FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2010931474> ?p ?o ?g. }

• W2010931474 endingPage "20921" @default.
• W2010931474 startingPage "20914" @default.
• W2010931474 abstract "The cyclosporin A (CsA)/FK506-sensitive nuclear factor of activated T cells (NFAT) plays a key role in the inducible expression of cytokine genes in T cells. Although NFAT has been recently shown to be inducible in several non-T immune cells, the NFAT gene family members characterized to date have been isolated only from T cells. To further characterize NFAT function in human B cells and to demonstrate cytokine gene specificity of NFAT proteins, we report here the isolation and characterization of a cDNA clone from the Raji B cell line. The cDNA clone encodes a new isoform, NFATc.β, of the NFAT gene family member NFATc (designated here NFATc.α). The amino acid sequence of NFATc.β differs from that of NFATc.α in the first NH2-terminal 29 residues and contains an additional region of 142 residues at the COOH terminus. Northern analysis using a probe encompassing a common region of both isoforms showed two mRNA species of 2.7 and 4.5 kilobase pairs, while an NFATc.β-specific probe detected only the 4.5-kilobase pair mRNA which was preferentially expressed in the spleen. Transient expression of NFATc.β was capable of activating an interleukin-2 NFAT-driven reporter gene in stimulated Jurkat cells in a CsA-sensitive manner. However, NFATc.β neither bound to the κ3 element (an NFAT-binding site) in the tumor necrosis factor-α promoter nor activated the tumor necrosis factor-α promoter in cotransfection assays. These data suggest that different members or isoforms of NFAT gene family may regulate inducible expression of different cytokine genes. The cyclosporin A (CsA)/FK506-sensitive nuclear factor of activated T cells (NFAT) plays a key role in the inducible expression of cytokine genes in T cells. Although NFAT has been recently shown to be inducible in several non-T immune cells, the NFAT gene family members characterized to date have been isolated only from T cells. To further characterize NFAT function in human B cells and to demonstrate cytokine gene specificity of NFAT proteins, we report here the isolation and characterization of a cDNA clone from the Raji B cell line. The cDNA clone encodes a new isoform, NFATc.β, of the NFAT gene family member NFATc (designated here NFATc.α). The amino acid sequence of NFATc.β differs from that of NFATc.α in the first NH2-terminal 29 residues and contains an additional region of 142 residues at the COOH terminus. Northern analysis using a probe encompassing a common region of both isoforms showed two mRNA species of 2.7 and 4.5 kilobase pairs, while an NFATc.β-specific probe detected only the 4.5-kilobase pair mRNA which was preferentially expressed in the spleen. Transient expression of NFATc.β was capable of activating an interleukin-2 NFAT-driven reporter gene in stimulated Jurkat cells in a CsA-sensitive manner. However, NFATc.β neither bound to the κ3 element (an NFAT-binding site) in the tumor necrosis factor-α promoter nor activated the tumor necrosis factor-α promoter in cotransfection assays. These data suggest that different members or isoforms of NFAT gene family may regulate inducible expression of different cytokine genes. Characterization of a new isoform of the NFAT (nuclear factor of activated T cells) gene family member NFATc.Journal of Biological ChemistryVol. 272Issue 36PreviewWe reported corrections at two nucleotide positions, 2334 and 2451, in our published sequence of NFATcβ ((1996)J. Biol. Chem. 271, 33705), Dr. Edgar Serfling of the Institute of Pathology, University of Wurzburg, had also independently identified these errors and kindly informed us about his findings. We write now to acknowledge his personal communication which was omitted from our previous Additions and Corrections. Full-Text PDF Open Access Nuclear factor of activated T cells (NFAT) 1The abbreviations used are: NFATnuclear factor of activated T cellsCsAcyclosporin APMAphorbol 12-myristate 13-acetateILinterleukinTNFtumor necrosis factorIgimmunoglobulinhGHhuman growth hormonePAGEpolyacrylamide gel electrophoresisCATchloramphenicol acetyltransferasekbkilobase pair(s). is a multicomponent transcription factor regulating expression of several cytokine genes in antigen-activated T cells and functions as a major molecular target for the immunosuppressive drugs cyclosporin A (CsA) and FK506 (reviewed in Refs. 1Schreiber S.L. Crabtree G.R. Immunol. Today. 