FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2011817021> ?p ?o ?g. }

• W2011817021 endingPage "18721" @default.
• W2011817021 startingPage "18711" @default.
• W2011817021 abstract "Members of the archease superfamily of proteins are represented in all three domains of life. Archease genes are generally located adjacent to genes encoding proteins involved in DNA or RNA processing. Archease have therefore been predicted to play a modulator or chaperone role in selected steps of DNA or RNA metabolism, although the roles of archeases remain to be established experimentally. Here we report the function of one of these archeases from the hyperthermophile Pyrococcus abyssi. The corresponding gene (PAB1946) is located in a bicistronic operon immediately upstream from a second open reading frame (PAB1947), which is shown here to encode a tRNA m5C methyltransferase. In vitro, the purified recombinant methyltransferase catalyzes m5C formation at several cytosines within tRNAs with preference for C49. The specificity of the methyltransferase is increased by the archease. In solution, the archease exists as a monomer, trimer, and hexamer. Only the oligomeric states bind the methyltransferase and prevent its aggregation, in addition to hindering dimerization of the methyltransferase-tRNA complex. This P. abyssi system possibly reflects the general function of archeases in preventing protein aggregation and modulating the function of their accompanying proteins. Members of the archease superfamily of proteins are represented in all three domains of life. Archease genes are generally located adjacent to genes encoding proteins involved in DNA or RNA processing. Archease have therefore been predicted to play a modulator or chaperone role in selected steps of DNA or RNA metabolism, although the roles of archeases remain to be established experimentally. Here we report the function of one of these archeases from the hyperthermophile Pyrococcus abyssi. The corresponding gene (PAB1946) is located in a bicistronic operon immediately upstream from a second open reading frame (PAB1947), which is shown here to encode a tRNA m5C methyltransferase. In vitro, the purified recombinant methyltransferase catalyzes m5C formation at several cytosines within tRNAs with preference for C49. The specificity of the methyltransferase is increased by the archease. In solution, the archease exists as a monomer, trimer, and hexamer. Only the oligomeric states bind the methyltransferase and prevent its aggregation, in addition to hindering dimerization of the methyltransferase-tRNA complex. This P. abyssi system possibly reflects the general function of archeases in preventing protein aggregation and modulating the function of their accompanying proteins. Archease proteins were first annotated in archaeal and eukaryal genomes and were later shown also to be present in the Bacteria (1Canaves J.M. Proteins. 2004; 56: 19-27Crossref PubMed Scopus (10) Google Scholar). According to present data base records, members of the archease superfamily belong to a cluster of orthologue genes (COG1371) and are represented in 28 eukaryal, 18 bacterial, and 25 archaeal species. This suggests that the function of these proteins has been phylogenetically conserved. However, the precise nature of this function has remained undetermined. The structures of two archeases, MTH1598 from the Archaea Methanobacter thermoautotrophicum (2Yee A. Chang X. Pineda-Lucena A. Wu B. Semesi A. Le B. Ramelot T. Lee G.M. Bhattacharyya S. Gutierrez P. Denisov A. Lee C.H. Cort J.R. Kozlov G. Liao J. Finak G. Chen L. Wishart D. Lee W. McIntosh L.P. Gehring K. Kennedy M.A. Edwards A.M. Arrowsmith C.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1825-1830Crossref PubMed Scopus (181) Google Scholar) and TM1083 from the thermophile bacterium Thermotoga maritima (3Lesley S.A. Kuhn P. Godzik A. Deacon A.M. Mathews I. Kreusch A. Spraggon G. Klock H.E. McMullan D. Shin T. Vincent J. Robb A. Brinen L.S. Miller M.D. McPhillips T.M. Miller M.A. Scheibe D. Canaves J.M. Guda C. Jaroszewski L. Selby T.L. Elsliger M.A. Wooley J. Taylor S.S. Hodgson K.O. Wilson I.A. Schultz P.G. Stevens R.C. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11664-11669Crossref PubMed Scopus (382) Google Scholar), have been solved. The two structures superimpose quite well (root mean square deviation (r.m.s.d.) 5The abbreviations used are: r.m.s.d., root mean square deviation; ORF, open reading frame; BSA, bovine serum albumin; DTT, dithiothreitol; MALDI, matrix-assisted laser desorption ionization; AdoMet, S-adenosylmethionine. = 2.6 Å) despite the relatively low identity (14.8%) in their amino acid sequences (1Canaves J.M. Proteins. 2004; 56: 19-27Crossref PubMed Scopus (10) Google Scholar). Intriguingly, the two archease structures are also similar to that of the heat shock protein Hsp33 (r.m.s.d. = 3.1 Å) (4Jaroszewski L. Schwarzenbacher R. McMullan D. Abdubek P. Agarwalla S. Ambing E. Axelrod H. Biorac T. Canaves J.M. Chiu H.J. Deacon A.M. DiDonato M. Elsliger M.A. Godzik A. Grittini C. Grzechnik S.K. Hale J. Hampton E. Han G.W. Haugen J. Hornsby M. Klock H.E. Koesema E. Kreusch A. Kuhn P. Lesley S.A. Miller M.D. Moy K. Nigoghossian E. Paulsen J. Quijano K. Reyes R. Rife C. Spraggon G. Stevens R.C. van den Bedem H. Velasquez J. Vincent J. White A. Wolf G. Xu Q. Hodgson K.O. Wooley J. Wilson I.A. Proteins. 2005; 61: 669-673Crossref PubMed Scopus (9) Google Scholar, 5Janda I. Devedjiev Y. Derewenda U. Dauter Z. Bielnicki J. Cooper D.R. Graf P.C. Joachimiak A. Jakob U. Derewenda Z.S. Structure (Lond.). 2004; 12: 1901-1907Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) and the gyrase inhibitory protein GyrI (r.m.s.d. = 3.1 Å) (6Romanowski M.J. Gibney S.A. Burley S.K. Proteins. 2002; 47: 403-407Crossref PubMed Scopus (19) Google Scholar). Protein Hsp33 is activated by oxidative stress and protects unfolded proteins against aggregation, whereas GyrI interacts specifically with DNA gyrase to inhibit its supercoiling activity. The structural resemblance to these proteins suggests that archeases might be engaged in similar functions. Archeases contain two SHS2 modules (also called βαβ2 folds) that are found in other proteins, including the ATPase FtsA, the RNA polymerase subunit Rpb7p, and GyrI (7Anantharaman V. Aravind L. Proteins. 2004; 56: 795-807Crossref PubMed Scopus (23) Google Scholar). The two SHS2 modules in GyrI are arranged in a tandem and opposite orientation, whereas in the MTH1598 and TM1083 archeases the one SHS2 module is inserted within the other. Hsp33 has no SHS2 fold, although it possesses two slightly different S2HS2 modules (β2αβ2) arranged in the same manner as in the MTH1598 and TM1083 archeases. The S2HS2 modules probably mediate protein-protein interactions, as has been postulated for SHS2 domains (7Anantharaman V. Aravind L. Proteins. 2004; 56: 795-807Crossref PubMed Scopus (23) Google Scholar). Further clues as to the function of archeases come from genome analyses, which reveal that all archease genes are adjacent to an ORF encoding a protein involved in nucleic acid processing, such as a DNA gyrase, a polymerase, or an RNA helicase (1Canaves J.M. Proteins. 2004; 56: 19-27Crossref PubMed Scopus (10) Google Scholar, 7Anantharaman V. Aravind L. Proteins. 2004; 56: 795-807Crossref PubMed Scopus (23) Google Scholar). The structure and the genomic location of archeases suggest that they might interact directly with these proteins. In support of this hypothesis, we additionally note that the C-terminal end of a putative Thiobacillus denitrificans tRNA nucleotidyltransferase is an archease sequence (EMBL data base number Q3SGD7). In the genome of the extreme thermophile Pyrococcus abyssi, an archease gene (PAB1946) is located immediately upstream from PAB1947 forming a putative bicistronic operon (8Alm E.J. Huang K.H. Price M.N. Koche R.P. Keller K. Dubchak I.L. Arkin A.P. Genome Res. 2005; 15: 1015-1022Crossref PubMed Scopus (165) Google Scholar, 9Price M.N. Huang K.H. Alm E.J. Arkin A.P. Nucleic Acids Res. 2005; 33: 880-892Crossref PubMed Scopus (285) Google Scholar). PAB1947 contains the Sun/NOL1/NOP2 family signature (Prosite profile PS01153) suggesting that it encodes an RNA m5C methyltransferase. To date, the specific RNA modifications sites of four RNA m5C methyltransferases have been identified. Two of these enzymes, the Escherichia coli rRNA m5C methyltransferases RsmB (10Gu X.R. Gustafsson C. Ku J. Yu M. Santi D.V. Biochemistry. 1999; 38: 4053-4057Crossref PubMed Scopus (56) Google Scholar, 11Tscherne J.S. Nurse K. Popienick P. Michel H. Sochacki M. Ofengand J. Biochemistry. 