FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2011974549> ?p ?o ?g. }

• W2011974549 endingPage "49834" @default.
• W2011974549 startingPage "49825" @default.
• W2011974549 abstract "The role of the extracellular signal-regulated kinase (ERK) 1 and ERK2 in the neutrophil chemotactic response remains to be identified since a previously used specific inhibitor of MEK1 and MEK2, PD98059, that was used to provide evidence for a role of ERK1 and ERK2 in regulating chemotaxis, has recently been reported to also inhibit MEK5. This issue is made more critical by our present finding that human neutrophils express mitogen-activated protein (MAP) kinase/ERK kinase (MEK)5 and ERK5 (Big MAP kinase), and that their activities were stimulated by the bacterial tripeptide, formyl methionyl-leucyl-phenylalanine (fMLP). Dose response studies demonstrated a bell-shaped profile of fMLP-stimulated MEK5 and ERK5 activation, but this was left-shifted when compared with the profile of fMLP-stimulated chemotaxis. Kinetics studies demonstrated increases in kinase activity within 2 min, peaking at 3–5 min, and MEK5 activation was more persistent than that of ERK5. There were some similarities as well as differences in the pattern of activation between fMLP-stimulated ERK1 and ERK2, and MEK5-ERK5 activation. The up-regulation of MEK5-ERK5 activities was dependent on phosphatidylinositol 3-kinase. Studies with the recently described specific MEK inhibitor, PD184352, at concentrations that inhibited ERK1 and ERK2 but not ERK5 activity demonstrate that the ERK1 and ERK2 modules were involved in regulating fMLP-stimulated chemotaxis and chemokinesis. Our data suggest that the MEK5-ERK5 module is likely to regulate neutrophil responses at very low chemoattractant concentrations whereas at higher concentrations, a shift to the ERK1/ERK2 and p38 modules is apparent. The role of the extracellular signal-regulated kinase (ERK) 1 and ERK2 in the neutrophil chemotactic response remains to be identified since a previously used specific inhibitor of MEK1 and MEK2, PD98059, that was used to provide evidence for a role of ERK1 and ERK2 in regulating chemotaxis, has recently been reported to also inhibit MEK5. This issue is made more critical by our present finding that human neutrophils express mitogen-activated protein (MAP) kinase/ERK kinase (MEK)5 and ERK5 (Big MAP kinase), and that their activities were stimulated by the bacterial tripeptide, formyl methionyl-leucyl-phenylalanine (fMLP). Dose response studies demonstrated a bell-shaped profile of fMLP-stimulated MEK5 and ERK5 activation, but this was left-shifted when compared with the profile of fMLP-stimulated chemotaxis. Kinetics studies demonstrated increases in kinase activity within 2 min, peaking at 3–5 min, and MEK5 activation was more persistent than that of ERK5. There were some similarities as well as differences in the pattern of activation between fMLP-stimulated ERK1 and ERK2, and MEK5-ERK5 activation. The up-regulation of MEK5-ERK5 activities was dependent on phosphatidylinositol 3-kinase. Studies with the recently described specific MEK inhibitor, PD184352, at concentrations that inhibited ERK1 and ERK2 but not ERK5 activity demonstrate that the ERK1 and ERK2 modules were involved in regulating fMLP-stimulated chemotaxis and chemokinesis. Our data suggest that the MEK5-ERK5 module is likely to regulate neutrophil responses at very low chemoattractant concentrations whereas at higher concentrations, a shift to the ERK1/ERK2 and p38 modules is apparent. Neutrophils, while playing an important role in host defense by killing microbial pathogens, are also responsible for tissue destruction in inflammatory conditions such as rheumatoid arthritis (1Pillinger M.H. Abramson S.B. Rheum. Dis. Clin. North Am. 1995; 21: 691-714PubMed Google Scholar) and cystic fibrosis (2Doring G. Worlitzsch D. Paediatr. Respir. Rev. 2000; 1: 101-106Crossref PubMed Scopus (26) Google Scholar). A crucial initial step in this is the recruitment of neutrophils to sites of infection and inflammation by a process known as chemotaxis. A number of studies have reported that the extracellular signal-regulated protein kinase (ERK) 1The abbreviations used are: ERK, extracellular signal-regulated protein kinase; MAP kinase, mitogen-activated protein