1992; 13: 136-142Abstract Full Text PDF PubMed Scopus (1971) Google Scholar, 2Rao A. Immunol. Today. 1994; 15: 274-281Abstract Full Text PDF PubMed Scopus (490) Google Scholar, 3Serfling E. Avots A. Neumann M. Biochim. Biophys. Acta. 1995; 1263: 181-200Crossref PubMed Scopus (201) Google Scholar). It consists of a protein kinase C-inducible nuclear component and a pre-existing cytoplasmic component(s) whose translocation to the nucleus is dependent upon Ca2+ mobilization (4Flanagan W.M. Corthésy B. Bram R.J. Crabtree G.R. Nature. 1991; 352: 803-807Crossref PubMed Scopus (954) Google Scholar, 5Shaw K.T.-Y. Ho A.M. Raghavan A. Kim J. Jain J. Park J. Sharma S. Rao A. Hogan P.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11205-11209Crossref PubMed Scopus (318) Google Scholar). The protein kinase C-inducible nuclear component was found to be AP-1 proteins (6Jain J. McCaffrey P.G. Valge A.V. Rao A. Nature. 1992; 356: 801-804Crossref PubMed Scopus (429) Google Scholar), and several members of the Fos and Jun families have been described to participate in NFAT complexes, contributing to NFAT-dependent transcription (7Boise L.H. Petryniak B. Mao X. June C.H. Wang C.-Y. Lindsten T. Bravo R. Kovary K. Leiden J.M. Thompson C.B. Mol. Cell. Biol. 1993; 13: 1911-1919Crossref PubMed Scopus (209) Google Scholar, 8Northrop J.P. Ullman K.S. Crabtree G.R. J. Biol. Chem. 1993; 268: 2917-2923Abstract Full Text PDF PubMed Google Scholar, 9Yaseen N.R. Park J. Kerppola T. Curran T. Sharma S. Mol. Cell. Biol. 1994; 14: 6886-6895Crossref PubMed Scopus (37) Google Scholar, 10Jain J. Nalefski E.A. McCaffrey P.G. Johnson R.S. Spiegelman B.M. Papaioannou V. Rao A. Mol. Cell. Biol. 1994; 14: 1566-1574Crossref PubMed Scopus (64) Google Scholar). Although an investigation of the inducible expression of the IL-2 gene led to the primary characterization of NFAT complex, functional NFAT binding sites have also been identified in the regulatory regions of other cytokine genes, including IL-3/granulocyte/macrophage colony-stimulating factor (11Cockerill P.N. Shannon F. Bert A.G. Ryan G.R. Vadas M.A. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2466-2470Crossref PubMed Scopus (177) Google Scholar, 12Masuda E.S. Tokumitsu H. Tsuboi A. Shlomai J. Hung P. Arai K.I. Arai N. Mol. Cell. Biol. 1993; 13: 7399-7407Crossref PubMed Scopus (126) Google Scholar), IL-4 (13Chuvpilo S. Schomberg C. Gerwig R. Heinfling A. Reeves R. Grummt F. Serfling E. Nucleic Acids Res. 1993; 21: 5694-5704Crossref PubMed Scopus (181) Google Scholar, 14Szabo S.J. Gold J.S. Murphy T.L. Murphy K.M. Mol. Cell. Biol. 1993; 13: 4793-4805Crossref PubMed Scopus (235) Google Scholar, 15Rooney J.W. Hodge M.R. McCaffrey P.G. Rao A. Glimcher L.H. EMBO J. 1994; 13: 625-633Crossref PubMed Scopus (149) Google Scholar), IL-5 (16Lee H.J. Masuda E.S. Arai N. Arai K. Yokota T. J. Biol. Chem. 1995; 270: 17541-17550Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), and TNF-α (17Goldfeld A.E. McCaffrey P.G. Strominger J.L. Rao A. J. Exp. Med. 1993; 178: 1365-1379Crossref PubMed Scopus (191) Google Scholar), whose expression has been shown to be CsA-sensitive. nuclear factor of activated T cells cyclosporin A phorbol 12-myristate 13-acetate interleukin tumor necrosis factor immunoglobulin human growth hormone polyacrylamide gel electrophoresis chloramphenicol acetyltransferase kilobase pair(s). Recently several cytoplasmic components of NFAT, collectively termed NFAT family proteins, have been cloned and characterized in murine and human T cells. They include NFATp (18McCaffrey P.G. Luo C. Kerppola T.K. Jain J. Badalian T.M. Ho A.M. Burgeon E. Lane W.S. Lambert J.N. Curran T. Verdine G.L. Rao A. Hogan P.G. Science. 1993; 262: 750-754Crossref PubMed Scopus (379) Google Scholar), NFATc (19Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (525) Google Scholar), NFATx/NFAT4/NFATc3 (20Masuda E.S. Naito Y. Tokumitsu H. Campbell D. Saito F. Hannum C. Arai K. Arai N. Mol. Cell. Biol. 1995; 15: 2697-2706Crossref PubMed Scopus (198) Google Scholar, 21Hoey T. Sun Y.-L. Williamson K. Xu X. Immunity. 