1999; 38: 1884-1892Crossref PubMed Scopus (67) Google Scholar) and RsmF (originally annotated as YebU) (12Andersen N.M. Douthwaite S. J. Mol. Biol. 2006; 359: 777-786Crossref PubMed Scopus (95) Google Scholar), are site-specific and modify 16 S rRNA at positions C967 and C1407, respectively. The two other characterized m5C methyltransferases modify eukaryal tRNAs. The Trm4 enzyme from Saccharomyces cerevisiae targets multiple cytidines within different tRNA, modifying positions 34 or 40 in an intron-dependent manner and positions 48 and/or 49 in an intron-independent manner (13Motorin Y. Grosjean H. RNA (N. Y.). 1999; 5: 1105-1118Crossref PubMed Scopus (151) Google Scholar). The orthologous Trm4 enzyme in humans appears to target only cytidine 34 within the intron-containing tRNALeu (14Brzezicha B. Schmidt M. Makalowska I. Jarmolowski A. Pienkowska J. Szweykowska-Kulinska Z. Nucleic Acids Res. 2006; 34: 6034-6043Crossref PubMed Scopus (135) Google Scholar). The m5C modification is common in archaeal and eukaryal tRNAs (15Sprinzl M. Vassilenko K.S. Nucleic Acids Res. 2005; 33: D139-D140Crossref PubMed Scopus (353) Google Scholar) (summarized in Fig. 1) and is frequently found at nucleotides 48 and 49, where it improves base stacking and enhances tRNA stability (16Sowers L.C. Shaw B.R. Sedwick W.D. Biochem. Biophys. Res. Commun. 1987; 148: 790-794Crossref PubMed Scopus (103) Google Scholar, 17Nobles K.N. Yarian C.S. Liu G. Guenther R.H. Agris P.F. Nucleic Acids Res. 2002; 30: 4751-4760Crossref PubMed Scopus (58) Google Scholar). Of the presently characterized m5C methyltransferases, P. abyssi PAB1947 shows greatest sequence similarity to the Trm4 enzyme (13Motorin Y. Grosjean H. RNA (N. Y.). 1999; 5: 1105-1118Crossref PubMed Scopus (151) Google Scholar, 18King M.Y. Redman K.L. Biochemistry. 2002; 41: 11218-11225Crossref PubMed Scopus (83) Google Scholar, 19Bujnicki J.M. Feder M. Ayres C.L. Redman K.L. Nucleic Acids Res. 2004; 32: 2453-2463Crossref PubMed Scopus (80) Google Scholar), suggesting a similar substrate specificity. In this study, we determine the functions of the gene products encoded by the P. abyssi PAB1946 (the archease) and PAB1947 (the putative methyltransferase). We establish that PAB1947 does indeed encode a tRNA m5C methyltransferase, and we localize its tRNA methylation sites by a combination of biochemical and mass spectrometric techniques. Furthermore, we establish how the substrate specificity of the tRNA m5C methyltransferase and its tendency to aggregate are influenced over a range of temperatures by the P. abyssi archease. The study provides the first experimental evidence for how an archease and its co-expressed enzyme operate as a functional couple. Cloning of the P. abyssi Open Reading Frames PAB1946 and PAB1947—Recombinant versions of the archease (PAB1946) and putative methyltransferase (PAB1947) proteins were constructed with a His6 tag at their N-terminal ends. The genes were amplified from P. abyssi genomic DNA using the following PCR primers: AAAACCATGGGTCATCATCATCATCATCACAAGAGATGGGAGCACTATG (5′-primer) and AAAACTCGAGTCATATGTCGGGGACAAG (3′-primer) for PAB1946, and AAAACCATGGGTCATCATCATCATCATCACATGGACTACAAGGAAGAAT (5′-primer) and AAAACTCGAGTCACCTCGGCTTCCTTATCTTAG (3′-primer) for PAB1947. The 5′-primers created the ATG start codon in the NcoI restriction site followed by six histidine codons. The 3′-primers introduced an XhoI restriction site immediately downstream from the TGA stop codon. The amplified fragments were cut with NcoI and XhoI restriction enzymes, and were cloned into the same sites in the expression vectors pET28b and pET15b (Novagen) for PAB1946 and PAB1947, respectively. Overexpression and Purification of Recombinant Archease and PAB1947 Proteins—Archease and the PAB1947 enzyme were overexpressed in separate clones of E. coli BL21 (DE3) CodonPlus RIL (Stratagene). Transformed cells were grown at 37 °C in LB medium containing chloramphenicol and were supplemented with kanamycin for the archease plasmid and ampicillin for the PAB1947 plasmid. Recombinant protein expression was induced by 1 mm of isopropyl thiogalactopyranoside when the culture absorbance reached 0.7 at 600 nm. After a further 3 h at 28°C, cells were harvested and resuspended in 5 volumes of buffer A (50 mm sodium phosphate, pH 7.5, 300 mm NaCl, 10 mm imidazole, 10% glycerol, 5 mm β-mercaptoethanol) supplemented