FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012171938> ?p ?o ?g. }

• W2012171938 endingPage "35148" @default.
• W2012171938 startingPage "35139" @default.
• W2012171938 abstract "The instability of regulatory T (Treg) cells is involved in the pathogenesis of autoimmune diseases and also highlights safety concerns with regard to clinical Treg cell therapy. Cell-intrinsic molecular events linked to this Treg cell instability in vivo cells, which leads to safety concerns regardingare still obscure. Here we developed a novel luciferase-based reporter system and performed an unbiased screening for kinases that potentially modulate Foxp3 function. We found that the active form of COT/Tpl2 specifically inhibits the DNA binding activity of Foxp3 through a MEK-ERK-dependent pathway. Moreover, Treg cell-specific expression of activated MEK1 led to dysregulation of Treg function and instability of Foxp3 expression in vivo. Our results support the hypothesis that outside inflammatory signals act through the COT/Tpl2-MEK-ERK signaling pathway to destabilize the Treg lineage. The instability of regulatory T (Treg) cells is involved in the pathogenesis of autoimmune diseases and also highlights safety concerns with regard to clinical Treg cell therapy. Cell-intrinsic molecular events linked to this Treg cell instability in vivo cells, which leads to safety concerns regardingare still obscure. Here we developed a novel luciferase-based reporter system and performed an unbiased screening for kinases that potentially modulate Foxp3 function. We found that the active form of COT/Tpl2 specifically inhibits the DNA binding activity of Foxp3 through a MEK-ERK-dependent pathway. Moreover, Treg cell-specific expression of activated MEK1 led to dysregulation of Treg function and instability of Foxp3 expression in vivo. Our results support the hypothesis that outside inflammatory signals act through the COT/Tpl2-MEK-ERK signaling pathway to destabilize the Treg lineage. T cells confer antigen-specific immune responses and immunological memory to protect the body from pathogens and cancer cells. However, misguided or excessive T cell responses targeting self-antigens can cause autoimmune diseases, such as type I diabetes and multiple sclerosis (1.Mocci S. Lafferty K. Howard M. The role of autoantigens in autoimmune disease.Curr. Opin. Immunol. 2000; 12: 725-730Crossref PubMed Scopus (22) Google Scholar). Foxp3+ regulatory T (Treg) 2The abbreviations used are: Treg cellregulatory T cellFKHforkhead/winged helixIPEXimmune dysregulation, polyendocrinopathy, enteropathy, X-linked syndromeLucluciferasemLNmesenteric lymph node(s)pLNaxillary and inguinal lymph node(s)EAEexperimental autoimmune encephalitisTCRT cell receptor. cells play central roles in maintaining immune homeostasis and self-tolerance, which is essential for the control of pathogenic T cell responses (2.Miyara M. Sakaguchi S. Natural regulatory T cells: mechanisms of suppression.Trends Mol. Med. 2007; 13: 108-116Abstract Full Text Full Text PDF PubMed Scopus (580) Google Scholar, 3.Josefowicz S.Z. Lu L.F. Rudensky A.Y. Regulatory T cells: mechanisms of differentiation and function.Annu. Rev. Immunol. 2012; 30: 531-564Crossref PubMed Scopus (1948) Google Scholar). Recently, Treg cells have demonstrated promising potential in clinical therapy for autoimmune diseases (4.Brunstein C.G. Miller J.S. Cao Q. McKenna D.H. Hippen K.L. Curtsinger J. Defor T. Levine B.L. June C.H. Rubinstein P. McGlave P.B. Blazar B.R. Wagner J.E. Infusion of ex vivo expanded T regulatory cells in adults transplanted with umbilical cord blood: safety profile and detection kinetics.Blood. 2011; 117: 1061-1070Crossref PubMed Scopus (813) Google Scholar, 5.Q. Tang, J.A. Bluestone (2013) Regulatory T-cell therapy in transplantation: moving to the clinic. Cold Spring Harb. Perspect. Med. 10.1101/cshperspect.a015552.Google Scholar). regulatory T cell forkhead/winged helix immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome luciferase mesenteric lymph node(s) axillary and inguinal lymph node(s) experimental autoimmune encephalitis T cell receptor. Foxp3, a member of the forkhead transcription factor family, is associated with CD4+CD25+ T cells, acting as the most reliable marker for the Treg cell lineage (6.Fontenot J.D. Rasmussen J.P. Williams L.M. Dooley J.L. Farr A.G. Rudensky A.Y. Regulatory T cell lineage specification by the forkhead transcription factor foxp3.Immunity. 