kinase; MEK, MAP kinase/ERK kinase; BMK, Big MAP kinase; PI 3-kinase, phosphatidylinositol 3-kinase; MEKK, MEK kinase; Tpl, tumor progression locus; Cot, cancer osaka thyroid; MLK, mixed lineage kinase, WNK, with no lysine; fMLP, formyl methionyl-leucyl-phenylalanine.1The abbreviations used are: ERK, extracellular signal-regulated protein kinase; MAP kinase, mitogen-activated protein kinase; MEK, MAP kinase/ERK kinase; BMK, Big MAP kinase; PI 3-kinase, phosphatidylinositol 3-kinase; MEKK, MEK kinase; Tpl, tumor progression locus; Cot, cancer osaka thyroid; MLK, mixed lineage kinase, WNK, with no lysine; fMLP, formyl methionyl-leucyl-phenylalanine. 1 and ERK2 modules are involved in regulating neutrophil chemotaxis (3Drost E.M. MacNee W. Eur. J. Immunol. 2002; 32: 393-403Crossref PubMed Scopus (113) Google Scholar, 4Hii C.S. Stacey K. Moghaddami N. Murray A.W. Ferrante A. Infect. Immun. 1999; 67: 1297-1302Crossref PubMed Google Scholar, 5Xythalis D. Frewin M.B. Gudewicz P.W. Inflammation. 2002; 26: 83-88Crossref PubMed Scopus (14) Google Scholar, 6Lehman J.A. Paul C.C. Baumann M.A. Gomez-Cambronero J. Am. J. Physiol. Cell. Physiol. 2001; 280: C183-C191Crossref PubMed Google Scholar, 7Nagata T. Kansha M. Irita K. Takahashi S. Br. J. Anaesth. 2001; 86: 853-858Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). These studies showed that PD98059, a specific inhibitor of mitogen-activated protein (MAP) kinase/ERK kinase (MEK)1 and MEK2, the immediate upstream regulators of ERK1 and ERK2, inhibited chemotaxis in response to fMLP or IL8. However, PD98059 and another specific MEK1/MEK2 inhibitor, UO126, have recently been reported to also inhibit MEK5, the upstream regulator of ERK5 (8Kamakura S. Moriguchi T. Nishida E. J. Biol. Chem. 1999; 274: 26563-26571Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar, 9Davies S.P. Reddy H. Caivano M. Cohen P. Biochem. J. 2000; 351: 95-105Crossref PubMed Scopus (3910) Google Scholar). This therefore creates some doubt as to whether the previous conclusion is valid and whether the MEK5-ERK5 module could also be involved in regulating the chemotactic response. ERK5 or Big MAP kinase (BMK) is a recently described stress-activated MAP kinase (10Kyriakis J.M. Avruch J. Physiol. Rev. 2001; 81: 807-869Crossref PubMed Scopus (2833) Google Scholar, 11Lee J.D. Ulevitch R.J. Han J. Biochem. Biophys. Res. Commun. 1995; 213: 715-724Crossref PubMed Scopus (283) Google Scholar). This kinase is similar in many aspects to ERK1 and ERK2, but has a unique loop 12 domain within the kinase region, which is followed by an unusually long C terminus. Although murine tissues have been reported to express three forms of ERK5 protein species, generated by alternative splicing (12Yan C. Luo H. Lee J.D. Abe J. Berk B.C. J. Biol. Chem. 2001; 276: 10870-10878Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar), human tissues contain only one form of the protein, despite alternative splicing in the 5′-non-coding region (11Lee J.D. Ulevitch R.J. Han J. Biochem. Biophys. Res. Commun. 1995; 213: 715-724Crossref PubMed Scopus (283) Google Scholar). The activity of ERK5 is up-regulated through the phosphorylation of the TEY activation motif by MEK5. Alternative splicing at the 5′-end of MEK5 yields MEK5α and MEK5β and alternative splicing between the kinase subdomain IX-X region of each MEK5 species can potentially generate two further MEK5 species (13English J.M. Vanderbilt C.A. Xu S. Marcus S. Cobb M.H. J. Biol. Chem. 1995; 270: 28897-28902Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar). Kinases such as MEK kinase (MEKK)2, MEKK3, tumor progression locus (Tpl)-2/cancer osaka thyroid (Cot) and mixed lineage kinase (MLK)-like MAP triple kinase have all be been reported to serve as MAP kinase kinase kinases of the ERK5 module (8Kamakura S. Moriguchi T. Nishida E. J. Biol. Chem. 1999; 274: 26563-26571Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar, 10Kyriakis J.M. Avruch J. Physiol. Rev. 2001; 81: 807-869Crossref PubMed Scopus (2833) Google Scholar, 14Gotoh I. Adachi M. Nishida E. J. Biol. Chem. 2001; 276: 4276-4286Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Recent studies have identified the kinase WNK (with no lysine) 1 to be an upstream regulator of the MEK5-ERK5 module, acting via MEKK2 and MEKK3 (15Xu B.E. Stippec S. Lenertz