with 1% (v/v) Protease Inhibitor Mixture (Sigma). For the PAB1947 enzyme, NaCl was increased to 1 m to prevent co-purification of nucleic acids. Cells were lysed by sonication and centrifuged at 15,000 × g for 30 min at 4 °C. The archease supernatant was added to nickel-nitrilotriacetic acid Superflow™ resin (Qiagen) and mixed during 30 min at 4 °C. Special care was required to avoid aggregation of the PAB1947 enzyme, which was loaded in batches onto the resin, and purification was carried out at room temperature. Resin columns were washed with 20 mm imidazole in buffer A, and proteins were eluted with buffer A containing 250 mm imidazole for archease and 150 mm imidazole for the PAB1947 enzyme. The final respective yields were 45 and 35 mg of recombinant protein per liter of culture. After purification, archease was dialyzed against 25 mm Tris-Cl, pH 7.5, 100 mm NaCl, 10% glycerol, 1 mm DTT; for the PAB1947 enzyme, the buffer contained 300 mm NaCl. Both proteins were stored in aliquots at –80 °C. Cloning of the P. abyssi tRNAAsp Gene—The P. abyssi tRNAAsp gene was cloned for transcription by T7 RNA polymerase. Overlapping DNA oligonucleotides were annealed, elongated, and then amplified using Platinum™ Pfx DNA polymerase (Invitrogen). The oligodeoxynucleotides sequences were as follows: (+) primer, CCCAAGCTTAATACGACTCACTATAGCCCGGGTGGTGTAGCCCGGCCTATCATGCGGGACTGTCAC; and (–) primer, CGCGGATCCTGGCGCCCGGGCCGGGATTTGAACCCGGGTCGCGGGAGTGACAGTCCCGCATGATAGGCCG. The (+) primer contained a HindIII site (underlined) upstream from the T7 promoter (italic type), and the (–) primer contained BamHI (underlined) and MvaI sites (boldface type), positioned to cleave the template for in vitro transcription. The PCR product was digested with HindIII and BamHI and was inserted into the same sites in plasmid pUC18. T7 in Vitro Transcriptions of RNA—Transcription of the tRNA genes with radiolabeled [α-32P]CTP were transcribed in vitro from the T7 promoter as described previously (20Auxilien S. Crain P.F. Trewyn R.W. Grosjean H. J. Mol. Biol. 1996; 262: 437-458Crossref PubMed Scopus (92) Google Scholar). The plasmid templates were digested with MvaI for P. abyssi tRNAAsp and E. coli tRNATyr2 and with BamHI for P. abyssi tRNALeu1 prior to transcription. Nonradioactive tRNAs were synthesized by using the RiboMAX™ large scale RNA production system-T7 (Promega). All tRNA transcripts were purified on 6% polyacrylamide gels; yields were around 100 μg of transcript from 10 μg of plasmid template. The rRNA fragments radiolabeled with [α-32P]CTP were T7-transcribed in vitro from single-stranded DNA templates (21Becker H.F. Motorin Y. Sissler M. Florentz C. Grosjean H. J. Mol. Biol. 1997; 274: 505-518Crossref PubMed Scopus (53) Google Scholar). Methyltransferase Assays—Methylation reactions were carried out in 50 μl of 25 mm Tris-Cl, pH 7.5, 50 mm KCl, 2 mm DTT, 80 μm AdoMet (i.e. in large excess), 1 mg/ml RNase-free bovine serum albumin (Worthington), with 1 nm32P-radiolabeled RNA and 200 nm PAB1947 enzyme. In some experiments, radiolabeled tRNA (1 nm) and unlabeled tRNA (200 nm) were mixed to increase the substrate concentration. Reactions were quenched by phenol/chloroform extraction; tRNA were digested with nuclease P1 (Roche Applied Science); and modified nucleotides were identified by two-dimensional thin layer chromatography (20Auxilien S. Crain P.F. Trewyn R.W. Grosjean H. J. Mol. Biol. 1996; 262: 437-458Crossref PubMed Scopus (92) Google Scholar). Radiolabeled mono-nucleotide spots were quantified using a Storm™ system (GE Healthcare). Methyltransferase assays using nonradioactive RNA and 0.67 μm tritiated AdoMet (GE Healthcare) were carried out at 50 °C to avoid thermal degradation of the cofactor (13Motorin Y. Grosjean H. RNA (N. Y.). 