR were mainly from PrimerBank (http://pga.mgh.harvard.edu/primerbank) and appear in supplementary Table I. Respiratory quotient and oxygen consumption were determined with mice fed ad libitum using a comprehensive laboratory animal monitoring system (Columbus Instruments) according to the manufacturer's instructions. Mice were measured for 24 h after acclimation to the system for 24 h. Total energy expenditure was calculated as (3.815 + 1.232 × respiratory quotient) × VO2 (41Sleeman M.W. Garcia K. Liu R. Murray J.D. Malinova L. Moncrieffe M. Yancopoulos G.D. Wiegand S.J. Ciliary neurotrophic factor improves diabetic parameters and hepatic steatosis and increases basal metabolic rate in db/db mice.Proc. Natl. Acad. Sci. USA. 2003; 100: 14297-14302Crossref PubMed Scopus (95) Google Scholar). Oxygen consumption and total energy expenditure were normalized to bodyweight or lean mass as indicated. Except where indicated, data are expressed as mean ± SD of at least three independent experiments. Statistical significance was assessed by Student's t-test. Differences were considered statistically significant at P < 0.05. The strategy to generate Patt1 liver-specific knockout (LKO) mice is shown in Fig. 1A. The Patt1lox/lox, Cre+/− mice were crossed with Patt1lox/lox mice to obtain Patt1 LKO mice and littermate controls Patt1lox/lox mice for this study. Patt1 expression was abolished in the liver of the LKO mice compared with littermate controls (Fig. 1B), although its expression was not changed in muscle, white adipose tissue, brain, pancreas, kidney, or brown adipose tissue (Fig. 1C–E and supplementary Fig. I). These results demonstrate that the LKO mice have liver-specific deletion of Patt1. To evaluate the effect of liver-specific Patt1 deletion, we examined the fat and lean mass and body weight of Patt1 LKO mice. The fat mass and fat content (the ratio of fat mass to body weight) of male Patt1 LKO mice was markedly decreased at the age of 20 weeks (Fig. 2A, B), and even at the age of 6 or 9 weeks, a significant decrease of fat mass and fat content in male Patt1 LKO mice was observed (supplementary Fig. II). Lean mass and lean content in male Patt1 LKO mice were moderately increased at the age of 20 weeks compared with littermate controls (Fig. 2C, D). Male Patt1 LKO mice showed slightly increased body weight and food intake compared with lit" @default.
• W2010221489 created "2016-06-24" @default.
• W2010221489 creator A5000300986 @default.
• W2010221489 creator A5004514476 @default.
• W2010221489 creator A5006834456 @default.
• W2010221489 creator A5012706485 @default.
• W2010221489 creator A5013862966 @default.
• W2010221489 creator A5019632971 @default.
• W2010221489 creator A5023363049 @default.
• W2010221489 creator A5030908494 @default.
• W2010221489 creator A5058223300 @default.
• W2010221489 creator A5058898772 @default.
• W2010221489 creator A5063938568 @default.
• W2010221489 creator A5088705161 @default.
• W2010221489 date "2012-03-01" @default.
• W2010221489 modified "2023-10-12" @default.
• W2010221489 title "Liver Patt1 deficiency protects male mice from age-associated but not high-fat diet-induced hepatic steatosis" @default.
• W2010221489 cites W1566946085 @default.
• W2010221489 cites W1969149505 @default.
• W2010221489 cites W1969295126 @default.
• W2010221489 cites W1969734540 @default.
• W2010221489 cites W1974545118 @default.
• W2010221489 cites W1974961331 @default.
• W2010221489 cites W1981110601 @default.
• W2010221489 cites W1982232718 @default.
• W2010221489 cites W1990909446 @default.
• W2010221489 cites W1994489610 @default.
• W2010221489 cites W1994652351 @default.
• W2010221489 cites W1996536878 @default.
• W2010221489 cites W2001464177 @default.
• W2010221489 cites W2004940502 @default.
• W2010221489 cites W2007381747 @default.
• W2010221489 cites W2007480238 @default.
• W2010221489 cites W2011105101 @default.
• W2010221489 cites W2012443360 @default.
• W2010221489 cites W2013196115 @default.
• W2010221489 cites W2016294119 @default.
• W2010221489 cites W2018314000 @default.
• W2010221489 cites W2020353017 @default.
• W2010221489 cites W2028874440 @default.
• W2010221489 cites W2029708291 @default.
• W2010221489 cites W2032129662 @default.
• W2010221489 cites W2032393597 @default.
• W2010221489 cites W2032878070 @default.
• W2010221489 cites W2034175329 @default.
• W2010221489 cites W2040109162 @default.
• W2010221489 cites W2043785033 @default.
• W2010221489 cites W2047257800 @default.
• W2010221489 cites W2052751736 @default.
• W2010221489 cites W2065034018 @default.
• W2010221489 cites W2067886088 @default.
• W2010221489 cites W2072493172 @default.
• W2010221489 cites W2072997880 @default.
• W2010221489 cites W2080349032 @default.
• W2010221489 cites W2087714970 @default.
• W2010221489 cites W2093596830 @default.
• W2010221489 cites W2098688944 @default.
• W2010221489 cites W2101236804 @default.
• W2010221489 cites W2102172732 @default.
• W2010221489 cites W2107921064 @default.
• W2010221489 cites W2114733829 @default.
• W2010221489 cites W2121956021 @default.
• W2010221489 cites W2134823147 @default.
• W2010221489 cites W2155344601 @default.
• W2010221489 cites W2157379232 @default.
• W2010221489 cites W2159921182 @default.
• W2010221489 cites W2168346186 @default.
• W2010221489 cites W2408687244 @default.
• W2010221489 cites W4230280576 @default.
• W2010221489 doi "https://doi.org/10.1194/jlr.m019257" @default.
• W2010221489 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3276459" @default.
• W2010221489 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22231784" @default.
• W2010221489 hasPublicationYear "2012" @default.
• W2010221489 type Work @default.
• W2010221489 sameAs 2010221489 @default.
• W2010221489 citedByCount "22" @default.
• W2010221489 countsByYear W20102214892013 @default.
• W2010221489 countsByYear W20102214892015 @default.
• W2010221489 countsByYear W20102214892016 @default.
• W2010221489 countsByYear W20102214892017 @default.
• W2010221489 countsByYear W20102214892020 @default.
• W2010221489 countsByYear W20102214892021 @default.
• W2010221489 countsByYear W20102214892022 @default.
• W2010221489 countsByYear W20102214892023 @default.
• W2010221489 crossrefType "journal-article" @default.
• W2010221489 hasAuthorship W2010221489A5000300986 @default.
• W2010221489 hasAuthorship W2010221489A5004514476 @default.
• W2010221489 hasAuthorship W2010221489A5006834456 @default.
• W2010221489 hasAuthorship W2010221489A5012706485 @default.
• W2010221489 hasAuthorship W2010221489A5013862966 @default.
• W2010221489 hasAuthorship W2010221489A5019632971 @default.
• W2010221489 hasAuthorship W2010221489A5023363049 @default.
• W2010221489 hasAuthorship W2010221489A5030908494 @default.
• W2010221489 hasAuthorship W2010221489A5058223300 @default.
• W2010221489 hasAuthorship W2010221489A5058898772 @default.
• W2010221489 hasAuthorship W2010221489A5063938568 @default.
• W2010221489 hasAuthorship W2010221489A5088705161 @default.
• W2010221489 hasBestOaLocation W20102214891 @default.

• next