2005; 22: 329-341Abstract Full Text Full Text PDF PubMed Scopus (1909) Google Scholar). Moreover, Foxp3 is indispensable for the development and function of Treg cells, as exemplified by mice harboring the scurfy mutation, germ line deletion, or conditional deletion of the Foxp3 gene. They develop severe autoimmune diseases because of defects in the development and/or functions of Treg cells (7.Williams L.M. Rudensky A.Y. Maintenance of the Foxp3-dependent developmental program in mature regulatory T cells requires continued expression of Foxp3.Nat. Immunol. 2007; 8: 277-284Crossref PubMed Scopus (683) Google Scholar, 8.Fontenot J.D. Gavin M.A. Rudensky A.Y. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells.Nat. Immunol. 2003; 4: 330-336Crossref PubMed Scopus (6078) Google Scholar, 9.Brunkow M.E. Jeffery E.W. Hjerrild K.A. Paeper B. Clark L.B. Yasayko S.A. Wilkinson J.E. Galas D. Ziegler S.F. Ramsdell F. Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse.Nat. Genet. 2001; 27: 68-73Crossref PubMed Scopus (2019) Google Scholar, 10.Wildin R.S. Freitas A. IPEX and FOXP3: clinical and research perspectives.J. Autoimmun. 2005; 25: 56-62Crossref PubMed Scopus (125) Google Scholar). Notably, scurfy mice can be rescued by Foxp3 transgene expression (6.Fontenot J.D. Rasmussen J.P. Williams L.M. Dooley J.L. Farr A.G. Rudensky A.Y. Regulatory T cell lineage specification by the forkhead transcription factor foxp3.Immunity. 2005; 22: 329-341Abstract Full Text Full Text PDF PubMed Scopus (1909) Google Scholar), and ectopic expression of Foxp3 confers partial surface phenotypes and suppressive function of Treg cells to non-Treg cells in vitro (11.Hori S. Nomura T. Sakaguchi S. Control of regulatory T cell development by the transcription factor Foxp3.Science. 2003; 299: 1057-1061Crossref PubMed Scopus (51) Google Scholar), indicating that Foxp3 directly programs the development and function of Treg cells. It has been demonstrated that a fraction of Foxp3+ Treg cells can lose Foxp3 expression in vivo, especially in lymphopenic and inflammatory settings (12.Tsuji M. Komatsu N. Kawamoto S. Suzuki K. Kanagawa O. Honjo T. Hori S. Fagarasan S. Preferential generation of follicular B helper T cells from Foxp3+ T cells in gut Peyer's patches.Science. 2009; 323: 1488-1492Crossref PubMed Scopus (481) Google Scholar, 13.Zhou X. Bailey-Bucktrout S.L. Jeker L.T. Penaranda C. Martínez-Llordella M. Ashby M. Nakayama M. Rosenthal W. Bluestone J.A. Instability of the transcription factor Foxp3 leads to the generation of pathogenic memory T cells in vivo.Nat. Immunol. 2009; 10: 1000-1007Crossref PubMed Scopus (964) Google Scholar, 14.Komatsu N. Mariotti-Ferrandiz M.E. Wang Y. Malissen B. Waldmann H. Hori S. Heterogeneity of natural Foxp3+ T cells: a committed regulatory T-cell lineage and an uncommitted minor population retaining plasticity.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 1903-1908Crossref PubMed Scopus (428) Google Scholar, 15.Bailey-Bucktrout S.L. Martinez-Llordella M. Zhou X. Anthony B. Rosenthal W. Luche H. Fehling H.J. Bluestone J.A. Self-antigen-driven activation induces instability of regulatory T cells during an inflammatory autoimmune response.Immunity. 2013; 39: 949-962Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 16.Komatsu N. Okamoto K. Sawa S. Nakashima T. Oh-hora M. Kodama T. Tanaka S. Bluestone J.A. Takayanagi H. Pathogenic conversion of Foxp3+ T cells into TH17 cells in autoimmune arthritis.Nat. Med. 2014; 20: 62-68Crossref PubMed Scopus (722) Google Scholar). These unstable Treg cells usually acquire effector Th cell-like phenotypes and turn into pathogenic cells, which leads to safety concerns regarding human Treg cell therapy (13.Zhou X. Bailey-Bucktrout S.L. Jeker L.T. Penaranda C. Martínez-Llordella M. Ashby M. Nakayama M. Rosenthal W. Bluestone J.A. Instability of the transcription factor Foxp3 leads to the generation of pathogenic memory T cells in vivo.Nat. Immunol. 2009; 10: 1000-1007Crossref PubMed Scopus (964) Google Scholar, 15.Bailey-Bucktrout S.L. Martinez-Llordella M. Zhou X. Anthony B. Rosenthal W. Luche H. Fehling H.J. Bluestone J.A. Self-antigen-driven activation induces instability of regulatory T cells during an inflammatory autoimmune response.Immunity. 