1999; 5: 1105-1118Crossref PubMed Scopus (151) Google Scholar). Other components in the reaction were unchanged, except that 0.3 μg of tRNA transcript or poly(C) RNA (Roche Applied Science) was used. In some samples, 1.2 or 4 μm archease was added, corresponding to a 6- or 20-fold molar excess over the PAB1947 enzyme. MALDI Mass Spectrometry Analysis—Nonradioactive tRNA transcripts at 200 nm were methylated as above with the exception that KCl was replaced with ammonium acetate, pH 7.5. After 10 min of incubation at 80 °C, reactions were stopped by phenol/chloroform extraction, and tRNA was recovered by ethanol precipitation with 300 mm ammonium acetate, pH 5.5. The tRNA was digested with 10–20 units of RNase T1 (U. S. Biochemical Corp.) in 0.5 μl of 0.5 m 3-hydroxypicolinic acid at 37 °C for 2 h. Cyclic phosphates were hydrolyzed with HCl, and the RNA oligonucleotides were dried and redissolved in H2O (12Andersen N.M. Douthwaite S. J. Mol. Biol. 2006; 359: 777-786Crossref PubMed Scopus (95) Google Scholar). Mass spectra were recorded in reflector and positive ion mode on a Voyager-DE STR mass spectrometer (PerSeptive Biosystems); spectra were smoothed and calibrated using “m/z” software (Proteometrics Inc). Tandem mass spectra were recorded in positive ion mode on a MicroMass MALDI Q-Time-of-Flight Ultima mass spectrometer (22Kirpekar F. Krogh T.N. Rapid Commun. Mass Spectrom. 2001; 15: 8-14Crossref PubMed Scopus (57) Google Scholar). The collision energy used for tandem mass spectrometry was varied between 30 and 110 eV. All tandem mass spectra were smoothed using the MassLynx software supplied by the manufacturer. Determination of m5C Level in T1 Oligonucleotides of P. abyssi tRNAAsp—[α-32P]CTP-labeled P. abyssi tRNAAsp was methylated as described above with or without a 10-fold molar excess of archease. After 10 min at 80 °C, the tRNA was extracted with phenol and recovered by ethanol precipitation. The tRNA was then digested by overnight incubation in 25 mm Tris-Cl, pH 7.5, at 37 °C with 10 units of RNase T1 and 10 μg of unlabeled carrier tRNA (yeast total tRNA; Roche Applied Science). The individual RNA oligonucleotides were purified on denaturing 20% polyacrylamide gels, and after extraction as described (23Brule H. Grosjean H. Giege R. Florentz C. Biochimie (Paris). 1998; 80: 977-985Crossref PubMed Scopus (13) Google Scholar), they were digested with nuclease P1. The resulting mononucleotides were analyzed by two-dimensional thin layer chromatography (20Auxilien S. Crain P.F. Trewyn R.W. Grosjean H. J. Mol. Biol. 1996; 262: 437-458Crossref PubMed Scopus (92) Google Scholar). Gel Retardation Experiments—Radiolabeled RNA (10 fmol) was incubated with the PAB1947 enzyme and/or archease (at a 1:6 molar ratio, respectively, when used together) in 20 μl of 25 mm Tris-HCl, pH 7.5, 50 mm NaCl, 10% glycerol, 0.1 mg/ml RNase-free bovine serum albumin, 2 mm DTT at 25 °C for 20 min. Samples were quenched on ice, and bromphenol blue was added to 0.05% prior to loading on 6% polyacrylamide gels (mono/bisacrylamide, 37.5:1) containing 5% glycerol and 1 mm EDTA in 0.5× TBE at 4 °C. After electrophoresis and drying, gel bands were scanned with a Storm™ system (GE Healthcare). Gel Filtration and Stokes Radius Determination—The interaction of PAB1947 enzyme with archease was studied by gel filtration on a Superdex™ 75 HR 10/30 column (GE Healthcare) equilibrated with 25 mm Tris-Cl, pH 7.5, 100 mm NaCl, 10% glycerol, 5 mm EDTA. Samples, in 200 μl of the same buffer containing 150 μg (20 μm) PAB1947 enzyme and/or 450 μg (130 μm) archease, were incubated for 30 min at ambient temperature (18–20 °C) before loading onto the column and eluting at a flow rate of 0.5 ml/min. For Stokes radius (RS) determination, the column was calibrated with bovine γ-globulin (158,000 Da; RS = 45 Å), chicken ovalbumin (44,000 Da; RS = 27.5 Å), equine myoglobin (17,000 Da; RS = 20 Å) (Bio-Rad), and bovine brain tubulin (100,000 Da; RS = 41.5 Å (24Curmi P.A. Andersen S.S. Lachkar S. Gavet O. Karsenti E. Knossow M. Sobel A. J. Biol. Chem. 1997; 272: 25029-25036Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar)). The void volume of the column was determined from the elution volume of blue dextran. The Stokes radii of archease, PAB1947 enzyme, and their complexes were determined using Equation 1, according to Ref. (25Siegel L.M. Monty K.J. Biochim. Biophys. Acta. 1966; 112: 346-362Crossref PubMed Scopus (1547) Google Scholar), -logKav=f(RS)(Eq. 1) where Kav is the molecular sieve coefficient ((Velution – V0)/(Vgel bed – V0)). Binding of tRNA to PAB1947 or the archease-PAB1947 complex was followed by Superdex™ 200 HR 10/300 GL gel filtration (GE Healthcare) as described above. The PAB1947-tRNA complex was formed between 16 μm PAB1947 enzyme and 2.8 μm (15 μg) natural E. coli tRNATyr2 (Sigma); to form the tripartite complex, 100 μm (360 μg) archease was added before the E. coli