1995; 2: 461-472Abstract Full Text PDF PubMed Scopus (354) Google Scholar, 22Ho S.N. Thomas D.J. Timmerman L.A. Li X. Francke U. Crabtree G.R. J. Biol. Chem. 1995; 270: 19898-19907Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar), and NFAT3 (21Hoey T. Sun Y.-L. Williamson K. Xu X. Immunity. 1995; 2: 461-472Abstract Full Text PDF PubMed Scopus (354) Google Scholar) and share a conserved region of ∼290 amino acids. This region exhibits DNA binding activity and shows a limited sequence similarity to the DNA binding and dimerization domains of dorsal/rel/NFκB transcription factors (reviewed in Ref. 23Nolan G.P. Cell. 1994; 77: 795-798Abstract Full Text PDF PubMed Scopus (97) Google Scholar). Another common feature of these proteins is the presence of the repeated motifs of serine-proline residues (SPXXSPXXSPXXXXX(D/E)(D/E)) in the NH2-terminal region (20Masuda E.S. Naito Y. Tokumitsu H. Campbell D. Saito F. Hannum C. Arai K. Arai N. Mol. Cell. Biol. 1995; 15: 2697-2706Crossref PubMed Scopus (198) Google Scholar). Most (if not all) NFAT family proteins appear to undergo dephosphorylation in response to stimuli increasing intracellular Ca2+ concentration. It has been suggested that they are either direct or indirect substrates for the Ca2+/calmodulin-dependent phosphatase calcineurin which is sensitive to the immunosuppressive drugs CsA and FK506. For example, NFATp acts as an in vitro substrate of calcineurin (24Jain J. McCaffrey P.G. Miner Z. Kerppola T.K. Lambert J.N. Verdine G.L. Curran T. Rao A. Nature. 1993; 365: 352-355Crossref PubMed Scopus (681) Google Scholar, 25McCaffrey P.G. Perrino B.A. Soderling T.R. Rao A. J. Biol. Chem. 1993; 268: 3747-3752Abstract Full Text PDF PubMed Google Scholar) and becomes dephosphorylated upon treatment with ionomycin prior to its nuclear translocation. This dephosphorylation process is blocked by CsA and FK506 (5Shaw K.T.-Y. Ho A.M. Raghavan A. Kim J. Jain J. Park J. Sharma S. Rao A. Hogan P.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11205-11209Crossref PubMed Scopus (318) Google Scholar). Moreover, phosphorylated NFATp fails to bind to the IL-2 NFAT binding site, suggesting that CsA not only affects nuclear translocation but also DNA binding ability of NFAT family proteins (26Park J. Yaseen N.R. Hogan P.G. Rao A. Sharma S. J. Biol. Chem. 1995; 270: 20653-20659Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). It has recently become clear that NFAT also plays an important role in production of cytokines by non-T cells of the immune system. Although originally described as a T cell-specific transcriptional factor, NFAT proteins, in particular NFATp, have been detected in several other hematopoietic cells including B cells (27Yaseen N.R. Maizel A.L. Wang F. Sharma S. J. Biol. Chem. 1993; 268: 14285-14293Abstract Full Text PDF PubMed Google Scholar, 28Venkataraman L. Francis D.A. Wang Z. Liu J. Rothstein T.L. Sen R. Immunity. 1994; 1: 189-196Abstract Full Text PDF PubMed Scopus (106) Google Scholar, 29Choi M.S. Brines R.D. Holman M.J. Klaus G. Immunity. 1994; 1: 179-187Abstract Full Text PDF PubMed Scopus (127) Google Scholar), natural killer cells (30Aramburu J. Azzoni L. Rao A. Perussia B. J. Exp. Med. 1995; 182: 801-810Crossref PubMed Scopus (120) Google Scholar), mast cells (31Weiss D.L. Hural J. Tara D. Timmerman L.A. Henkel G. Brown M.A. Mol. Cell. Biol. 1996; 16: 228-235Crossref PubMed Scopus (69) Google Scholar), and macrophages (5Shaw K.T.-Y. Ho A.M. Raghavan A. Kim J. Jain J. Park J. Sharma S. Rao A. Hogan P.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11205-11209Crossref PubMed Scopus (318) Google Scholar) as well as in neuronal cells (32Ho A.M. Jain J. Rao A. Hogan P.G. J. Biol. Chem. 1994; 269: 28181-28186Abstract Full Text PDF PubMed Google Scholar) albeit with no well defined function. We have been characterizing NFAT function in human B cells and showed that B cell NFAT complex was indistinguishable from that detected in T cells (9Yaseen N.R. Park J. Kerppola T. Curran T. Sharma S. Mol. Cell. Biol. 1994; 14: 6886-6895Crossref PubMed Scopus (37) Google Scholar, 27Yaseen N.R. Maizel A.L. Wang F. Sharma S. J. Biol. Chem. 1993; 268: 14285-14293Abstract Full Text PDF PubMed Google Scholar). Furthermore, we have recently shown that CsA leads to phosphorylation of nuclear NFATp in transformed B and T cells and inhibits its DNA binding (26Park J. Yaseen N.R. Hogan P.G. Rao A. Sharma S. J. Biol. Chem. 1995; 270: 20653-20659Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). In this regard, CsA has been shown to directly inhibit B cell activation elicited by anti-Ig, SAC, or ionomycin which induce Ca2+ mobilization during the signaling processes (reviewed in Ref. 33Klaus G. Transplantation. 