2013; 39: 949-962Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 16.Komatsu N. Okamoto K. Sawa S. Nakashima T. Oh-hora M. Kodama T. Tanaka S. Bluestone J.A. Takayanagi H. Pathogenic conversion of Foxp3+ T cells into TH17 cells in autoimmune arthritis.Nat. Med. 2014; 20: 62-68Crossref PubMed Scopus (722) Google Scholar). Considerable evidence supports the hypothesis that Treg cell instability is associated with both external signals and cell-intrinsic events, including proinflammatory cytokines (17.Yang X.O. Nurieva R. Martinez G.J. Kang H.S. Chung Y. Pappu B.P. Shah B. Chang S.H. Schluns K.S. Watowich S.S. Feng X.H. Jetten A.M. Dong C. Molecular antagonism and plasticity of regulatory and inflammatory T cell programs.Immunity. 2008; 29: 44-56Abstract Full Text Full Text PDF PubMed Scopus (910) Google Scholar), strong engagement with autoantigens (13.Zhou X. Bailey-Bucktrout S.L. Jeker L.T. Penaranda C. Martínez-Llordella M. Ashby M. Nakayama M. Rosenthal W. Bluestone J.A. Instability of the transcription factor Foxp3 leads to the generation of pathogenic memory T cells in vivo.Nat. Immunol. 2009; 10: 1000-1007Crossref PubMed Scopus (964) Google Scholar, 15.Bailey-Bucktrout S.L. Martinez-Llordella M. Zhou X. Anthony B. Rosenthal W. Luche H. Fehling H.J. Bluestone J.A. Self-antigen-driven activation induces instability of regulatory T cells during an inflammatory autoimmune response.Immunity. 2013; 39: 949-962Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar), IL-2 depletion (15.Bailey-Bucktrout S.L. Martinez-Llordella M. Zhou X. Anthony B. Rosenthal W. Luche H. Fehling H.J. Bluestone J.A. Self-antigen-driven activation induces instability of regulatory T cells during an inflammatory autoimmune response.Immunity. 2013; 39: 949-962Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar), epigenetic modification of the Foxp3 locus (18.Lal G. Zhang N. van der Touw W. Ding Y. Ju W. Bottinger E.P. Reid S.P. Levy D.E. Bromberg J.S. Epigenetic regulation of Foxp3 expression in regulatory T cells by DNA methylation.J. Immunol. 2009; 182: 259-273Crossref PubMed Scopus (454) Google Scholar), Foxp3 protein stability (19.Chen Z. Barbi J. Bu S. Yang H.Y. Li Z. Gao Y. Jinasena D. Fu J. Lin F. Chen C. Zhang J. Yu N. Li X. Shan Z. Nie J. Gao Z. Tian H. Li Y. Yao Z. Zheng Y. Park B.V. Pan Z. Zhang J. Dang E. Li Z. Wang H. Luo W. Li L. Semenza G.L. Zheng S.G. Loser K. Tsun A. Greene M.I. Pardoll D.M. Pan F. Li B. The ubiquitin ligase Stub1 negatively modulates regulatory T cell suppressive activity by promoting degradation of the transcription factor Foxp3.Immunity. 2013; 39: 272-285Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar), and modulation of microRNAs (20.Zhou X. Jeker L.T. Fife B.T. Zhu S. Anderson M.S. McManus M.T. Bluestone J.A. Selective miRNA disruption in T reg cells leads to uncontrolled autoimmunity.J. Exp. Med. 2008; 205: 1983-1991Crossref PubMed Scopus (446) Google Scholar), but it is still not clear how cell-intrinsic signaling pathways are linked to Treg cell instability. Stable Foxp3 expression in the progeny of Treg cells is ensured by a positive feedback loop comprising the CNS2 (also known as TSDR) region in the Foxp3 gene locus, the Cbfβ-Runx1 transcription factor, and Foxp3 itself, in which CNS2, Cbfβ-Runx1, and Foxp3 bind to each other to form a transcription complex (7.Williams L.M. Rudensky A.Y. Maintenance of the Foxp3-dependent developmental program in mature regulatory T cells requires continued expression of Foxp3.Nat. Immunol. 2007; 8: 277-284Crossref PubMed Scopus (683) Google Scholar, 21.Rudra D. Egawa T. Chong M.M. Treuting P. Littman D.R. Rudensky A.Y. Runx-CBFβ complexes control expression of the transcription factor Foxp3 in regulatory T cells.Nat. Immunol. 2009; 10: 1170-1177Crossref PubMed Scopus (158) Google Scholar, 22.Zheng Y. Josefowicz S. Chaudhry A. Peng X.P. Forbush K. Rudensky A.Y. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate.Nature. 2010; 463: 808-812Crossref PubMed Scopus (863) Google Scholar, 23.Birzele F. Fauti T. Stahl H. Lenter M.C. Simon E. Knebel D. Weith A. Hildebrandt T. Mennerich D. Next-generation insights into regulatory T cells: expression profiling and FoxP3 occupancy in human.Nucleic Acids Res. 2011; 39: 7946-7960Crossref PubMed Scopus (68) Google Scholar, 24.Ono M. Yaguchi H. Ohkura N. Kitabayashi I. Nagamura Y. Nomura T. Miyachi Y. Tsukada T. Sakaguchi S. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1.Nature. 2007; 446: 685-689Crossref PubMed Scopus (510) Google Scholar). Treg cells lacking CNS2, Cbfβ, or Runx1 gradually lose or down-regulate Foxp3 expression, indicating that defects in this positive feedback loop promote Treg cell instability (21.Rudra D. Egawa T. Chong M.M. Treuting P. Littman D.R. Rudensky A.Y. Runx-CBFβ complexes control expression of the transcription factor Foxp3 in regulatory T cells.Nat. Immunol. 2009; 10: 1170-1177Crossref PubMed Scopus (158) Google Scholar, 22.Zheng Y. Josefowicz S. Chaudhry A. Peng X.P. Forbush K. Rudensky A.Y. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate.Nature. 2010; 463: 808-812Crossref PubMed Scopus (863) Google Scholar). The formation of this feedback loop is largely dependent on the methylation status of the CNS2 region and the DNA binding activity of the Cbfβ-Runx1-Foxp3 complex. Demethylated CNS2 in Treg cells favors the recruitment of the Cbfβ-Runx1-Foxp3 complex to CNS2, whereas methylated CNS2 in conventional T cells and TGF-β-induced Treg cells does not (22.Zheng Y. Josefowicz S. Chaudhry A. Peng X.P. Forbush K. Rudensky A.Y. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate.Nature. 2010; 463: 808-812Crossref PubMed Scopus (863) Google Scholar). Consistent with this, the DNA methyltransferase family promotes Treg cell instability by increasing the level of CpG methylation in the CNS2 region (18.Lal G. Zhang N. van der Touw W. Ding Y. Ju W. Bottinger E.P. Reid S.P. Levy D.E. Bromberg J.S. Epigenetic regulation of Foxp3 expression in regulatory T cells by DNA methylation.J. Immunol. 2009; 182: 259-273Crossref PubMed Scopus (454) Google Scholar). Attenuating the DNA binding activity of Foxp3 potentially breaks the CNS2-Cbfβ-Runx1-Foxp3 feedback loop, resulting in Treg cell instability. As a transcription factor, Foxp3 binds target gene loci through its forkhead/winged helix (FKH) domain, which is critical to Foxp3 function. Of great significance, most IPEX patients carry genetic mutations in the FKH domain (25.Barzaghi F. Passerini L. Bacchetta R. Immune dysregulation, polyendocrinopathy, enteropathy, x-linked syndrome: a paradigm of immunodeficiency with autoimmunity.Front. Immunol. 2012; 3: 211Crossref PubMed Scopus (245) Google Scholar). To explore the links among cell-intrinsic signaling pathways, the DNA binding activity of Foxp3, and Treg cell instability, we performed an unbiased screen for kinases that modulate the DNA binding activity of Foxp3 using a novel luciferase-based reporter system. We found that activation of the COT/Tpl2-MEK-ERK signaling pathway inhibited the DNA binding activity of Foxp3 and promoted Treg cell instability in vivo. Our results support the hypothesis that external inflammatory signals modulate Treg cell stability through the COT/Tpl2-MEK-ERK signaling pathway, which provides a potential target for therapeutic intervention to treat autoimmune diseases and optimize human Treg cell therapy. DNA elements with six tandem copies of an optimized FOXP3 binding motif (5′-gtaaacaagagtaaacaagtcacgatcgcaaggtaaacaagacaacacgattgtaaacaagtccgaattccaaggtaaacaagagtaaaca-3′) or five tandem copies of the Gal4DB binding motif (5′-cggagtactgtcctccgagcggagtactgtcctccgac tcgagcggagtactgtcctccgatcggagtactgtcctccgcgaattccggagtactgtcctccg-3′) were inserted into the NheI/BglII sites of the vector pGL3-promoter (Promega) to generate pFOXP3Luc or pGal4Luc, respectively. Plasmid pVP16-FL (full-length) was engineered by inserting a recombinant fragment, VP16-FOXP3, that contains the activation domain of herpes simplex virion protein 16 (VP16) and full-length human FOXP3 into the NotI/SalI sites of p3×FLAGcmv7.1 (Sigma). On the basis of pVP16-FL, other plasmids encoding truncated and/or mutated versions of VP16-FOXP3 or VP16-Gal4 were generated. Recombinant fragments HA-FOXP3DelN (amino acids 1–181 truncated), VP16-DelN, and VP16-Gal4 were also cloned into the NotI/SalI sites of pMSCV-IRES-Thy1.1. A library of 192 human kinases and kinase-related ORFs with a myristoylation sequence and FLAG epitope tag was obtained from Addgene (Addgene collection 1000000012) (26.Boehm J.S. Zhao J.J. Yao J. Kim S.Y. Firestein R. Dunn I.F. Sjostrom S.K. Garraway L.A. Weremowicz S. Richardson A.L. Greulich H. Stewart C.J. Mulvey L.A. Shen R.R. Ambrogio L. Hirozane-Kishikawa T. Hill D.E. Vidal M. Meyerson M. Grenier J.K. Hinkle G. Root D.E. Roberts T.M. Lander E.S. Polyak K. Hahn W.C. Integrative genomic approaches identify IKBKE as a breast cancer oncogene.Cell. 2007; 129: 1065-1079Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar). pWZL-Neo-Myr-FLAG-EGFP was engineered by inserting the recombinant fragment myr-FLAG-EGFP into the EcoRI/SalI sites of pWZL-Neo-Myr-DEST. pEGFP-FOXP3DelN was engineered by inserting FOXP3DelN (amino acids 1–181 truncated) into the SalI/BamH I sites of pEGFP-C1. pLEX-DUSP6 was obtained from Addgene (Addgene plasmid 27975) (27.Bagnyukova T.V. Restifo D. Beeharry N. Gabitova L. Li T. Serebriiskii I.G. Golemis E.A. Astsaturov I. DUSP6 regulates drug sensitivity by modulating DNA damage response.Br. J. Cancer. 2013; 109: 1063-1071Crossref PubMed Scopus (25) Google Scholar). pcDNA3.1-MEK1DD and pcDNA3.1-MEK1mut (A-loop truncated) were provided by Prof. Y. H. Peng (Peking University, Beijing, China). To characterize the reporter system, 48-well tissue culture plates were seeded with 1 × 105 HEK293T cells/well 6 h before transfection using Lipofectamine 2000 (Invitrogen). Type A DNA mixtures (p3×FLAGcmv7.1-based construct:pFOXP3Luc:pRL-TK = 75:25:1) were introduced into HEK293T cells according to the specifications of the manufacturers. Similarly, type B DNA mixtures (kinase construct:pMSCV-VP16-DelN:pFOXP3Luc:pRL-TK = 45:45:10:1) were prepared for the screening of the kinase library and the following experiments. U0126 was added to the cell culture 6 h after transfection at final concentrations of 0, 20, and 40 μm. pLEX-DUSP6 was cotransfected with COT constructs at a ratio of 2. The dose effects of kinase were analyzed by serial dilution of the kinase construct in the type B DNA mixtures. For all of the experiments described above, empty vectors, GAL4-derived constructs, or EGFP constructs were used for control groups. Cells were washed with 1× PBS and lysed with 1× passive lysis buffer 24 h post-transfection (Promega, catalog no. E1941). Dual luciferase activity was measured using the Dual-Luciferase® reporter assay system (Promega, catalog no. E1960) and GloMax®20/20 luminometers according to the specifications of the manufacturers. Experiments were conducted in triplicate. Data were normalized to control groups. Differences in relative light units or fold activation were analyzed for statistical significance using unpaired Student's t test. To test the DNA binding activity of various versions of FOXP3, 6-well tissue culture plates were seeded with 4 × 105 HEK293T cells/well 6 h before transfection. The p3×FLAGcmv7.1-based constructs were introduced into HEK293T cells according to the specifications of the manufacturers. Similarly, DNA mixtures (kinase construct:pVP16-DelN = 2:1) were introduced into HEK293T cells. Twenty-four hours post-transfection, cells were washed with 1× PBS and lysed with Nonidet P-40 lysis buffer containing 150 mm NaCl, 50 mm Tris (pH 7.4), 1% Nonidet P-40, 1 mm PMSF, and protease inhibitors (Beyotime, China, catalog no. P0013F). The expression of versions of FOXP3 protein in cell lysates was confirmed by Western blotting using anti-FLAG antibodies. Properly diluted lysates were incubated with 10 μg of poly deoxyinosinic-deoxycytidylic acid (Sigma) and 40 μl of streptavidin-agarose beads (Sigma) coated with 5′-biotinylated FOXP3 binding oligonucleotide (5′-CAAGGTAAACAAGAGTAA ACAAAGTC-3′) overnight at 4 °C on a roller. The beads were washed three times with 500 μl of ice-cold wash buffer (1× PBS, 1 mm EDTA, 1 mm PMSF, and 0.1% Nonidet P-40), resuspended in 40 μl of SDS sample loading buffer, heated at 95 °C for 10 min, and analyzed by Western blotting using anti-FLAG antibody. The protein degradation assay was performed by introducing mixtures (kinase construct:pMSCV-HA-FOXP3DelN = 1:1) into HEK293T cells. Cycloheximide (200 μg/ml, Sigma) was added to the cell culture 24 h after transfection. Following incubation for 0, 0.5, 1, 2, and 4 h, cells were harvested and lysed for Western blotting assays using anti-HA and anti-β-actin antibodies. Foxp3-GFP-Cre×R26-loxp-stop-loxp-YFP (termed TregYFP in this study) reporter mice were crossed with wild-type C57BL/6 mice to create a mixed NOD×B6 background (13.Zhou X. Bailey-Bucktrout S.L. Jeker L.T. Penaranda C. Martínez-Llordella M. Ashby M. Nakayama M. Rosenthal W. Bluestone J.A. Instability of the transcription factor Foxp3 leads to the generation of pathogenic memory T cells in vivo.Nat. Immunol. 