L. Lee B.H. Zhang W. Lee Y.K. Cobb M.H. J. Biol. Chem. 2004; 279: 7826-7831Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). ERK5 is activated by stresses such as H2O2 and shear stress (8Kamakura S. Moriguchi T. Nishida E. J. Biol. Chem. 1999; 274: 26563-26571Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar, 10Kyriakis J.M. Avruch J. Physiol. Rev. 2001; 81: 807-869Crossref PubMed Scopus (2833) Google Scholar, 16Abe J. Kusuhara M. Ulevitch R.J. Berk B.C. Lee J.D. J. Biol. Chem. 1996; 271: 16586-16590Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar). However, unlike the p38 and JNK stress MAP kinases, ERK5 is not activated by UV irradiation or anisomycin (8Kamakura S. Moriguchi T. Nishida E. J. Biol. Chem. 1999; 274: 26563-26571Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar). Depending on the cell type, the activity of ERK5 can be stimulated by agents such as serum, epidermal growth factor, 1,25 dihydroxyvitamin D3 and phorbol 12-myristate 13-acetate (8Kamakura S. Moriguchi T. Nishida E. J. Biol. Chem. 1999; 274: 26563-26571Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar, 17Dwivedi P.P. Hii C.S. Ferrante A. Tan J. Der C.J. Omdahl J.L. Morris H.A. May B.K. J. Biol. Chem. 2002; 277: 29643-29653Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Substrates that have been identified for ERK5 include transcription factors such as Ets-1, MEF2C, and Sap1a (8Kamakura S. Moriguchi T. Nishida E. J. Biol. Chem. 1999; 274: 26563-26571Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar, 17Dwivedi P.P. Hii C.S. Ferrante A. Tan J. Der C.J. Omdahl J.L. Morris H.A. May B.K. J. Biol. Chem. 2002; 277: 29643-29653Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 18Sohn S.J. Sarvis B.K. Cado D. Winoto A. J. Biol. Chem. 2002; 277: 43344-43351Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). Recent studies have demonstrated that deletion of ERK5 results in angiogenic failure and death of the embryo (18Sohn S.J. Sarvis B.K. Cado D. Winoto A. J. Biol. Chem. 2002; 277: 43344-43351Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). Both MEK5 and ERK5 have sequences that suggest that these kinases may interact with cytoskeletal elements such as actin (13English J.M. Vanderbilt C.A. Xu S. Marcus S. Cobb M.H. J. Biol. Chem. 1995; 270: 28897-28902Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar, 19Zhou G. Bao Z.Q. Dixon J.E. J. Biol. Chem. 1995; 270: 12665-12669Abstract Full Text Full Text PDF PubMed Scopus (532) Google Scholar). The presence of MEK5 and ERK5 in neutrophils has not been described, and their roles in neutrophils remain unknown. The aims of this study were to characterize the expression and activation of MEK5 and ERK5 in human neutrophils, and to investigate whether this kinase module could regulate neutrophil migration. We have found for the first time, that human neutrophils express MEK5 and ERK5 and the activity of the MEK-ERK5 module was stimulated by fMLP. Activation of the MEK-ERK5 module was blocked by wortmannin, an inhibitor of phosphatidylinositol 3-kinase. Investigations with the recently described specific MEK inhibitor, PD184352, at concentrations that inhibited ERK1/ERK2 but not ERK5 activity, provided further evidence that ERK1 and ERK2 are involved in regulating the chemotactic response. Materials—Myelin basic protein, protein A-Sepharose, lucigenin, and fMLP were purchased from Sigma-Aldrich Pty. Ltd. (Sydney, Australia). The anti-ERK5 (L-19) and anti ERK2 (C-14) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). We also obtained an anti-ERK5 antibody from Sigma-Aldrich and this was used in the majority of our experiments. The anti-MEK5 antibody was purchased from Stressgen Biotechnologies (Victoria, Canada). [γ-32P]ATP (4000 Ci/mmol) was obtained from Geneworks (Adelaide, Australia). Mr markers were from MBI Fermentas (Hanover, MD) and Bio-Rad. pUC19/HpaII and SppI/EcoRI DNA markers were from Geneworks (Adelaide, Australia). PD98059 was purchased from New England Biolabs, Inc., (Beverly, MA), and PD184352 was obtained from Prof. P. Cohen, University of Dundee, Scotland, UK. Millicell-PCF 3-μm culture inserts were obtained from Millipore Australia (Sydney, Australia). Renaissance Chemiluminescence Reagent Plus was obtained from PerkinElmer Life Science Products (Boston, MA). Reinforced