FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012477137> ?p ?o ?g. }

• W2012477137 endingPage "19790" @default.
• W2012477137 startingPage "19784" @default.
• W2012477137 abstract "Defects in the AIRE gene cause a monogenic autoimmune syndrome APECED (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy), which is characterized by loss of self-tolerance to multiple organs. In concordance with its role in immune tolerance, AIRE is most strongly expressed in thymic epithelial cells and in cells of monocytic-dendritic lineage. The AIRE protein has been shown to function as a transcriptional regulator, however, the mechanisms regulating AIRE gene expression are not known. Here we have characterized the AIRE promoter region by identifying a minimal promoter region within 350 bp of the translation initiation codon. Electrophoretic mobility shift assays and transient transfections with mutated promoter constructs revealed a functional TATA box (-163 to -153) and binding sites for transcription complexes AP-1 (-307 to -296), NF-Y (-213 to -202), and Sp1 (-202 to -189). The presence of a 390-bp CpG island within the proximal promoter suggested that cytosine methylation has a role in transcriptional regulation of AIRE, which was supported by in vitro methylation experiments of promoter constructs. Sodium bisulfite sequencing showed a less methylated status of AIRE promoter in the thymic epithelial cell line TEC1A3 compared with HeLa and monocytic cells U937 and THP-1. Real-time PCR analysis showed that treatment with 5-aza-2′-deoxycytidine (5-azaCdR), a DNA methyltransferase inhibitor, up-regulated AIRE transcript levels in TEC1A3, U937, and HeLa cells and that even greater activations in TEC1A3 and U937 cells were observed using combined treatments with deacetylase inhibitor trichostatin A. These results suggest that AIRE gene expression is modulated through modifications in chromatin methylation and acetylation. Defects in the AIRE gene cause a monogenic autoimmune syndrome APECED (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy), which is characterized by loss of self-tolerance to multiple organs. In concordance with its role in immune tolerance, AIRE is most strongly expressed in thymic epithelial cells and in cells of monocytic-dendritic lineage. The AIRE protein has been shown to function as a transcriptional regulator, however, the mechanisms regulating AIRE gene expression are not known. Here we have characterized the AIRE promoter region by identifying a minimal promoter region within 350 bp of the translation initiation codon. Electrophoretic mobility shift assays and transient transfections with mutated promoter constructs revealed a functional TATA box (-163 to -153) and binding sites for transcription complexes AP-1 (-307 to -296), NF-Y (-213 to -202), and Sp1 (-202 to -189). The presence of a 390-bp CpG island within the proximal promoter suggested that cytosine methylation has a role in transcriptional regulation of AIRE, which was supported by in vitro methylation experiments of promoter constructs. Sodium bisulfite sequencing showed a less methylated status of AIRE promoter in the thymic epithelial cell line TEC1A3 compared with HeLa and monocytic cells U937 and THP-1. Real-time PCR analysis showed that treatment with 5-aza-2′-deoxycytidine (5-azaCdR), a DNA methyltransferase inhibitor, up-regulated AIRE transcript levels in TEC1A3, U937, and HeLa cells and that even greater activations in TEC1A3 and U937 cells were observed using combined treatments with deacetylase inhibitor trichostatin A. These results suggest that AIRE gene expression is modulated through modifications in chromatin methylation and acetylation. Mutations in the autoimmune regulator (AIRE) 1The abbreviations used are: AIRE, autoimmune regulator promoter; APECED, autoimmune polyendocrinopathy candidiasis ectodermal dystrophy; 5-azaCdR, 5-aza-2′-deoxycytidine; TSA, trichostatin A; EMSA, electrophoretic mobility shift assay; DTT, dithiothreitol; RT, real-time; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.1The abbreviations used are: AIRE, autoimmune regulator promoter; APECED, autoimmune polyendocrinopathy candidiasis ectodermal dystrophy; 5-azaCdR, 5-aza-2′-deoxycytidine; TSA, trichostatin A; EMSA, electrophoretic mobility shift assay; DTT, dithiothreitol; RT, real-time; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. gene cause an autosomal recessive disease called APECED (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar, 2The Finnish-German APECED Consortium Nat. Genet. 