2009; 10: 1000-1007Crossref PubMed Scopus (964) Google Scholar). Rosa26-loxp-stop-loxp-MEK1DD-IRES-EGFP mice were obtained from The Jackson Laboratory (catalog no. 012352, C57BL/6-Gt (ROSA) 26Sortm8 (Map2k1*, EGFP) Rsky/J) (28.Srinivasan L. Sasaki Y. Calado D.P. Zhang B. Paik J.H. DePinho R.A. Kutok J.L. Kearney J.F. Otipoby K.L. Rajewsky K. PI3 kinase signals BCR-dependent mature B cell survival.Cell. 2009; 139: 573-586Abstract Full Text Full Text PDF PubMed Scopus (501) Google Scholar) and bred to Foxp3-GFP-Cre×R26-loxp-stop-loxp-YFP mice to create progenies in the mixed NOD×B6 background. All mice were housed and bred under the same environmental conditions at the Beijing Laboratory Animal Research Center in accordance with the guidelines for the care and use of laboratory animals established by the Beijing Association for Laboratory Animal Science. All animal procedures were conducted according to the regulations of the Institute of Microbiology, Chinese Academy of Sciences Research Ethics Committee. The protocol was approved by the Research Ethics Committee of the Institute of Microbiology, Chinese Academy of Sciences. Axillary and inguinal lymph node (pLN) cells from TregYFP mice were activated by plate-bound anti-CD3 (2 μg/ml/day) and anti-CD28 (1 μg/ml/day) for 5 days in the presence of 200 units/ml IL-2. COT inhibitor (CAS 871307-18-5, Santa Cruz Biotechnology) or U0126 (Sigma) was added to the cell culture medium at day 2 to a final concentration of 5 μm. Foxp3 protein expression was assessed at day 5 using a Foxp3 staining kit (eBioscience). The retrovirus vector LMP-Thy1.1 was engineered by inserting the Thy1.1 ORF into the NcoI/SalI sites of MSCV-LTRmiR30-PIG (Open Biosystems). A double-stranded DNA cassette that targets the coding region of mouse Cot was cloned into LMP-Thy1.1 according to the protocol of the manufacturer. Retrovirus production was performed as described previously (29.Ivanov I.I. McKenzie B.S. Zhou L. Tadokoro C.E. Lepelley A. Lafaille J.J. Cua D.J. Littman D.R. The orphan nuclear receptor RORγt directs the differentiation program of proinflammatory IL-17+ T helper cells.Cell. 2006; 126: 1121-1133Abstract Full Text Full Text PDF PubMed Scopus (3949) Google Scholar). Pooled splenocytes and pLN cells from TregYFP mice were activated by plate-coated anti-CD3/CD28 for 2 days in the presence of 200 units/ml IL-2 before FACS for YFP+ cells. Sorted YFP+ cells were then infected with retrovirus and continued to be stimulated with plate-bound anti-CD3/CD28 for 3 days in the presence of 1000 units/ml IL-2 before intracellular Foxp3 staining. Labeled anti-CD4 (GK1.5), anti-CD8 (53–6.7), anti-CD25 (PC61), anti-CD45R (RA3–6B2), anti-CD44 (IM7), anti-CD62L (MEL14), anti-Foxp3 (FJK-16s), anti-Helios (22F6), anti-IL-2 (JES6–5H4), and anti-IFN-γ (XMG1.2) antibodies and specific isotype-matched control antibodies were from BD Biosciences or eBioscience. For cytokine analysis, cells were incubated for 3–4 h at 37 °C with 0.5 mm ionomycin, 10 ng/ml phorbol 12-myristate 13-acetate, and 3 mm monensin. Cells with YFP or GFP expression were prefixed in 1% (w/v) paraformaldehyde for 2 min, fixed, made permeable using a Foxp3 staining kit (eBioscience), and stained for intracellular proteins. The stained cells were analyzed on a FACSCalibur flow cytometer followed by data analysis using FlowJo software. Eight- to twelve-week-old mice were immunized subcutaneously at four sites (50 μl/site) with 200 μl of emulsified complete Freund adjuvant (Sigma) supplemented with 4 mg/ml Mycobacterium tuberculosis H37Ra (Difco) and 300 μg of MOG35–55 peptide (MEVGWYRSPFSRVVHLYR-NK, ChinaPeptides, China) and received intraperitoneal injections of 2 × 109 heat-killed Bordetella pertussis organisms (Beijing Tiantan Biological products Co., Ltd.) at the time of immunization and 48 h later. Clinical disease was assessed by the scoring of hind limb