FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012103133> ?p ?o ?g. }

• W2012103133 endingPage "907" @default.
• W2012103133 startingPage "905" @default.
• W2012103133 abstract "Esophageal cancer is one of the most aggressive upper aerodigestive tract malignancies and major cause of cancer-related mortality worldwide, exhibiting marked variation in geographical incidence.1 Despite intensive multimodality therapy, including surgery, radiotherapy and chemotherapy, prognosis of this disease remains dismal, with a 5-year survival rate of 5–10%.2 The development of novel diagnostic or therapeutic strategies requires an in-depth understanding of the molecular mechanisms involved in the complex multistep process of esophageal tumorigenesis.3 In search of novel molecular targets for esophageal cancer using differential display as described previously,4 we report for the first time to our knowledge that β-mannosidase is overexpressed in esophageal squamous cell carcinoma (ESCC). In differential display using primer combination HAP-54: 5′ AAG CTT TTG AGG T 3′ and HT11C: 5′ AAG CTT TTT TTT TTT C 3′ (Gen Hunter Corp., Brookline, MA), a 210 bp cDNA was observed to be overexpressed in ESCC as compared to matched nonmalignant esophageal tissue (Fig. 1a). This cDNA was reamplified using corresponding primer combinations and subcloned into pGEM-T Easy vector. Computer search of this clone against Gen Bank Database revealed 98% homology to human lysosomal β-mannosidase. The differential expression of the cDNA fragment was confirmed by reverse northern analysis as described earlier,4 which also showed overexpression of β-mannosidase in ESCCs and its absence in nonmalignant esophageal tissues (Fig. 1b). (a) mRNA differential display of paired distant esophageal normal mucosa and esophageal squamous cell carcinoma (N, normal; T, tumor) using HAP-54 and HT11C run in duplicates where normal and tumor samples are loaded in adjacent lanes. The primers used to generate these bands are described in the text. Arrowhead represents the band of interest, sequencing of this cDNA fragment revealed a 210 bp sequence showing homology to the 3′ end of the human β-mannosidase mRNA. Panel II shows β-actin used as an internal control to demonstrate equal amount of RNAs used for DD-RTPCR from ESCC and paired distant esophageal normal tissue. (b) Confirmation of differentially expressed cDNA by reverse Northern blot analysis. After denaturation of plasmid containing the cloned cDNA fragment, it was blotted onto nylon membrane. Membranes were hybridized with 32P-labeled cDNA probes made from the RNAs of either tumor (lane 1) or normal (lane 2) esophageal tissue by reverse transcription. Star indicates β-actin as a control to equalize differences in efficiency of reverse transcription. Expression of β-mannosidase is observed in esophageal tumor (T) and absent in nonmalignant esophageal tissue (N). To reconfirm the differential expression of β-mannosidase, Northern blot analysis was performed in, 1 surgically resected ESCC tissue and matched nonmalignant esophageal tissue, 3 endoscopic biopsies (histologically confirmed to be ESCCs), 1 esophageal cancer cell line (TE13) and 1 oral cancer cell line (HSC-2), as described earlier.4 The results revealed expression of β-mannosidase in 2/4 ESCC tissues and esophageal cancer cell line (TE13). Nonmalignant esophageal tissue and oral cancer cell line did not show expression of β-mannosidase, (Fig. 2). Northern blot analysis of β-mannosidase in surgically resected ESCC tissue (C1) and matched nonmalignant esophageal tissue (N1), 3 endoscopic biopsies, (B1, B2 and B3), esophageal cancer cell line (TE13) and oral cancer cell line (HSC-2). Total RNA (20 μg) from each tissue sample was subjected to electrophoresis on 1.5% agarose formaldehyde denaturing gels. Following electrophoresis, the gel was transferred to nylon membrane by capillary action using 20× SSC to facilitate transfer. RNA was cross-linked to nylon membrane using UV cross-linker. Membrane was hybridized with 32P labeled probe prepared by PCR amplification of 210 bp differentially expressed cDNA fragment (showing homology to β-mannosidase). The membrane was hybridized with the probe overnight and exposed to X-OMAT film for 3–7 days before development. β-mannosidase is an exoglycosidase involved in the degradation of N-linked oligosaccharide moieties of glycoproteins. Changes in glycosylation are known to occur early in tumor progression.5. Glycosyltransferases and glycosidases, enzymes of golgi oligosaccharide processing pathways, play a significant role in cancer development and progression.6 Expression of alpha-mannosidases has been shown to