1988; 46: 11S-14SCrossref PubMed Scopus (54) Google Scholar). Importantly, it also prevents TNF-α production by B cells stimulated through their surface Ig receptor (34Goldfeld A.E. Flemingtn E.K. Boussiotis V.A. Theodos C.M. Titus R.G. Strominger J.L. Speck S.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 12198-12201Crossref PubMed Scopus (54) Google Scholar). Furthermore, in murine T cells, a transcription factor similar or identical to NFATp has been shown to bind to the CsA-sensitive regulatory element (κ3 element) in the TNF-α promoter (17Goldfeld A.E. McCaffrey P.G. Strominger J.L. Rao A. J. Exp. Med. 1993; 178: 1365-1379Crossref PubMed Scopus (191) Google Scholar, 35McCaffrey P.G. Goldfeld A.E. Rao A. J. Biol. Chem. 1994; 269: 30445-30450Abstract Full Text PDF PubMed Google Scholar). Thus, NFAT appears to mediate CsA-sensitive transcriptional regulation of the TNF-α and other yet unidentified, activation-associated genes in B cells by similar mechanisms operational in T cells. To further understand the structural complexity and function of NFAT, we screened a cDNA library derived from Raji B cells to isolate a unique NFAT family protein(s). Here, we report cDNA cloning and initial characterization of a new isoform, designated NFATc.β of NFAT family member NFATc.α. 2To distinguish NFATc isoforms, we have used an arbitrary nomenclature in which NFATc previously reported by Northrop et al. (21Hoey T. Sun Y.-L. Williamson K. Xu X. Immunity. 1995; 2: 461-472Abstract Full Text PDF PubMed Scopus (354) Google Scholar) is referred to as NFATc.α. This molecule exhibits a unique expression pattern and likely plays a role in the mutually exclusive expression of cytokine genes. A cDNA library constructed in λgt10 vector was purchased from Clontech Inc. (Palo Alto, CA) and was derived from a human Burkitt's lymphoma cell line Raji using both random and oligo(dT) primers. The cDNA library was screened under low stringency conditions using a radiolabeled DNA fragment corresponding to nucleotides 1-1257 in the published murine NFATp sequence (18McCaffrey P.G. Luo C. Kerppola T.K. Jain J. Badalian T.M. Ho A.M. Burgeon E. Lane W.S. Lambert J.N. Curran T. Verdine G.L. Rao A. Hogan P.G. Science. 1993; 262: 750-754Crossref PubMed Scopus (379) Google Scholar) as a probe. The DNA probe contained NH2-terminal of the rel similarity domain and its upstream sequence. This was obtained from murine NFATp cDNA clone (kindly provided by Drs. A. Rao and P. Hogan) by double digestion with HindIII and AccI. Positive clones were isolated by three rounds of hybridization, and inserts were subcloned into Bluescript plasmids. The clone containing the longest cDNA insert was sequenced on both strands using the dideoxynucleotide chain termination (U. S. Biochemical Corp.) and polymerase chain reaction sequencing (Promega) methods. A Northern blot with poly(A)+ RNAs isolated from multiple human tissues was purchased from Clontech Inc. For the common probe of NFATc.α and NFATc.β, we used a 467-base pair NsiI-NcoI fragment of a NFATc.β cDNA clone. The nucleotide sequence of this fragment is identical between NFATc.α and NFATc.β, and corresponds to nucleotides 383-848 in the published NFATc.α cDNA sequence (19Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (525) Google Scholar) and to nucleotides 180-646 in the NFATc.β cDNA of this study (Fig. 1). For the NFATc.β unique probe, we used a 418-base pair polymerase chain reaction fragment encompassing the region encoding amino acids 676-814 located downstream of the rel similarity domain of NFATc.β. The human glyceraldehyde-3-phosphate dehydrogenase cDNA probe was used to quantitate the amounts of RNA loaded in each lane. DNA probes were labeled by random priming and hybridization was carried out in 5 × SSPE, 50% formamide, 5 × Denhardt's solution, 2% SDS, 100 µg/ml herring sperm DNA at 42°C. The filter was washed in 2 × SSC, 0.05% SDS at room temperature, and subsequently in 0.1 × SSC, 0.1% SDS at 55°C. The same filter was used for all subsequent hybridizations. Escherichia coli expression plasmids for three deletion derivatives of NFATc.