FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012186301> ?p ?o ?g. }

• W2012186301 endingPage "94" @default.
• W2012186301 startingPage "92" @default.
• W2012186301 abstract "Bacterial vaginosis (BV) is the most common form of vaginitis worldwide and has been linked to multiple reproductive tract complications including preterm birth and increased risk of acquiring STD/HIV.1–3 The pathogenesis of BV is poorly understood and there is lack of consensus on a possible etiologic agent, if any. The majority of epidemiologic data, however, suggests that BV is an STD.4–7 Early on, in the recognition of this syndrome it was accepted that Gardnerella vaginalis was the causative organism; however, this fell out of favor when it was reported that G. vaginalis could be cultured from women who did not meet the Amsel criteria for BV.8 In retrospect, although these women did not meet the clinical criteria for the diagnosis of BV, they also may have not had normal vaginal flora. Although BV flora is characterized by a multitude of organisms, the presence of G. vaginalis in the vaginal flora of women with BV is universal. Studies of G. vaginalis in men have been limited and few studies of concordance among sexual partners have been published and none using polymerase chain reaction (PCR). We determined the presence or absence of this organism from genitourinary specimens of male sexual partners of women with and without normal vaginal flora using G. vaginalis-specific PCR. Women attending the Jefferson County Department of Health STD Clinic for screening or a new problem were invited to participate in the study. Women were classified as having BV if they met the clinical criteria of Amsel et al.9 or as negative for BV if they did not fulfill this criteria. Women were administered standardized questionnaires regarding sexual behavior and a vaginal smear was obtained for Gram stain using the method of Nugent et al.10 Women were asked to refer sexual partners with whom they had had sexual intercourse within the past 2 weeks to the study for enrollment in the study. Men were also administered a questionnaire and examined for signs of STD. First fraction urine (15–20 mL) was collected, centrifuged, and the pellet resuspended in 5 mL of urine. The pellet mixture was refrigerated on-site then stored at −20 °C before processing. Swabs were obtained from the coronal sulcus and the urethra, placed into a dry sterile screw-capped tube, refrigerated on-site then stored at −20 °C before processing. Total DNA was extracted from urine sediment, urethral, and coronal sulcus swab specimens by inorganic extraction (Wizard Genomic Purification Kit, Promega, Madison, WI).11 Amplification of a conserved sequence within the G. vaginalis 16 S rRNA gene was carried out using previously reported primers: GV-V6-U2 5′ GACCATGCACCACCTGTGAA 3′ and GV-V2-R1 5′ TCGTGGAGGGTTCGATTCTG 3′.12 Reactions were carried out in 20 μL containing template DNA, 1 × CoralLoad Buffer (Qiagen, Valencia, CA), 200 μmol/L of each dNTP, 0.5 μmol/L of each primer, and 0.025 U/μL of HotStarTaq Plus (Qiagen, Valencia, CA). Amplification conditions on an iCycler (BioRad Laboratories, Hercules, CA) were as follows: 95 °C × 5′/(94 °C × 30′; 60 °C × 30′; 72 °C × 30′) × 30/72 °C × 5′/4°C pause. Two negative controls were run on each amplification batch: water as template for reagent check and Mobiluncus mulieris. The positive control was laboratory cultured G. vaginalis. Amplicons were electrophoresed on 2% agarose/1 × tris acetic acid EDTA (TAE) gels prestained with ethidium bromide, followed by photodigital documentation. G. vaginalis positivity (a band of 1041 base pairs) was defined as a positive PCR from at least 1 sampling of the specimen set. For comparisons of categorical data, Fisher exact test, and the χ2 test were used. The Wilcoxon rank sum test was used to compare groups about continuous variables because a number of variables were not normally distributed. A total of 68 men were enrolled into the study, 29 (43%) as partners of women with BV and 39 (57%) as partners of women without BV. For the present analysis we limited inclusion to only those 47 (69.1%) men who had available specimens from all 3 sampling sites (urine, urethral swab, coronal sulcus swab). Women with BV by Amsel criteria had a median baseline Nugent score of 8 versus 2 for the women without BV (P <0.001). The only significant difference other than the baseline Nugent scores of the female partners was race. There was a significantly higher proportion of black subjects who were partners of women with BV than those who were partners to women without BV (Table 1). There were no significant differences between the 47 men who had samples available and the larger cohort (data not shown).TABLE 1: Baseline Characteristics of Male Sexual Partners of Women With and Without BVG. vaginalis was detected in 12 patients [25%, 95% confidence interval (CI) from 14% to 40%]. Urethral specimens were positive in 8/12 (66.6%) of the infected subjects. One patient had a positive result only from the coronal sulcus and 3 patients were positive only in the urine (Table 2). Twenty-six percent of partners of women with BV tested positive for Gardnerella versus 25% of