nitrocellulose was purchased from Schleicher and Schuell (Dassel, Germany). The Western blot recycling kit was obtained from Alpha Diagnostic International (San Antonio, Texas). TRIzol® Reagent was purchased from Invitrogen Life Technologies (Mt Waverly, Australia). AMV reverse transcriptase and Expand High Fidelity polymerase were from Roche Diagnostics Australia (Castle Hill, Australia). Q Buffer was from Qiagen Pty. Ltd. (Clifton Hill, Australia). Isolation of Neutrophils and Monocytes—Human neutrophils were isolated from the peripheral blood of healthy volunteers by the rapid single-step method (20Ferrante A. Thong Y.H. J. Immunol. Methods. 1982; 48: 81-85Crossref PubMed Scopus (117) Google Scholar). The neutrophil preparation was >98% pure and viable, and were left for 30 min at 37 °C before they were stimulated. Monocytes were prepared from the mononuclear cell fraction by adherence to plasma-coated dishes (21Huang Z.H. Hii C.S. Rathjen D.A. Poulos A. Murray A.W. Ferrante A. Biochem. J. 1997; 325: 553-557Crossref PubMed Scopus (48) Google Scholar). HL60 Promeylocytic and HEK293T Cells—HL60 and human embryonic kidney (HEK293T) cells were maintained in RPMI 1640 supplemented with antibiotics and fetal bovine serum (10%) (22Hii C.S. Huang Z.H. Bilney A. Costabile M. Murray A.W. Rathjen D.A. Der C.J. Ferrante A. J. Biol. Chem. 1998; 273: 19277-19282Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). HL60 cells were grown at less than 1 × 106 cells/ml. HEK293T cells were plated in 10-cm dishes and used when confluent. Chemotaxis—Neutrophil chemotaxis was investigated by a chamber method and/or the under-agarose method as described previously (4Hii C.S. Stacey K. Moghaddami N. Murray A.W. Ferrante A. Infect. Immun. 1999; 67: 1297-1302Crossref PubMed Google Scholar). To determine the dose response relationship between chemotaxis and fMLP, we used the chamber method because the specific concentrations of a ligand cannot be determined in the under-agarose method because of diffusion of the ligand. For the chamber assay, neutrophils (106 in 500 μl RPMI 1640 that had been supplemented with bovine serum albumin, 2%, w/v) were placed in filter chambers (Millicell culture plate inserts with 3-μm pore size polycarbonate filters). The chambers were then placed into wells (24-well plate) that contained RPMI 1640-bovine serum albumin (0.5 ml) and either fMLP or Me2SO. After 45 min at 37 °C in a humidified atmosphere of 5% CO2 in air, the inserts were removed and neutrophils that had migrated across the filter and collected on the surface of the wells were harvested by gentle pipetting and counted. Previous studies on the kinetics of neutrophil migration in this system have demonstrated that the majority of neutrophils had migrated across the filter within this period (4Hii C.S. Stacey K. Moghaddami N. Murray A.W. Ferrante A. Infect. Immun. 1999; 67: 1297-1302Crossref PubMed Google Scholar). For the under-agarose method, 6 ml of agarose (1% v/v) was allowed to set in culture dishes (60-mm diameter) and wells (sets of 3) were made. To assess the chemotactic response, fMLP (5 × 10–8m), neutrophils (2 × 105), and Me2SO (0.1% v/v), all in 5-μl aliquots, were added to the outer, center and inner wells, respectively, and the dishes were placed in a humidified atmosphere of 5% CO2 in air at 37 °C for 90 min. In this assay, neutrophils continuously migrate out of the wells in every direction, albeit with the majority of the migrating cells exhibiting directional migration toward the chemoattractant-containing well (23Nelson R.D. Quie P.G. Simmons R.L. J. Immunol. 1975; 115: 1650-1656PubMed Google Scholar). The leading neutrophils form a distinct migrating front. To quantify migration, we measured the distance between the edge of the central well and the migrating front moving toward either the fMLP (chemotaxis) or Me2SO (random migration) containing well using an inverted Leitz microscope fitted with a grid eyepiece graticule. The plates were sealed and stored at 4 °C until photomicrographed. To assess the effect of PD184352, neutrophils (106) were preincubated with the inhibitor or ME2SO for 1 h before being used in the above chemotaxis assays. The cells with the inhibitor or vehicle were placed in the chambers or wells as described above. Cell viability at