tRNATyr2. Sedimentation Velocity and Molecular Mass Calculation—Sedimentation velocity experiments were carried out with a Beckman Optima XL-A analytical ultracentrifuge equipped with a 60 Ti four-hole rotor and cells with two-channel 12-mm path length centerpieces. Measurements were made at 50,000 rpm and at 18 °C with PAB1947 enzyme at 0.3 mg/ml and archease at 0.9 mg/ml in 25 mm Tris-Cl, pH 7.5, 100 mm NaCl, and 10% glycerol. The solvent density was 1.032 g ·cm–3, and partial specific volumes of PAB1947 enzyme (0.7441 cm3 ·g–1) and archease (0.7405 cm3 ·g–1) were calculated using SEDNTERP software (26Philo J.S. Schuster T.M. Laue T.M. Modern Analytical Ultracentrifugation. Birkhauser Boston, Inc., Cambridge, MA1994: 156-170Crossref Google Scholar). The apparent distributions of sedimentation coefficients were calculated using Svedberg (26Philo J.S. Schuster T.M. Laue T.M. Modern Analytical Ultracentrifugation. Birkhauser Boston, Inc., Cambridge, MA1994: 156-170Crossref Google Scholar) and Sedfit (27Schuck P. Scott D.J. Harding S.E. Rowe A.J. Modern Analytical Ultracentrifugation: Techniques and Methods. Royal Society of Chemistry, Cambridge, UK2005: 26-60Google Scholar, 28Dam J. Schuck P. Biophys. J. 2005; 89: 651-666Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 29Dam J. Velikovsky C.A. Mariuzza R.A. Urbanke C. Schuck P. Biophys. J. 2005; 89: 619-634Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar) programs. The apparent molecular masses of the proteins were calculated from the Stokes radii and sedimentation coefficients using the modified Svedberg Equation 2 (25Siegel L.M. Monty K.J. Biochim. Biophys. Acta. 1966; 112: 346-362Crossref PubMed Scopus (1547) Google Scholar), M=6πηN(1-vρ)⋅Rs⋅s(Eq. 2) where M is molecular mass; η is viscosity of the medium (10–2 g ·cm–1 ·s–1); N is Avogadro's number; RS is Stokes radius, s is sedimentation coefficient, v is partial specific volume, and ρ is density of the medium. Sedimentation Equilibrium—Sedimentation equilibrium experiments were performed at 10,000 rpm and at 18 °C. Radial scans of the absorbance at 280 nm were taken at 3-h intervals, and equilibrium was reached after 24 h of centrifugation. The base line was recorded at 60,000 rpm, at the end of the experiment. The data were analyzed with XLAEQ and EQASSOC programs (Beckman) to calculate molecular weights. Aggregation Analyses—The PAB1947 enzyme was adjusted to a final concentration of 0.06 mg/ml in 20 μl of 25 mm Tris-Cl, pH 7.5, 50 mm KCl, 2 mm DTT, with or without 0.18 mg/ml of archease or BSA. Samples were incubated for 10 min at 4, 60, 65, 70, or 80 °C and were then centrifuged at 12,000 × g for 15 min. The pellets were resuspended in 20 μl of the same buffer and were analyzed by SDS-PAGE together with the supernatants. The P. abyssi ORF PAB1947 Encodes a tRNA m5C Methyltransferase—BLAST analysis (30Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (60216) Google Scholar) of the P. abyssi genome identified five potential RNA m5C methyltransferases. Of these, the sequence encoded by PAB1947 is most similar to the tRNA m5C methyltransferase from S. cerevisiae, Trm4p (13Motorin Y. Grosjean H. RNA (N. Y.). 1999; 5: 1105-1118Crossref PubMed Scopus (151) Google Scholar, 18King M.Y. Redman K.L. Biochemistry. 2002; 41: 11218-11225Crossref PubMed Scopus (83) Google Scholar, 19Bujnicki J.M. Feder M. Ayres C.L. Redman K.L. Nucleic Acids Res. 2004; 32: 2453-2463Crossref PubMed Scopus (80) Google Scholar). The P. abyssi PAB1947 gene was cloned in E. coli and expressed with an N-terminal His tag. The activity of the purified recombinant PAB1947 protein was tested at 50 and 80 °C against tRNA transcripts containing radiolabeled cytidine. The incubation temperatures in vitro were lower than that for optimal growth of P. abyssi (103 °C) to reduce breakdown of the individual components of the reaction. After methylation, nucleotide monophosphates were derived from the transcripts by nuclease P1 digestion and were analyzed by thin layer chromatography. Analyses of P. abyssi tRNAAsp (Fig. 2A), P. abyssi tRNALeu1, and E. coli tRNATyr2 transcripts (not shown) demonstrated that the recombinant PAB1947 protein is indeed an m5C methyltransferase and uses AdoMet as the methyl donor. Time courses of the methylation reactions were performed at 80 °C with P. abyssi tRNAAsp and tRNALeu1 (Fig. 