be involved in tumor growth and metastasis in nasopharyngeal carcinoma.7, 8 Expression of N-acetylglucosamine transferase (Glc NAc) in epithelial cells promotes loss of contact inhibition and metastasis.9 To confirm the overexpression of β-mannosidase in ESCCs and to determine stage of esophageal cancer development at which upregulation of this enzyme occurs, its expression was analyzed in clinical specimens of ESCCs, dysplastic lesions and nonmalignant esophageal tissues by Reverse-Transcription Polymerase Chain Reaction (RT-PCR). To our knowledge, this is the first study showing overexpression of β-mannosidase in ESCCs. Twenty-five ESCCs, 5 dysplasias and 8 distant nonmalignant esophageal tissues were collected from patients undergoing curative surgery, after obtaining approval of the institutional human ethics committee and prior informed consent of the patients, at The Department of GastroIntestinal Surgery, All India Institute of Medical Sciences, New Delhi, India. Histologic examination of the tumors revealed 3 well-differentiated, 21 moderately differentiated and 1 poorly differentiated esophageal squamous cell carcinoma. For RT-PCR analysis of β-mannosidase in ESCCs, dysplastic and nonmalignant esophageal tissues and TE13, an esophageal cancer cell line, total RNA was prepared from frozen tissues with Trizol Reagent (GIBCO, BRL, Gaithersburg, MD) according to manufacturer's protocol or the standard protocol of Chomczynsci.10 The commercially synthesized primers were sense 5′ TCGTACTGGCAGGAGACAAG 3′ and antisense 5′ TGCTGATCCACTATCTCG 3′ (Microsynth, Balgach, Switzerland). For establishment of nonsaturating RT-PCR conditions, an experiment with β-mannosidase was carried using RNA samples from 2 ESCCs and 2 distant nonmalignant esophageal tissues. Amplification was performed for 14, 28 and 35 cycles. PCR conditions consisted of initial denaturation at 95°C for 5 min, 14, 28 and 35 cycles of 95°C for 1 min, 54°C for 2 min, 72°C for 1 min and a final extension at 72°C for 10 min (Fig. 3). The RT-PCR analysis in tissue specimens was performed for 35 cycles (Fig. 4). The products were analyzed by electrophoresis on 1% agarose gel. For individual samples, the integrated density value of each band (sum of all the pixel intensity values in a given band area) was determined and the background was subtracted. Normalization was achieved by dividing the corrected intergrated density value of the gene in each sample by the corrected intergrated density value of beta-actin gene in the corresponding sample. This ratio was considered as arbitrary units. The expression level of β-mannosidase in each tissue is represented by a histogram shown in Figure 5. Semi-quantitative RT-PCR of β-mannosidase. (a) amplification of all samples performed in 2 ESCCs for 14 cycles (lanes 1–2), 28 (lanes 3–4) and 35 cycles(lanes 5–6). Lane 7 is DNA 100 bp marker. No amplification was observed in nonmalignant esophageal tissue (not shown). (b) Amplification of β-actin from the same RT reactions. (a) Validation of differential display data by RT-PCR. RT PCR analysis was performed in TE 13 cells (lane 1), dysplastic esophageal epithelium (lanes 2,3), ESCCs (lanes 4,5) and nonmalignant esophageal tissues (lanes 6,7). Lane 8 is DNA 100 bp marker. A 500 bp amplicon was observed in samples showing overexpression of β-mannosidase. (b) Amplification of β-actin from the same RT reactions. Histogram showing expression levels of β-mannosidase relative to β-actin mRNA in individual ESCCs (C1–C14), esophageal dysplasias (D1–D4) and representative nonmalignant esophageal tissues (N1–N4). Overexpression of β-mannosidase was observed in 14/25 (56%) ESCCs (Fig. 5, C1–C14) and 4/5 dysplastic tissues (Fig. 5, D1–D4). None of the nonmalignant esophageal tissues showed β-mannosidase expression (Fig. 5, N1–N4). Since there is heterogeneity in the origin of cells present in surgically resected ESCC tissue specimens, the expression of β-mannosidase was analyzed in homogeneous esophageal cancer cell culture as well (TE13). Overexpression of β-mannosidase in TE13 cells suggests that its expression occurs in tumor cells. In conclusion, the increased expression of β-mannosidase in dysplastic esophageal tissues and ESCCs as compared to nonmalignant esophageal epithelium suggests that it may serve as a candidate molecular target for early detection of esophageal cancer. In depth studies are warranted to determine its potential as a candidate molecular marker for esophageal cancer. Yours sincerely, Neetu Sud, Rinu Sharma, Riju Ray, TusharKant Chattopadhyay, Ranju Ralhan" @default.
• W2012103133 created "2016-06-24" @default.
• W2012103133 creator A5001997349 @default.