the end of the pre-incubation period, as judged by the trypan blue exclusion test, was not affected by the inhibitor, with >99% of the cells being able to exclude the dye. Preparation of Cell Lysates—The cells were lysed in buffer A (20 mm Hepes, pH 7.4, 0.5% Nonidet P-40 (v/v), 100 mm NaCl, 1 mm EDTA, 2 mm Na3VO4, 2 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride, and 10 μg/ml each of leupeptin, aprotinin, pepstatin A, and benzamidine) for 2 h (4 °C) with constant mixing (24Hii C.S. Moghadammi N. Dunbar A. Ferrante A. J. Biol. Chem. 2001; 276: 27246-27255Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Cell debris was sedimented (12,000 × g 30 s), and the protein content of the soluble fractions was determined by the Lowry's protein estimation method. Samples were stored at –20 °C for up to 2 weeks with no apparent loss of kinase activity being detected within this period. RNA Isolation and RT-PCR—Total RNA was isolated from normal human monocytes and neutrophils using TRIzol® reagent as per the manufacturer's instructions. cDNA was synthesized from total RNA with AMV reverse transcriptase using an oligo d(T) primer. PCR primers, analogous to those used by Yan et al. (12Yan C. Luo H. Lee J.D. Abe J. Berk B.C. J. Biol. Chem. 2001; 276: 10870-10878Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar) to amplify murine ERK5, were designed to the human ERK5 sequence. These were: sense primer ACGAGTACGAGATCATCGAGACC, and antisense primer GGTCACCACATCGAAAGCATTAGG. These are designed to amplify a 125-bp fragment (nucleotides 238–362) from the human ERK5 mRNA sequence (GenBank™ accession number HSU25278). The 5′ primer is located 52 bp 5′ of an exon-intron junction (GenBank™ accession number AC124066, base 17697), and the 3′-primer is located 25 bp 3′ of the same intron (intron-exon junction at bp 17009 of GenBank accession number AC124066). These primers therefore also define a PCR product of 774 bp (GenBank™ accession number AC124066, base 17723–16950) that can be amplified from human genomic DNA. This intron corresponds to the murine sequence reported as being alternatively spliced by Yan et al. (12Yan C. Luo H. Lee J.D. Abe J. Berk B.C. J. Biol. Chem. 2001; 276: 10870-10878Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). PCR amplification was performed in 50-μl reactions using 2 μl of cDNA as template, 100 μm of each dNTP, 1 μg of each primer, and 3.5 units of Expand High Fidelity polymerase in a final 1× concentration of the recommended buffer plus 1× Q Buffer (Qiagen Pty. Ltd., Clifton Hill, Australia). Thirty cycles of amplification was performed with each cycle consisting of a denaturation of 94 °C for 30 s, annealing at 60 °C for 30 s and an extension of 68 °C for 30 s. PCR products were resolved on a 2.5% agarose gel with pUC19/HpaII and SppI/EcoRI DNA markers (500 ng). Western Blot—Proteins in the lysates were separated by 8 or 12% SDS-PAGE as appropriate and transferred to nitrocellulose membrane. Even transfer of proteins between the lanes was confirmed by staining with Ponceau S. Membranes were probed with anti-ERK2, ERK5, MEK5, or p38 antibody using standard procedures, and the immune complexes were detected by enhanced chemiluminescence (25Hii C.S. Ferrante A. Edwards Y.S. Huang Z.H. Hartfield P.J. Rathjen D.A. Poulos A. Murray A.W. J. Biol. Chem. 1995; 270: 4201-4204Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). In some cases, the blots were stripped using a Western blot recycling kit and reprobed with another antibody. Immunoprecipitation of ERK1, ERK2, ERK5, MEK5, and p38—Lysates, normalized for protein content (1 mg), were precleared by incubation with protein A-Sepharose (15 μl of a 1:1 slurry) for 20 min at 4 °C with constant mixing. The supernatants were removed and incubated with an anti-ERK5, ERK2, MEK5, or p38 antibody (3 μg each) for 2 h at 4 °C with constant mixing. Protein A-Sepharose was added and after a further 30 min incubation at 4 °C with constant mixing, the immunocomplexes were sedimented and were washed once with buffer A and once with assay buffer (20 mm Hepes, pH 7.2, 20 mm β-glycerophosphate, 3.8 mmp-nitrophenyl phosphate, 10 mm MgCl2, 1 mm dithiothreitol, 50 μm Na3VO4, and 20 μm ATP) at 4 °C. The samples were then used in kinase activity assays, kinase quantitation, or Western blot