β proteins were constructed into pQE30 (Qaigen, CA) by subcloning the NFATc.β cDNA fragments, which express recombinant proteins tagged with a hexahistidine at the NH2 terminus. Using the NFATc.β cDNA clone as template, a polymerase chain reaction fragment was generated with 5′- and 3′-primers containing restriction linker sites, BamHI and KpnI, respectively, and subsequently the restricted polymerase chain reaction products subcloned into pQE30 to generate the NFATc.β (amino acids 214-814) (Fig. 4) expression vector. The other two deletion mutants, NFATc.β (amino acids 214-769) and NFATc.β (amino acids 214-703) (Fig. 4), were derived from the NFATc.β (214-814) expression plasmid by blunt end ligation of the plasmid after restriction digestion with either SmaI and EcoRV or AgeI and EcoRV, respectively. Murine NFATp expression vector pNFATpXS(1-297), constructed in pQE31 (Qaigen, CA), was kindly provided by Drs. A. Rao and J. Jain (36Jain J. Burgeon E. Badalian T.M. Hogan P.G. Rao A. J. Biol. Chem. 1995; 270: 4138-4145Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). Proteins were expressed and purified as described previously with minor modifications (36Jain J. Burgeon E. Badalian T.M. Hogan P.G. Rao A. J. Biol. Chem. 1995; 270: 4138-4145Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). Expression was induced by addition of 2 mM isopropyl-β-D-thiogalactopyranoside to E. coli culture at OD600 0.7-0.9, and the cultures were harvested after 4 h incubation at 37°C. The cells were disrupted by three cycles of freeze-thawing in 8 M urea, 5 mM 2-mercaptoethanol, 0.1 M sodium phosphate, 10 mM Tris-HCl, pH 8.0. The lysates were spun in microcentrifuge for 10 min to remove insoluble particulates. Proteins were purified from the soluble fractions of the extracts with nickel-chelate resin (Ni-NTA-agarose; Qaigen). After washing the resin column with 10 mM imidazole in the same buffer, proteins were eluted with 100 mM imidazole. The eluates were dialyzed against a buffer (20 mM HEPES pH 7.4, 1 mM dithiothreitol, 100 mM KCl, 0.5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride) containing 4 M urea for 6 h, and overnight against an urea-free dialysis buffer. Proteins were stored in small aliquots at −70°C. Protein concentration was determined using the Bio-Rad protein assay kit with bovine serum albumin as standard. To verify the purification, 0.2 µg of each purified protein was separated in SDS-PAGE and stained with Coomassie Brilliant Blue. Purified recombinant c-Fos(1-321) and c-Jun(199-334) proteins were kindly provided by Drs. T. Curran and T. Kerppola and have been described elsewhere (37Abate C.D. Luk D. Curran T. Mol. Cell. Biol. 1991; 11: 3624-3632Crossref PubMed Scopus (146) Google Scholar). Binding reactions (16 µl) were performed with 0.16 ng to 0.3 µg of purified NFATc.β and NFATp proteins, 300 ng of poly(dI)·poly(dC), and 0.2-0.3 ng of radiolabeled oligonucleotides in a binding buffer containing 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 0.5 mM dithiothreitol, 1% Ficoll (Mr 400,000), 0.125 mg/ml bovine serum albumin. For competition assays, 25-100-fold molar excess of unlabeled oligonucleotides were added to the binding reaction mixtures as indicated in the figure legends. Where indicated, c-Fos and c-Jun proteins were included in the binding reaction mixtures to test their association with NFAT proteins. After 20-min incubation at room temperature, the reaction products were separated on a 4% non-denaturing polyacrylamide gel (27Yaseen N.R. Maizel A.L. Wang F. Sharma S. J. Biol. Chem. 1993; 268: 14285-14293Abstract Full Text PDF PubMed Google Scholar). Oligonucleotides used in DNA binding assays were as follows: 1) human NFAT, a 30-mer containing the distal NFAT site within the human IL-2 promoter (5′-GGAGGAAAAACTGTTTCATACAGAAGGCGT-3′); 2) murine NFAT, a 33-mer containing the distal NFAT site in the murine IL-2 promoter (5′-gatcGCCCAAAGAGGAAAATTTGTTTCATACAG-3′); 3) mutant NFAT, a 30-mer containing 5 base changes at the 5′-end of the human IL-2 NFAT site (5′-GAAAACTGTTTCATACAGAAGGCGT 3′); 4) nonspecific oligonucleotide, a 33-mer (5′ AAGAAGGAGAAAATACCTTTTTGATTTTCACA 3′); 5) AP-1, a 24-mer containing the AP-1 binding site (5′-CGCTTGATGAGTCAGCCGGAA-3′); 6) κ3 element, a 30-mer containing the NFAT-binding site within the human TNF-α promoter (5′-gatccGAGCTCATGGGTTTCTCCACCAAGG-3′) (35McCaffrey P.G. Goldfeld A.E. Rao A. J. Biol. Chem. 1994; 269: 30445-30450Abstract Full Text PDF PubMed Google Scholar). The full-length coding region of NFATc.