2B). After 10 min, the PAB1947 enzyme had methylated 1.6 cytosines per tRNAAsp and 2.6 cytosines in tRNALeu1. The tRNA substrates at 200-fold higher concentrations were also methylated, and this resulted in a lower final level of m5C incorporation (Fig. 2B). The mesophilic E. coli tRNATyr2 was tested only at 50 °C to avoid degradation at the higher temperature. The PAB1947 enzyme is active on all the tRNA substrates at 50 °C (Fig. 2C), although methylation is slower than at 80 °C. Surprisingly, small fragments of ribosomal RNA (Fig. 2D) were also methylated by the PAB1947 enzyme, despite having no obvious structural similarities to tRNAs. The Unassisted PAB1947 Enzyme Methylates Multiple Cytosines in P. abyssi tRNA—Pyrococcal tRNAs have been shown previously to contain m5C (31Kowalak J.A. Dalluge J.J. McCloskey J.A. Stetter K.O. Biochemistry. 1994; 33: 7869-7876Crossref PubMed Scopus (177) Google Scholar), although the positions of these modifications were not determined. Here we have mapped the methylation sites in P. abyssi tRNAAsp (Fig. 3A) after incubation at 80 °C under conditions where 0.3 mol of m5C was incorporated per mol of tRNA. The methylated tRNA was digested with the guanosine-specific RNase T1, and the oligonucleotides were analyzed by MALDI mass spectrometry. In the mass spectra (Fig. 3B), proportions of six oligonucleotides were 14 Da larger than would be expected from their predicted masses (Fig. 3C), indicating that the recombinant PAB1947 enzyme had methylated at least six different nucleotides in the tRNAAsp. The number of methylation sites is potentially higher, as some oligonucleotides (such as in the oligonucleotide CCCG) contain several cytosines and could be substoichiometrically modified at more than one cytosine under the conditions used here. From the compilation of known methylation sites (Fig. 1), only the fragments 35–43 and 47–51 were expected to contain targets for methylation. When tRNA was incubated with the PAB1947 enzyme at 50 °C instead of 80 °C, methylation became more specific for the 47–51 sequence, indicating that this oligonucleotide contained the preferred target. This methylated oligonucleotide (m/z 1622.3) was analyzed by tandem mass spectrometry, and the primary site of PAB1947 methylation was unambiguously identified as the tRNA cytidine 49 (Fig. 4). The methylation site was localized more precisely to the cytosine base of nucleotide 49 from the combination of ions, including y3 that had lost methylcytosine (m/z 863.1), the free methylcytosine ion (m/z 126.1), and the lack of any methylribose ion (at m/z 111.1). Nonspecific Methylation in Vitro of Poly(C) RNA by PAB1947—Our observation that a large variety of RNAs could serve as substrates for the PAB1947 enzyme in vitro was tested further using a poly(C) RNA. The unstructured poly(C) RNA was effectively methylated at 50 °C, with most of the tritiated label from the AdoMet methyl donor becoming incorporated into the RNA (Fig. 5B). However, when the recombinant PAB1947 enzyme was substituted with a P. abyssi cell extract, no methylation of the poly(C) RNA occurred. Under comparable conditions, the cell extract efficiently catalyzed m5C formation in P. abyssi tRNAAsp transcripts, and retained this activity despite extensive dialysis (data not shown). Clearly, the naturally occurring tRNA m5C methyltransferase activity in P. abyssi cells has greater substrate specificity than the isolated recombinant PAB1947 enzyme, and this indicated that at least one essential component was missing from our in vitro assays. A clue as to what this component might be was given by its resilience to extensive dialysis. The high specificity of methylation exhibited by the P. abyssi cell extract was retained after dialysis through membranes with a cutoff at 14,000 Da. This ruled out the hypothetical component b" @default.
• W2011817021 created "2016-06-24" @default.
• W2011817021 creator A5006146881 @default.
• W2011817021 creator A5052534123 @default.
• W2011817021 creator A5053616262 @default.
• W2011817021 creator A5073956638 @default.
• W2011817021 creator A5075349967 @default.
• W2011817021 date "2007-06-01" @default.
• W2011817021 modified "2023-09-30" @default.
• W2011817021 title "Archease from Pyrococcus abyssi Improves Substrate Specificity and Solubility of a tRNA m5C Methyltransferase" @default.