analysis. Kinase Activity Assay—The assay was started by adding 30 μl of assay buffer (30 °C) containing 10 μCi of [γ-32P]ATP, 3.8 mmp-nitrophenyl phosphate, and 15 μg of myelin basic protein. After 20 min, the assay was terminated by the addition of Laemmli buffer and boiling the samples for 5 min at 100 °C. Phosphorylated myelin basic protein was resolved by 16% SDS-polyacrylamide gel electrophoresis and was detected and quantitated using an Instant Imager (Packard Instruments). Statistical Analysis—Statistical analyses were performed using Student's unpaired t test or analysis of variance (ANOVA) followed by the Tukey-Kramer multiple comparisons test as appropriate. H2O2 Stimulated the Activity of ERK5—Since H2O2 has widely been reported to stimulate the activity of ERK5 (8Kamakura S. Moriguchi T. Nishida E. J. Biol. Chem. 1999; 274: 26563-26571Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar, 16Abe J. Kusuhara M. Ulevitch R.J. Berk B.C. Lee J.D. J. Biol. Chem. 1996; 271: 16586-16590Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, 17Dwivedi P.P. Hii C.S. Ferrante A. Tan J. Der C.J. Omdahl J.L. Morris H.A. May B.K. J. Biol. Chem. 2002; 277: 29643-29653Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar), we first investigated whether H2O2 was able to stimulate the ERK5 module in neutrophils. Neutrophils were incubated with H2O2, lysed, and lysates were subjected to immunoprecipitation with an anti-ERK5 antibody that was raised against residues 790–803 in the C terminus of human ERK5 (Sigma-Aldrich Corp.) and had previously been used for this purpose (15Xu B.E. Stippec S. Lenertz L. Lee B.H. Zhang W. Lee Y.K. Cobb M.H. J. Biol. Chem. 2004; 279: 7826-7831Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 26Pearson G.W. Cobb M.H. J. Biol. Chem. 2002; 277: 48094-48098Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar, 27Sun W. Wei X. Kesavan K. Garrington T.P. Fan R. Mei J. Anderson S.M. Gelfand E.W. Johnson G.L. Mol. Cell. Biol. 2003; 23: 2298-2308Crossref PubMed Scopus (76) Google Scholar). ERK5 kinase activity was assayed using myelin basic protein as a substrate. Consistent with the data in other cell-types, H2O2 stimulated the kinase activity in the ERK5 immunoprecipitates (Fig. 1). In contrast, H2O2 did not stimulate the dual phosphorylation of ERK1/ERK2, suggesting that the kinase activity in the ERK5 immunoprecipitates was un-likely to have been caused by contaminating ERK1 or ERK2. Expression of ERK5 and MEK5 in Neutrophils—Previously, we reported that ERK5 in COS-1 monkey kidney cells migrated in SDS gels with an Mr of greater than the top Mr marker of 113,000 (17Dwivedi P.P. Hii C.S. Ferrante A. Tan J. Der C.J. Omdahl J.L. Morris H.A. May B.K. J. Biol. Chem. 2002; 277: 29643-29653Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). This is consistent with other reports that ERK5 migrates at 100 or higher (16Abe J. Kusuhara M. Ulevitch R.J. Berk B.C. Lee J.D. J. Biol. Chem. 1996; 271: 16586-16590Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, 28Nicol R.L. Frey N. Pearson G. Cobb M. Richardson J. Olson E.N. EMBO J. 2001; 20: 2757-2767Crossref PubMed Scopus (237) Google Scholar, 29Nakamura K. Johnson G.L. J. Biol. Chem. 2003; 278: 36989-36992Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). To characterize the expression of ERK5 in neutrophils, we first subjected neutrophil lysates to Western blotting. The anti-ERK5 antibody detected a number of bands that migrated in SDS gels with Mr of ∼97,000, ∼ 90,000 ∼82,000 and ∼45,000. On prolonged exposure of the film, a faint ∼120-kDa band could also be seen in the neutrophils (Fig. 2a and also Fig. 3b). In contrast, when the lysates were immunoprecipitated with the anti-ERK5 antibody prior to Western blotting, the blots showed predominantly 2 bands of Mr of ∼97,000 and ∼120,000 (Fig. 2b). No bands could be seen if the immunoprecipitation was carried out with an anti-β-actin (Fig. 2c) or ERK2 (Fig. 2d) antibody. This implies that the ∼97- and ∼120-kDa bands were specifically brought down by the anti-ERK5 antibody.Fig. 3PCR analysis of ERK5 mRNA expression in human neutrophils and monocytes and a comparison of ERK5 protein expression between the two cell-types. RT-PCR analysis of total RNA from monocytes and neutrophils (a) was performed as described under “Experimental Procedures.” The arrows to the left of the figure indicate the hERK5 PCR products amplified from genomic DNA (774 bp) and cDNA (125 bp). Lane 1, SppI/EcoRI size markers; lane 2, monocyte cDNA template; lane 3, neutrophil cDNA template; lane 4, monocyte RNA template; lane 5, neutrophil RNA template; lane 6, no template control; lane 7, human genomic DNA template; lane 8, pUC/HpaII size markers. b, lysates from neutrophils (100 μg of protein) (lane 1) and mononuclear leukocytes (lane 2, 100 μg of protein; lane 3,2 μgof protein) were Western-blotted with the anti-ERK5 antibody. The blot was overexposed to show the faint ∼120-kDa ERK5 band in the neutrophil lysate. Right panel shows lane 2 from a shorter exposure. The results are representative of two separate experiments.View Large Image Figure ViewerDownload (PPT) When lysates from human peripheral blood monocytes, human embryonic kidney HEK293T cells, and HL60 cells (not shown) were subjected to Western blotting with the anti-ERK5 antibody, the blots showed the presence of predominantly the ∼120-kDa band (Fig. 2e), although some monocyte samples also contained faster migrating bands (see Fig. 3b). These data imply that the ∼120-kDa band is ERK5. The presence of faster migrating anti-ERK5 immunoreactive bands in cell lysates is not unprecedented as others have previously reported that ERK5 blots sometimes contained multiple immunoreactive bands that had been ascribed to ERK5 degradation products (30English J.M. Pearson G. Bae R. Cobb M.H. J. Biol. Chem. 1998; 273: 3854-3860Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). For comparison, lysates from HEK293T cells were also probed with an anti-ERK5 antibody from Santa Cruz Biotechnology. According to the manufacturer's specification sheet, this antibody detects a ∼120-kDa ERK5 band. Akin to the antibody from Sigma-Aldrich, the Santa Cruz antibody also detected a ∼120-kDa band in HEK293T cells (Fig. 2e, right lane). Taken together, our data imply that the ∼120-kDa band is ERK5. The faster migrating species are likely to be degradation products (30English J.M. Pearson G. Bae R. Cobb M.H. J. Biol. Chem. 1998; 273: 3854-3860Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). The expression of ERK5 in neutrophils was also investigated at the mRNA level. Human placenta has previously been reported to contain three ERK5 transcripts (11Lee J.D. Ulevitch R.J. Han J. Biochem. Biophys. Res. Commun. 1995; 213: 715-724Crossref PubMed Scopus (283) Google Scholar). However, since these are generated by alternative splicing in the 5′-non-coding region, only one form of ERK5 is expressed at the protein level (11Lee J.D. Ulevitch R.J. Han J. Biochem. Biophys. Res. Commun. 1995; 213: 715-724Crossref PubMed Scopus (283) Google Scholar). In contrast, murine tissues have been reported to contain three isoforms of ERK5 protein, designated mERK5a, mERK5b and mERK5c, which are derived from differential splicing of the N terminus of mERK5 (12Yan C. Luo H. Lee J.D. Abe J. Berk B.C. J. Biol. Chem. 2001; 276: 10870-10878Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). The data in Fig. 3a demonstrate the presence of only one species of ERK5 mRNA in both peripheral blood monocytes and neutrophils (lanes 2 and 3, lower arrow). The presence of a PCR product corresponding to genomic DNA in the neutrophil cDNA sample (lane 3, upper arrow) demonstrates that the PCR would be capable of detecting larger, alternatively spliced, mRNA species analogous to those found in mice, if they were present. In the absence of reverse transcriptase RNA templates (lanes 4 and 5), only the product corresponding to genomic DNA was seen (lane 7) i" @default.
• W2011974549 created "2016-06-24" @default.
• W2011974549 creator A5001353704 @default.
• W2011974549 creator A5025052420 @default.
• W2011974549 creator A5033636243 @default.
• W2011974549 creator A5051169622 @default.
• W2011974549 creator A5085173358 @default.
• W2011974549 creator A5088505289 @default.
• W2011974549 date "2004-11-01" @default.
• W2011974549 modified "2023-10-01" @default.
• W2011974549 title "Characterization of the MEK5-ERK5 Module in Human Neutrophils and Its Relationship to ERK1/ERK2 in the Chemotactic Response" @default.
• W2011974549 cites W114874095 @default.
• W2011974549 cites W1529396499 @default.