• W2012103133 creator A5007159324 @default.
• W2012103133 creator A5008705036 @default.
• W2012103133 creator A5050945412 @default.
• W2012103133 creator A5055233311 @default.
• W2012103133 date "2004-07-30" @default.
• W2012103133 modified "2023-10-14" @default.
• W2012103133 title "Differential expression of ?mannosidase in human esophageal cancer" @default.
• W2012103133 cites W1491212204 @default.
• W2012103133 cites W1987197335 @default.
• W2012103133 cites W2003879802 @default.
• W2012103133 cites W2017897242 @default.
• W2012103133 cites W2065081049 @default.
• W2012103133 cites W4294216491 @default.
• W2012103133 doi "https://doi.org/10.1002/ijc.20469" @default.
• W2012103133 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15386384" @default.
• W2012103133 hasPublicationYear "2004" @default.
• W2012103133 type Work @default.
• W2012103133 sameAs 2012103133 @default.
• W2012103133 citedByCount "7" @default.
• W2012103133 countsByYear W20121031332020 @default.
• W2012103133 countsByYear W20121031332021 @default.
• W2012103133 crossrefType "journal-article" @default.
• W2012103133 hasAuthorship W2012103133A5001997349 @default.
• W2012103133 hasAuthorship W2012103133A5007159324 @default.
• W2012103133 hasAuthorship W2012103133A5008705036 @default.
• W2012103133 hasAuthorship W2012103133A5050945412 @default.
• W2012103133 hasAuthorship W2012103133A5055233311 @default.
• W2012103133 hasConcept C121608353 @default.
• W2012103133 hasConcept C126322002 @default.
• W2012103133 hasConcept C127413603 @default.
• W2012103133 hasConcept C142724271 @default.
• W2012103133 hasConcept C146978453 @default.
• W2012103133 hasConcept C181199279 @default.
• W2012103133 hasConcept C199360897 @default.
• W2012103133 hasConcept C2777174400 @default.
• W2012103133 hasConcept C2779742542 @default.
• W2012103133 hasConcept C41008148 @default.
• W2012103133 hasConcept C502942594 @default.
• W2012103133 hasConcept C55493867 @default.
• W2012103133 hasConcept C71924100 @default.
• W2012103133 hasConcept C86803240 @default.
• W2012103133 hasConcept C90559484 @default.
• W2012103133 hasConcept C93226319 @default.
• W2012103133 hasConceptScore W2012103133C121608353 @default.
• W2012103133 hasConceptScore W2012103133C126322002 @default.
• W2012103133 hasConceptScore W2012103133C127413603 @default.
• W2012103133 hasConceptScore W2012103133C142724271 @default.
• W2012103133 hasConceptScore W2012103133C146978453 @default.
• W2012103133 hasConceptScore W2012103133C181199279 @default.
• W2012103133 hasConceptScore W2012103133C199360897 @default.
• W2012103133 hasConceptScore W2012103133C2777174400 @default.
• W2012103133 hasConceptScore W2012103133C2779742542 @default.
• W2012103133 hasConceptScore W2012103133C41008148 @default.
• W2012103133 hasConceptScore W2012103133C502942594 @default.
• W2012103133 hasConceptScore W2012103133C55493867 @default.
• W2012103133 hasConceptScore W2012103133C71924100 @default.
• W2012103133 hasConceptScore W2012103133C86803240 @default.
• W2012103133 hasConceptScore W2012103133C90559484 @default.
• W2012103133 hasConceptScore W2012103133C93226319 @default.
• W2012103133 hasIssue "5" @default.
• W2012103133 hasLocation W20121031331 @default.
• W2012103133 hasLocation W20121031332 @default.
• W2012103133 hasOpenAccess W2012103133 @default.
• W2012103133 hasPrimaryLocation W20121031331 @default.
• W2012103133 hasRelatedWork W1762648508 @default.
• W2012103133 hasRelatedWork W1797854425 @default.
• W2012103133 hasRelatedWork W1970414992 @default.
• W2012103133 hasRelatedWork W2029899059 @default.
• W2012103133 hasRelatedWork W2033117589 @default.
• W2012103133 hasRelatedWork W2043570633 @default.
• W2012103133 hasRelatedWork W2141490660 @default.
• W2012103133 hasRelatedWork W2201941145 @default.
• W2012103133 hasRelatedWork W2326740013 @default.
• W2012103133 hasRelatedWork W392875935 @default.
• W2012103133 hasVolume "112" @default.
• W2012103133 isParatext "false" @default.
• W2012103133 isRetracted "false" @default.
• W2012103133 magId "2012103133" @default.
• W2012103133 workType "article" @default.