• W2011817021 cites W1491492631 @default.
• W2011817021 cites W1539264168 @default.
• W2011817021 cites W1590313270 @default.
• W2011817021 cites W1640169075 @default.
• W2011817021 cites W181741071 @default.
• W2011817021 cites W1966497102 @default.
• W2011817021 cites W1977721212 @default.
• W2011817021 cites W1985428254 @default.
• W2011817021 cites W1989054182 @default.
• W2011817021 cites W1994926187 @default.
• W2011817021 cites W1997659862 @default.
• W2011817021 cites W2006710298 @default.
• W2011817021 cites W2010903160 @default.
• W2011817021 cites W2016753466 @default.
• W2011817021 cites W2021368140 @default.
• W2011817021 cites W2029112298 @default.
• W2011817021 cites W2032881391 @default.
• W2011817021 cites W2038989483 @default.
• W2011817021 cites W2047182256 @default.
• W2011817021 cites W2051323334 @default.
• W2011817021 cites W2051737779 @default.
• W2011817021 cites W2053216686 @default.
• W2011817021 cites W2053802188 @default.
• W2011817021 cites W2056377594 @default.
• W2011817021 cites W2063170944 @default.
• W2011817021 cites W2069737643 @default.
• W2011817021 cites W2083576886 @default.
• W2011817021 cites W2096002674 @default.
• W2011817021 cites W2104069149 @default.
• W2011817021 cites W2111578963 @default.
• W2011817021 cites W2112472128 @default.
• W2011817021 cites W2117239890 @default.
• W2011817021 cites W2119199330 @default.
• W2011817021 cites W2124013748 @default.
• W2011817021 cites W2124681451 @default.
• W2011817021 cites W2124800414 @default.
• W2011817021 cites W2136041406 @default.
• W2011817021 cites W2158714788 @default.
• W2011817021 cites W2165289664 @default.
• W2011817021 cites W2167673850 @default.
• W2011817021 cites W2169596493 @default.
• W2011817021 doi "https://doi.org/10.1074/jbc.m607459200" @default.
• W2011817021 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17470432" @default.
• W2011817021 hasPublicationYear "2007" @default.
• W2011817021 type Work @default.
• W2011817021 sameAs 2011817021 @default.
• W2011817021 citedByCount "37" @default.
• W2011817021 countsByYear W20118170212012 @default.
• W2011817021 countsByYear W20118170212014 @default.
• W2011817021 countsByYear W20118170212015 @default.
• W2011817021 countsByYear W20118170212016 @default.
• W2011817021 countsByYear W20118170212017 @default.
• W2011817021 countsByYear W20118170212018 @default.
• W2011817021 countsByYear W20118170212019 @default.
• W2011817021 countsByYear W20118170212020 @default.
• W2011817021 countsByYear W20118170212021 @default.
• W2011817021 countsByYear W20118170212022 @default.
• W2011817021 countsByYear W20118170212023 @default.
• W2011817021 crossrefType "journal-article" @default.
• W2011817021 hasAuthorship W2011817021A5006146881 @default.
• W2011817021 hasAuthorship W2011817021A5052534123 @default.
• W2011817021 hasAuthorship W2011817021A5053616262 @default.
• W2011817021 hasAuthorship W2011817021A5073956638 @default.
• W2011817021 hasAuthorship W2011817021A5075349967 @default.
• W2011817021 hasBestOaLocation W20118170211 @default.
• W2011817021 hasConcept C104317684 @default.
• W2011817021 hasConcept C153957851 @default.
• W2011817021 hasConcept C185592680 @default.
• W2011817021 hasConcept C33288867 @default.
• W2011817021 hasConcept C552990157 @default.
• W2011817021 hasConcept C55493867 @default.
• W2011817021 hasConcept C67705224 @default.
• W2011817021 hasConcept C91965660 @default.
• W2011817021 hasConceptScore W2011817021C104317684 @default.
• W2011817021 hasConceptScore W2011817021C153957851 @default.
• W2011817021 hasConceptScore W2011817021C185592680 @default.
• W2011817021 hasConceptScore W2011817021C33288867 @default.
• W2011817021 hasConceptScore W2011817021C552990157 @default.
• W2011817021 hasConceptScore W2011817021C55493867 @default.
• W2011817021 hasConceptScore W2011817021C67705224 @default.
• W2011817021 hasConceptScore W2011817021C91965660 @default.
• W2011817021 hasIssue "26" @default.
• W2011817021 hasLocation W20118170211 @default.
• W2011817021 hasOpenAccess W2011817021 @default.
• W2011817021 hasPrimaryLocation W20118170211 @default.
• W2011817021 hasRelatedWork W1243787592 @default.
• W2011817021 hasRelatedWork W1577592023 @default.
• W2011817021 hasRelatedWork W1974967661 @default.

• next