• W2011974549 cites W1561782952 @default.
• W2011974549 cites W1819732475 @default.
• W2011974549 cites W1912343035 @default.
• W2011974549 cites W1973386789 @default.
• W2011974549 cites W1973854089 @default.
• W2011974549 cites W1984267035 @default.
• W2011974549 cites W1991738330 @default.
• W2011974549 cites W1991972495 @default.
• W2011974549 cites W1995806196 @default.
• W2011974549 cites W1997918326 @default.
• W2011974549 cites W2001587733 @default.
• W2011974549 cites W2003732689 @default.
• W2011974549 cites W2005732248 @default.
• W2011974549 cites W2009718333 @default.
• W2011974549 cites W201632791 @default.
• W2011974549 cites W2017821413 @default.
• W2011974549 cites W2029030025 @default.
• W2011974549 cites W2030284600 @default.
• W2011974549 cites W2037792829 @default.
• W2011974549 cites W2053305914 @default.
• W2011974549 cites W2059763373 @default.
• W2011974549 cites W2063413463 @default.
• W2011974549 cites W2065308949 @default.
• W2011974549 cites W2072061824 @default.
• W2011974549 cites W2075261741 @default.
• W2011974549 cites W2078192624 @default.
• W2011974549 cites W2079104684 @default.
• W2011974549 cites W2079753883 @default.
• W2011974549 cites W2080145523 @default.
• W2011974549 cites W2080231926 @default.
• W2011974549 cites W2081672859 @default.
• W2011974549 cites W2090756832 @default.
• W2011974549 cites W2093796596 @default.
• W2011974549 cites W2102745676 @default.
• W2011974549 cites W2122057254 @default.
• W2011974549 cites W2123885531 @default.
• W2011974549 cites W2125771292 @default.
• W2011974549 cites W2127659913 @default.
• W2011974549 cites W2134468110 @default.
• W2011974549 cites W2140016136 @default.
• W2011974549 cites W2145357604 @default.
• W2011974549 cites W2162885959 @default.
• W2011974549 cites W2164053051 @default.
• W2011974549 cites W2406082163 @default.
• W2011974549 cites W2413605634 @default.
• W2011974549 cites W4247904703 @default.
• W2011974549 cites W4313308248 @default.
• W2011974549 doi "https://doi.org/10.1074/jbc.m406892200" @default.
• W2011974549 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15381709" @default.
• W2011974549 hasPublicationYear "2004" @default.
• W2011974549 type Work @default.
• W2011974549 sameAs 2011974549 @default.
• W2011974549 citedByCount "33" @default.
• W2011974549 countsByYear W20119745492012 @default.
• W2011974549 countsByYear W20119745492014 @default.
• W2011974549 countsByYear W20119745492015 @default.
• W2011974549 countsByYear W20119745492016 @default.
• W2011974549 countsByYear W20119745492017 @default.
• W2011974549 countsByYear W20119745492019 @default.
• W2011974549 countsByYear W20119745492021 @default.
• W2011974549 countsByYear W20119745492022 @default.
• W2011974549 crossrefType "journal-article" @default.
• W2011974549 hasAuthorship W2011974549A5001353704 @default.
• W2011974549 hasAuthorship W2011974549A5025052420 @default.
• W2011974549 hasAuthorship W2011974549A5033636243 @default.
• W2011974549 hasAuthorship W2011974549A5051169622 @default.
• W2011974549 hasAuthorship W2011974549A5085173358 @default.
• W2011974549 hasAuthorship W2011974549A5088505289 @default.
• W2011974549 hasBestOaLocation W20119745491 @default.
• W2011974549 hasConcept C170493617 @default.
• W2011974549 hasConcept C171250308 @default.
• W2011974549 hasConcept C185592680 @default.
• W2011974549 hasConcept C192562407 @default.
• W2011974549 hasConcept C2780841128 @default.
• W2011974549 hasConcept C54166955 @default.
• W2011974549 hasConcept C55493867 @default.
• W2011974549 hasConcept C86803240 @default.
• W2011974549 hasConcept C95444343 @default.
• W2011974549 hasConceptScore W2011974549C170493617 @default.
• W2011974549 hasConceptScore W2011974549C171250308 @default.
• W2011974549 hasConceptScore W2011974549C185592680 @default.
• W2011974549 hasConceptScore W2011974549C192562407 @default.
• W2011974549 hasConceptScore W2011974549C2780841128 @default.
• W2011974549 hasConceptScore W2011974549C54166955 @default.
• W2011974549 hasConceptScore W2011974549C55493867 @default.

• next