β was subcloned into the expression vector containing the SRα promoter (38Takebe Y. Seiki M. Fujisawa J.-I. Hoy P. Yokota K. Arai K.-I. Yoshida M. Arai N. Mol. Cell. Biol. 1988; 8: 466-472Crossref PubMed Google Scholar). The NFATp expression vector, in which NFATp expression is under the control of the SV40 promoter, was kindly provided by Drs. A. Rao and P. Hogan (Harvard Medical School). The reporter plasmid 5B3.1, a kind gift from Dr. G. Crabtree (Stanford University), expresses chloramphenicol acetyltransferase (CAT) driven by three IL-2 NFAT sites upstream of a minimal γ-fibrinogen promoter (39Durand D.B. Shaw J.-P. Bush M.R. Replogle R.E. Belagaje R. Crabtree G.R. Mol. Cell. Biol. 1988; 8: 1715-1724Crossref PubMed Scopus (375) Google Scholar). The human TNF-α promoter (−614/+20)-luciferase plasmid constructed in pGL2 basic vector was kindly provided by Dr. F. de la Brousse, Tularik, Inc. (40Nedwin G.E. Naylor S.L. Sakaguchi A.Y. Smith D. Jarrett-Nedwin J. Pennica D. Goeddel D.V. Gray P.W. Nucleic Acids Res. 1985; 13: 6361-6373Crossref PubMed Scopus (419) Google Scholar). The pTKGH plasmid which expresses human growth hormone (hGH) under the control of the herpes simplex virus thymidine kinase promoter serves as an internal control for the efficiency of transfection. Exponentially growing Jurkat or Raji cells (1 × 107 cells) were transfected with 5 µg of 5B3.1 or the TNF-α promoter-luciferase plasmid, 2.5 µg of pTKGH, and 15 µg of either NFATc.β or NFATp expression vector by electroporation at 240 V, 960 microfarads. At 24 h after transfection, the cells were treated with 50 ng/ml PMA and 1.5 µM ionomycin. After 8 h of treatment, the cells were harvested, and CAT and luciferase activities were determined using the established techniques. Transfection efficiencies were normalized by hGH assays using Allegro HGH kit (Nichols Institute Diagnostics, CA). Cloning of NFATc.β—To isolate a cDNA clone(s) which putatively encodes an NFAT family protein from B cells, we screened a Burkitt's lymphoma cell line Raji cDNA library (approximately 7 × 105 plaques) with a cDNA probe encoding NH2-terminal and the rel similarity domain of the murine NFATp at low stringency (18McCaffrey P.G. Luo C. Kerppola T.K. Jain J. Badalian T.M. Ho A.M. Burgeon E. Lane W.S. Lambert J.N. Curran T. Verdine G.L. Rao A. Hogan P.G. Science. 1993; 262: 750-754Crossref PubMed Scopus (379) Google Scholar). Several positive clones were isolated and divided into two different groups closely related to NFATc.α (5 clones) and NFATp (10 clones), respectively, by initial analysis using restriction digestion and partial sequencing. Interestingly, one clone related to the NFATc.α gene showed nucleotide sequence differences in both 5′- and 3′-end regions, and further sequencing analysis of this clone, designated NFATc.β, revealed an open reading frame encoding a new protein of 827 amino acids with deduced molecular mass of 89.5 kDa that is closely related to NFATc.α previously reported by Northrop et al. (19Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (525) Google Scholar) (Fig. 1). At the amino acid level, this clone displayed perfect sequence identity with NFATc.α in the region corresponding to amino acids 30-684 with the exception of 2 amino acids at positions 219(Ser) and 222(Arg) in which the corresponding amino acids of NFATc.α are Gly and Gln, respectively. The identical region includes the rel similarity domain and NH2-terminal containing the SPXXSPXXSPXXXXX(D/E)(D/E) repeat motifs that are well conserved in the NFAT family proteins, suggesting that the new NFAT family protein may play a similar biological role as other NFAT proteins (Fig. 2B). On the other hand, two unique regions were found in NFATc.β. The first NH2-terminal 29 amino acids of NFATc.β differ from that of NFATc.α and are rich in acidic amino acid content (8 of 29 amino acids), suggesting that this region may constitute a transactivation domain. Another unique region of NFATc.