partners of women without BV. There was no significant difference in the rates of G. vaginalis between men who were sexual partners of women with and without BV by Amsel criteria, women with and without normal Nugent scores of 0 to 3, or women with and without bacterial morphotypes on vaginal Gram stain that were consistent with G. vaginalis.TABLE 2: Concordance of Results Across Anatomic SitesNone of the 11 participants who stated that they had used a condom at the last sexual encounter tested positive for G. vaginalis in contrast to 12/36 (33%) of those who did not use a condom at the last sexual encounter (P = 0.04). None of the 5 participants who stated that they always used a condom in the previous 3 months were positive for G. vaginalis. In comparison, 12/42 (29%) of those who did not always use a condom in the past 3 months were positive for G. vaginalis (P = 0.31) (Table 3).TABLE 3: Results of G. vaginalis PCR Among Men With Specimens From All 3 Anatomic SitesThe significance of G. vaginalis in the pathogenesis of BV remains controversial; however, nearly all women with BV have high concentrations of this organism.13 Like Neisseria gonorrhoeae, it is a fastidious bacterium that is recovered primarily from genitourinary sites in both sexes and is unstable when removed from its natural environment.14 The human vagina provides an especially rich culture medium, the presence of glycogen being an in vivo growth requirement.15 In males, G. vaginalis has been repeatedly recovered from the urethra and from seminal fluid.16–20 Sexual contact studies point to the sexual transmissibility of G. vaginalis. In 1955, Gardner and Dukes reported that they had isolated Gardnerella from the urethras of 86% of husbands of women with BV.16 Similarly, in 1978, Pheiffer et al. demonstrated the concordance of Gardnerella among 79% of couples in which the woman had BV versus 0% of couples in which the woman did not have BV.21 Biotyping of G. vaginalis has yielded compelling results supporting the sexual transmission of this bacterium. Piot et al. found that biotypes isolated from women with BV and from the urethras of their sexual partners were identical 90% of the time.22 In a longitudinal study of G. vaginalis biotypes, Briselden and Hillier found that lipase-producing strains were associated with BV and that although not statistically significant there was an association between acquisition of a new biotype and new sex partners.23 Ninety percent of women who developed BV acquired a new biotype suggesting a new infection rather than relapse.23 Holst cultured the urethra, coronal sulcus, and seminal fluid of male partners of women with and without BV. They found that 17% of male partners of women with BV were infected versus 2% of partners of women without BV. Further, among men who had specimens taken within 20 hours of unprotected sex with women with BV and then 2 weeks later after interval condom usage, G. vaginalis was only isolated from specimens taken after recent unprotected intercourse.24 In our study, using PCR, we found an overall prevalence of G. vaginalis of 25% but found no difference in the prevalence rates between male sexual partners of women with and without BV. This unexpected finding may be the result of the fact that both groups of men were recruited from the same high risk cohort of patients attending an STD clinic. In fact, the overall prevalence of BV among women attending the clinic is between 50% and 60% (unpublished data). It is therefore possible that the male partners of women without BV were either exposed to abnormal vaginal flora in their referring partners at an earlier time or that they were exposed via a second partner. Although a few men had G. vaginalis detected externally from the coronal sulcus, most cases were detected using either urethral swab specimens or urine. Condom use with the last sexual encounter was significantly associated with a reduced rate of G. vaginalis detection and there was a similar trend for those men who reported always using condoms in the previous 3 months. Condom use has been shown in several recent studies to be protective for acquisition of BV in women.25,26 Additional studies examining concordance of BV-related pathogens in couples, especially couples at lower risk of STD, may be beneficial in contributing to our knowledge of the pathogenesis of BV." @default.
• W2012186301 created "2016-06-24" @default.
• W2012186301 creator A5025156995 @default.
• W2012186301 creator A5056409417 @default.
• W2012186301 creator A5075557864 @default.
• W2012186301 date "2009-02-01" @default.
• W2012186301 modified "2023-10-16" @default.
• W2012186301 title "Prevalence of Gardnerella vaginalis in Male Sexual Partners of Women With and Without Bacterial Vaginosis" @default.
• W2012186301 cites W1502676012 @default.
• W2012186301 cites W1511490662 @default.
• W2012186301 cites W1865352975 @default.
• W2012186301 cites W1868667984 @default.
• W2012186301 cites W1908331074 @default.
• W2012186301 cites W1983683595 @default.
• W2012186301 cites W1989832453 @default.
• W2012186301 cites W2009968817 @default.
• W2012186301 cites W2022056287 @default.
• W2012186301 cites W2059574636 @default.
• W2012186301 cites W2089635226 @default.