paralysis as follows: no signs, 0; flaccid tail, 1; hind limb weakness, 2; partial hind limb paralysis, 3; complete hind limb paralysis, 4; and moribund mouse, 5. To study the DNA binding activity of FOXP3, we developed a novel luciferase-based reporter system (FOXP3Luc) in HEK293T cells. Briefly, FOXP3Luc consists of a reporter plasmid containing six tandem copies of an optimized FOXP3-binding DNA motif inserted upstream of the SV40-Luc cassette (pFOXP3Luc), a vector expressing full-length or truncated FOXP3 fused to the FLAG-tagged VP16 activation domain, and pRL-TK as an internal control (Fig. 1A). Theoretically, the VP16 domain can recruit additional transcriptional activators to enhance the transcription of the SV40-Luc gene upon FOXP3 binding to target sites through its FKH domain (30.Sadowski I. Ma J. Triezenberg S. Ptashne M. GAL4-VP16 is an unusually potent transcriptional activator.Nature. 1988; 335: 563-564Crossref PubMed Scopus (974) Google Scholar). We first verified the function of the VP16 domain and the specificity of the FOXP3-binding elements by comparing the functions of different versions of FOXP3 in FOXP3Luc. Compared with the vector control, FOXP3FL (full-length) and FOXP3DelN (amino acids 1–181 truncated) had negligible effects on the readout of FOXP3Luc, whereas VP16-FL and VP16-DelN strikingly elevated the activity (∼3- and ∼30-fold, respectively) (Fig. 1B). Moreover, the optimized FOXP3-binding elements acted as specific targets of FOXP3 (but not the Gal4 DNA binding domain) in HEK293T cells, as shown by VP16-Gal4, which could not enhance the transcription of luciferase. It was striking that deletion of the N-terminal FOXP3 repressor domain (amino acids 1–181) increased the DNA binding activity of the FKH domain, which is consistent with gel shift findings reported previously (31.Koh K.P. Sundrud M.S. Rao A. Domain requirements and sequence specificity of DNA binding for the forkhead transcription factor FOXP3.PLoS ONE. 2009; 4: e8109Crossref PubMed Scopus (45) Google Scholar). Next we compared the DNA binding activities of VP16-DelN variants harboring different IPEX mutations. Compared with wild-type VP16-DelN, the F324L mutation had little effect on the function of VP16-DelN in FOXP3Luc. The A384T mutation caused a mild reduction in activity, and the M370I, F371C, F373A, and R397W mutations caused severe reductions, indicating that FOXP3Luc recapitulates the function of the FOXP3 FKH domain with high sensitivity and fidelity (Fig. 1C). Finally, to directly prove that FOXPLuc can indicate the DNA binding activity of FOXP3, we performed a DNA pulldown assay using streptavidin-agarose beads coated with 5′-biotinylated FOXP3-binding oligonucleotide. We found that VP16-Gal4 could not be detected in the pulldown products, whereas wild-type VP16-DelN yielded a strong signal in the same assay, indicating that VP16-DelN can specifically bind the 5′-biotinylated FOXP3-binding oligonucleotide. VP16-FL was poorly enriched by the beads, in line with its low activity in FOXP3Luc. Further, VP16-F324L showed comparable DNA binding activity to wild-type VP16-DelN, whereas the DNA binding activity of the VP16-M370I, VP16-F371C, VP16-F373A, and VP16-R397W mutants was severely attenuated. Moreover, VP16-A384T had moderately attenuated DNA binding activity (Fig. 1D). Taken together, the results of the DNA pulldown assays were consistent with the FOXP3Luc assay. Therefore, we suggest that FOXP3Luc can reliably represent the DNA binding ability of FOXP3. Similarly, we successfully constructed a Gal4Luc system, which had no mutual interference with FOXP3Luc (data not shown). To investigate the cell-intrinsic signaling network linked to Treg cell instability, it is reasonable to study kinases that participate in diverse cellular signal transduction pathways. Therefore, we performed an unbiased screen for kinases that modulate the DNA binding activity of FOXP3 by utilizing a myr-kinase l" @default.
• W2012171938 created "2016-06-24" @default.
• W2012171938 creator A5040884155 @default.
• W2012171938 creator A5049165439 @default.
• W2012171938 creator A5051484619 @default.
• W2012171938 creator A5052937683 @default.
• W2012171938 creator A5056319049 @default.
• W2012171938 creator A5072284526 @default.
• W2012171938 date "2014-12-01" @default.