β is represented by an additional sequence of 142 amino acids at the COOH terminus, and this region, rich in proline residues (∼20%), shows no significant sequence similarity to the corresponding regions of other NFAT family members (Fig. 2A). Thus, the cDNA clone isolated here appears to encode a new isoform of NFATc.α that most likely resulted from alternative splicing and/or transcription from separate promoters. Expression Pattern of NFATc.β mRNA in Human Tissues Previous reports have shown that Northern analysis of NFATc using 5′-end fragments of NFATc cDNA as a probe displayed two hybridizing bands with apparent sizes of 2.7 and 4.5 kb (20Masuda E.S. Naito Y. Tokumitsu H. Campbell D. Saito F. Hannum C. Arai K. Arai N. Mol. Cell. Biol. 1995; 15: 2697-2706Crossref PubMed Scopus (198) Google Scholar, 21Hoey T. Sun Y.-L. Williamson K. Xu X. Immunity. 1995; 2: 461-472Abstract Full Text PDF PubMed Scopus (354) Google Scholar). To examine whether the new clone NFATc.β can be specifically assigned to one of these two bands, and to determine the tissue distribution of NFATc.β expression, we carried out Northern analysis of multiple human tissues using two separate probes. As expected, when a common sequence of NFATc.α and NFATc.β was used as a probe, two mRNA species with previously observed sizes were detected (Fig. 3). However, an NFATc.β unique probe corresponding to the region downstream from the rel similarity domain detected only the 4.5-kb band, indicating that this band represents NFATc.β mRNA. The 2.7-kb mRNA, on the other hand, appears to encode NFATc.α (19Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (525) Google Scholar), as assessed by the reported cDNA size and its tissue distribution. The expression pattern of these two mRNA species was distinct in different tissues. NFATc.α mRNA was predominantly expressed in the thymus and peripheral leukocytes, and at lower levels in the spleen. On the other hand, NFATc.β mRNA was preferentially expressed in the spleen and at lower levels in all other tissues tested. Interestingly, its expression level was higher than that of NFATc.α in all tissues except the thymus and peripheral leukocytes. Thus, it appears that expression of these two isoforms may be differentially regulated in a cell type-specific manner. To characterize biochemical properties of NFATc.β, we generated three recombinant derivatives of NFATc.β that were tagged with a hexahistidine at the NH2 terminus. NFATc.β(214-814) contains 601 amino acids corresponding to residues 214 to 814 which include the rel similarity domain (∼290 amino acids) and most residues at the COOH terminus of NFATc.β. The other two polypeptides were derived from NFATc.β(214-814) by further truncation of the COOH terminus as shown in Fig. 4A. The NFATc.β(214-703) polypeptide is devoid of most COOH-terminal residues of NFATc.β, and thus resembles NFATc.α. A deletion derivative of NFATp, NFATpXS(1-297), which contains the rel similarity domain of NFATp (36Jain J. Burgeon E. Badalian T.M. Hogan P.G. Rao A. J. Biol. Chem. 1995; 270: 4138-4145Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar), was also purified and used as a positive control in DNA binding assays. The deletion proteins were expressed in E. coli and purified by Ni-chelate affinity chromatography. The same amounts (2 µg) of purified proteins were separated on SDS-PAGE and stained with Coomassie Brilliant Blue. As shown in Fig. 4B, the protein preparations exhibited highly purified forms although there was evidence of partial degradation in the NFATc.β(214-814) recombinant protein. Using the purified NFATc.β(214-814), we tested sequence-specific DNA binding" @default.
• W2010931474 created "2016-06-24" @default.
• W2010931474 creator A5028264632 @default.
• W2010931474 creator A5057125764 @default.
• W2010931474 creator A5068283403 @default.
• W2010931474 date "1996-08-01" @default.
• W2010931474 modified "2023-09-27" @default.
• W2010931474 title "Characterization of a New Isoform of the NFAT (Nuclear Factor of Activated T Cells) Gene Family Member NFATc" @default.
• W2010931474 cites W1525008978 @default.
• W2010931474 cites W1538787080 @default.
• W2010931474 cites W1539959872 @default.
• W2010931474 cites W1584114579 @default.
• W2010931474 cites W1601157315 @default.
• W2010931474 cites W1827812119 @default.