• W2012186301 cites W2090979248 @default.
• W2012186301 cites W2112589439 @default.
• W2012186301 cites W2116864763 @default.
• W2012186301 cites W2118315033 @default.
• W2012186301 cites W2128168864 @default.
• W2012186301 cites W2140171259 @default.
• W2012186301 cites W2339142968 @default.
• W2012186301 cites W2396561933 @default.
• W2012186301 cites W2415074495 @default.
• W2012186301 doi "https://doi.org/10.1097/olq.0b013e3181886727" @default.
• W2012186301 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18797426" @default.
• W2012186301 hasPublicationYear "2009" @default.
• W2012186301 type Work @default.
• W2012186301 sameAs 2012186301 @default.
• W2012186301 citedByCount "34" @default.
• W2012186301 countsByYear W20121863012012 @default.
• W2012186301 countsByYear W20121863012013 @default.
• W2012186301 countsByYear W20121863012014 @default.
• W2012186301 countsByYear W20121863012015 @default.
• W2012186301 countsByYear W20121863012017 @default.
• W2012186301 countsByYear W20121863012019 @default.
• W2012186301 countsByYear W20121863012020 @default.
• W2012186301 countsByYear W20121863012022 @default.
• W2012186301 countsByYear W20121863012023 @default.
• W2012186301 crossrefType "journal-article" @default.
• W2012186301 hasAuthorship W2012186301A5025156995 @default.
• W2012186301 hasAuthorship W2012186301A5056409417 @default.
• W2012186301 hasAuthorship W2012186301A5075557864 @default.
• W2012186301 hasBestOaLocation W20121863011 @default.
• W2012186301 hasConcept C131872663 @default.
• W2012186301 hasConcept C141071460 @default.
• W2012186301 hasConcept C159047783 @default.
• W2012186301 hasConcept C2776983459 @default.
• W2012186301 hasConcept C2777617518 @default.
• W2012186301 hasConcept C2777700855 @default.
• W2012186301 hasConcept C2777744392 @default.
• W2012186301 hasConcept C2779379456 @default.
• W2012186301 hasConcept C2779952448 @default.
• W2012186301 hasConcept C2780018483 @default.
• W2012186301 hasConcept C29456083 @default.
• W2012186301 hasConcept C3013748606 @default.
• W2012186301 hasConcept C3020339741 @default.
• W2012186301 hasConcept C71924100 @default.
• W2012186301 hasConcept C86803240 @default.
• W2012186301 hasConcept C89423630 @default.
• W2012186301 hasConceptScore W2012186301C131872663 @default.
• W2012186301 hasConceptScore W2012186301C141071460 @default.
• W2012186301 hasConceptScore W2012186301C159047783 @default.
• W2012186301 hasConceptScore W2012186301C2776983459 @default.
• W2012186301 hasConceptScore W2012186301C2777617518 @default.
• W2012186301 hasConceptScore W2012186301C2777700855 @default.
• W2012186301 hasConceptScore W2012186301C2777744392 @default.
• W2012186301 hasConceptScore W2012186301C2779379456 @default.
• W2012186301 hasConceptScore W2012186301C2779952448 @default.
• W2012186301 hasConceptScore W2012186301C2780018483 @default.
• W2012186301 hasConceptScore W2012186301C29456083 @default.
• W2012186301 hasConceptScore W2012186301C3013748606 @default.
• W2012186301 hasConceptScore W2012186301C3020339741 @default.
• W2012186301 hasConceptScore W2012186301C71924100 @default.
• W2012186301 hasConceptScore W2012186301C86803240 @default.
• W2012186301 hasConceptScore W2012186301C89423630 @default.
• W2012186301 hasIssue "2" @default.
• W2012186301 hasLocation W20121863011 @default.
• W2012186301 hasLocation W20121863012 @default.
• W2012186301 hasLocation W20121863013 @default.
• W2012186301 hasOpenAccess W2012186301 @default.
• W2012186301 hasPrimaryLocation W20121863011 @default.
• W2012186301 hasRelatedWork W1502676012 @default.
• W2012186301 hasRelatedWork W178133968 @default.
• W2012186301 hasRelatedWork W1988744186 @default.
• W2012186301 hasRelatedWork W2351761433 @default.
• W2012186301 hasRelatedWork W2401363187 @default.
• W2012186301 hasRelatedWork W2417651210 @default.
• W2012186301 hasRelatedWork W2738646381 @default.
• W2012186301 hasRelatedWork W4233894143 @default.
• W2012186301 hasRelatedWork W4244558685 @default.
• W2012186301 hasRelatedWork W4302398963 @default.
• W2012186301 hasVolume "36" @default.
• W2012186301 isParatext "false" @default.

• next