• W2012171938 modified "2023-10-18" @default.
• W2012171938 title "Constitutive Activation of MEK1 Promotes Treg Cell Instability in Vivo" @default.
• W2012171938 cites W1575585006 @default.
• W2012171938 cites W1576274197 @default.
• W2012171938 cites W1674079630 @default.
• W2012171938 cites W1921636592 @default.
• W2012171938 cites W1965673490 @default.
• W2012171938 cites W1966972158 @default.
• W2012171938 cites W1979647722 @default.
• W2012171938 cites W1981008354 @default.
• W2012171938 cites W1982006380 @default.
• W2012171938 cites W1998157143 @default.
• W2012171938 cites W2001192666 @default.
• W2012171938 cites W2002726823 @default.
• W2012171938 cites W2007886976 @default.
• W2012171938 cites W2012891605 @default.
• W2012171938 cites W2013146483 @default.
• W2012171938 cites W2034531634 @default.
• W2012171938 cites W2034621048 @default.
• W2012171938 cites W2036117709 @default.
• W2012171938 cites W2038869692 @default.
• W2012171938 cites W2043776488 @default.
• W2012171938 cites W2054281806 @default.
• W2012171938 cites W2073045132 @default.
• W2012171938 cites W2078157388 @default.
• W2012171938 cites W2090069133 @default.
• W2012171938 cites W2091311002 @default.
• W2012171938 cites W2097811455 @default.
• W2012171938 cites W2100699905 @default.
• W2012171938 cites W2102650038 @default.
• W2012171938 cites W2105630018 @default.
• W2012171938 cites W2111867055 @default.
• W2012171938 cites W2114569569 @default.
• W2012171938 cites W2121325716 @default.
• W2012171938 cites W2122907933 @default.
• W2012171938 cites W2130486201 @default.
• W2012171938 cites W2138839197 @default.
• W2012171938 cites W2139047992 @default.
• W2012171938 cites W2141649011 @default.
• W2012171938 cites W2141674733 @default.
• W2012171938 cites W2142017607 @default.
• W2012171938 cites W2152642587 @default.
• W2012171938 cites W2156809901 @default.
• W2012171938 cites W2162408694 @default.
• W2012171938 cites W2166916498 @default.
• W2012171938 doi "https://doi.org/10.1074/jbc.m114.589192" @default.
• W2012171938 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4271203" @default.
• W2012171938 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25361764" @default.
• W2012171938 hasPublicationYear "2014" @default.
• W2012171938 type Work @default.
• W2012171938 sameAs 2012171938 @default.
• W2012171938 citedByCount "18" @default.
• W2012171938 countsByYear W20121719382015 @default.
• W2012171938 countsByYear W20121719382016 @default.
• W2012171938 countsByYear W20121719382017 @default.
• W2012171938 countsByYear W20121719382018 @default.
• W2012171938 countsByYear W20121719382019 @default.
• W2012171938 countsByYear W20121719382020 @default.
• W2012171938 countsByYear W20121719382021 @default.
• W2012171938 countsByYear W20121719382022 @default.
• W2012171938 countsByYear W20121719382023 @default.
• W2012171938 crossrefType "journal-article" @default.
• W2012171938 hasAuthorship W2012171938A5040884155 @default.
• W2012171938 hasAuthorship W2012171938A5049165439 @default.
• W2012171938 hasAuthorship W2012171938A5051484619 @default.
• W2012171938 hasAuthorship W2012171938A5052937683 @default.
• W2012171938 hasAuthorship W2012171938A5056319049 @default.
• W2012171938 hasAuthorship W2012171938A5072284526 @default.
• W2012171938 hasBestOaLocation W20121719381 @default.
• W2012171938 hasConcept C143425029 @default.
• W2012171938 hasConcept C154317977 @default.
• W2012171938 hasConcept C178169997 @default.
• W2012171938 hasConcept C185592680 @default.
• W2012171938 hasConcept C202751555 @default.
• W2012171938 hasConcept C207001950 @default.
• W2012171938 hasConcept C3020684253 @default.
• W2012171938 hasConcept C502942594 @default.
• W2012171938 hasConcept C54355233 @default.
• W2012171938 hasConcept C552990157 @default.
• W2012171938 hasConcept C55493867 @default.
• W2012171938 hasConcept C79484868 @default.
• W2012171938 hasConcept C86803240 @default.
• W2012171938 hasConcept C95444343 @default.
• W2012171938 hasConceptScore W2012171938C143425029 @default.
• W2012171938 hasConceptScore W2012171938C154317977 @default.
• W2012171938 hasConceptScore W2012171938C178169997 @default.
• W2012171938 hasConceptScore W2012171938C185592680 @default.
• W2012171938 hasConceptScore W2012171938C202751555 @default.
• W2012171938 hasConceptScore W2012171938C207001950 @default.

• next