• W2010931474 cites W1969971113 @default.
• W2010931474 cites W1969987028 @default.
• W2010931474 cites W2000536954 @default.
• W2010931474 cites W2002485919 @default.
• W2010931474 cites W2005821373 @default.
• W2010931474 cites W2012597218 @default.
• W2010931474 cites W2017467565 @default.
• W2010931474 cites W2019122675 @default.
• W2010931474 cites W2026181894 @default.
• W2010931474 cites W2039766781 @default.
• W2010931474 cites W2047198875 @default.
• W2010931474 cites W2051237803 @default.
• W2010931474 cites W2053132428 @default.
• W2010931474 cites W2059195281 @default.
• W2010931474 cites W2061029168 @default.
• W2010931474 cites W2062925771 @default.
• W2010931474 cites W2076338812 @default.
• W2010931474 cites W2092306121 @default.
• W2010931474 cites W2093760702 @default.
• W2010931474 cites W2096158027 @default.
• W2010931474 cites W2112278496 @default.
• W2010931474 cites W2131656392 @default.
• W2010931474 cites W2135557282 @default.
• W2010931474 cites W2145010599 @default.
• W2010931474 cites W2146963242 @default.
• W2010931474 cites W2151025733 @default.
• W2010931474 cites W2152394477 @default.
• W2010931474 cites W2161788277 @default.
• W2010931474 cites W2239911109 @default.
• W2010931474 cites W2324275051 @default.
• W2010931474 doi "https://doi.org/10.1074/jbc.271.34.20914" @default.
• W2010931474 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8702849" @default.
• W2010931474 hasPublicationYear "1996" @default.
• W2010931474 type Work @default.
• W2010931474 sameAs 2010931474 @default.
• W2010931474 citedByCount "80" @default.
• W2010931474 countsByYear W20109314742012 @default.
• W2010931474 countsByYear W20109314742013 @default.
• W2010931474 countsByYear W20109314742014 @default.
• W2010931474 countsByYear W20109314742015 @default.
• W2010931474 countsByYear W20109314742016 @default.
• W2010931474 countsByYear W20109314742018 @default.
• W2010931474 countsByYear W20109314742020 @default.
• W2010931474 countsByYear W20109314742021 @default.
• W2010931474 countsByYear W20109314742023 @default.
• W2010931474 crossrefType "journal-article" @default.
• W2010931474 hasAuthorship W2010931474A5028264632 @default.
• W2010931474 hasAuthorship W2010931474A5057125764 @default.
• W2010931474 hasAuthorship W2010931474A5068283403 @default.
• W2010931474 hasBestOaLocation W20109314741 @default.
• W2010931474 hasConcept C104317684 @default.
• W2010931474 hasConcept C189938988 @default.
• W2010931474 hasConcept C29512474 @default.
• W2010931474 hasConcept C49805395 @default.
• W2010931474 hasConcept C53345823 @default.
• W2010931474 hasConcept C54355233 @default.
• W2010931474 hasConcept C86339819 @default.
• W2010931474 hasConcept C86803240 @default.
• W2010931474 hasConcept C95444343 @default.
• W2010931474 hasConceptScore W2010931474C104317684 @default.
• W2010931474 hasConceptScore W2010931474C189938988 @default.
• W2010931474 hasConceptScore W2010931474C29512474 @default.
• W2010931474 hasConceptScore W2010931474C49805395 @default.
• W2010931474 hasConceptScore W2010931474C53345823 @default.
• W2010931474 hasConceptScore W2010931474C54355233 @default.
• W2010931474 hasConceptScore W2010931474C86339819 @default.
• W2010931474 hasConceptScore W2010931474C86803240 @default.
• W2010931474 hasConceptScore W2010931474C95444343 @default.
• W2010931474 hasIssue "34" @default.
• W2010931474 hasLocation W20109314741 @default.
• W2010931474 hasOpenAccess W2010931474 @default.
• W2010931474 hasPrimaryLocation W20109314741 @default.
• W2010931474 hasRelatedWork W2010931474 @default.
• W2010931474 hasRelatedWork W2012831646 @default.
• W2010931474 hasRelatedWork W2039846615 @default.
• W2010931474 hasRelatedWork W2083692829 @default.
• W2010931474 hasRelatedWork W2091426442 @default.
• W2010931474 hasRelatedWork W2104582299 @default.
• W2010931474 hasRelatedWork W4232776629 @default.
• W2010931474 hasRelatedWork W4244519304 @default.
• W2010931474 hasRelatedWork W8444092 @default.
• W2010931474 hasRelatedWork W2184675534 @default.
• W2010931474 hasVolume "271" @default.
• W2010931474 isParatext "false" @default.

• next