1997; 17: 399-403Crossref PubMed Scopus (1015) Google Scholar). The syndrome, occurring as a result of defective tolerance to self-antigens, is characterized by endocrine organ-specific autoimmunity and chronic mucocutaneous candidiasis and ectodermal disorders (3Ahonen P. Myllärniemi S. Sipilä I. Perheentupa J. N. Engl. J. Med. 1990; 322: 1829-1836Crossref PubMed Scopus (859) Google Scholar). AIRE encodes a 58-kDa protein with structural motifs indicative of a transcriptional regulator having a conserved nuclear localization signal, two plant homeodomain zinc-finger motifs, four LXXLL or nuclear receptor box motifs, a proline-rich region, a SAND domain, and an HSR domain (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar, 2The Finnish-German APECED Consortium Nat. Genet. 1997; 17: 399-403Crossref PubMed Scopus (1015) Google Scholar, 4Gibson T.J. Ramu C. Gemund C. Aasland R. Trends Biochem. Sci. 1998; 23: 242-244Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). The protein has a tissue-specific expression pattern, being mainly expressed in the thymus, lymph nodes, the spleen, and fetal liver (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar, 2The Finnish-German APECED Consortium Nat. Genet. 1997; 17: 399-403Crossref PubMed Scopus (1015) Google Scholar, 5Heino M. Peterson P. Kudoh J. Nagamine K. Lagerstedt A. Ovod V. Ranki A. Rantala I. Nieminen M. Tuukkanen J. Scott H.S. Antonarakis S.E. Shimizu N. Krohn K. Biochem. Biophys. Res. Commun. 1999; 257: 821-825Crossref PubMed Scopus (235) Google Scholar, 6Heino M. Peterson P. Sillanpää N. Guerin S. Wu L. Anderson G. Scott H.S. Antonarakis S.E. Kudoh J. Shimizu N. Jenkinson E.J. Naquet P. Krohn K.J. Eur. J. Immunol. 2000; 30: 1884-1893Crossref PubMed Scopus (154) Google Scholar). In the thymus, AIRE is expressed in medullary epithelial cells and cells of monocyte-dendritic lineage (5Heino M. Peterson P. Kudoh J. Nagamine K. Lagerstedt A. Ovod V. Ranki A. Rantala I. Nieminen M. Tuukkanen J. Scott H.S. Antonarakis S.E. Shimizu N. Krohn K. Biochem. Biophys. Res. Commun. 1999; 257: 821-825Crossref PubMed Scopus (235) Google Scholar, 7Björses P. Pelto-Huikko M. Kaukonen J. Aaltonen J. Peltonen L. Ulmanen I. Hum. Mol. Genet. 1999; 8: 259-266Crossref PubMed Scopus (123) Google Scholar). Subcellularly, AIRE is located in the cell nucleus and in nuclear dots resembling promyelocytic leukemia bodies (7Björses P. Pelto-Huikko M. Kaukonen J. Aaltonen J. Peltonen L. Ulmanen I. Hum. Mol. Genet. 1999; 8: 259-266Crossref PubMed Scopus (123) Google Scholar, 8Pitkänen J. Vähämurto P. Krohn K. Peterson P. J. Biol. Chem. 2001; 276: 19597-19602Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). Supporting AIRE subcellular location and its structural features, AIRE has been shown to act as a transcriptional activator, the process that is mediated through the plant homeodomain zinc fingers (8Pitkänen J. Vähämurto P. Krohn K. Peterson P. J. Biol. Chem. 2001; 276: 19597-19602Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). AIRE also interacts with the common transcriptional coactivator CREB-binding protein (CBP) through the CH1 and CH3 conserved domains (9Pitkänen J. Doucas V. Sternsdorf T. Nakajima T. Aratani S. Jensen K. Will H. Vähämurto P. Ollila J. Vihinen M. Scott H.S. Antonarakis S.E. Kudoh J. Shimizu N. Krohn K. Peterson P. J. Biol. Chem. 2000; 275: 16802-16809Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). Recent findings in AIRE-deficient mice suggest that the protein influences expression of peripheral self-antigens in the thymus, explaining the mechanism through which immune tolerance can be broken in multiorgan endocrine autoimmune diseases (10Anderson M.S. Venanzi E.S. Klein L. Chen Z. Berzins S.P. Turley S.J. von Boehmer H. Bronson R. Dierich A. Benoist C. Mathis D. Science. 2002; 298: 1395-1401Crossref PubMed Scopus (1867) Google Scholar, 11Ramsey C. Winqvist O. Puhakka L. Halonen M. Moro A. Kampe O. Eskelin P. Pelto-Huikko M. Peltonen L. Hum. Mol. Genet. 2002; 11: 397-409Crossref PubMed Scopus (390) Google Scholar). The role of AIRE in tolerance mechanisms led us to investigate the transcriptional regulation of the AIRE gene. Here we have characterized the human AIRE gene promoter structure identifying a minimal promoter and its transcriptional control elements. We describe the methylation status of the AIRE promoter in several cell lines and demonstrate the up-regulation of AIRE mRNA as a response to 5-aza-2′-deoxycytidine (5-azaCdR) and trichostatin A (TSA) treatments. Cell Culture—COS-7 cells were maintained in Dulbecco's modified Eagle's medium. HeLa and TEC 1A3 (human thymic epithelial cell line) cells were maintained in Eagle's minimum essential medium. Human monocytoid cell lines, THP-1 and U937, were cultured in RPMI 1640. Media was supplemented with 10% fetal calf serum and a 100 units/ml penicillin-streptomycin mixture (BioWhittaker, Europe). Isolation of AIRE Promoter—A 1.2-kb genomic fragment containing the 5′-end region of the AIRE gene was isolated by PCR amplification from human genomic DNA. Nucleotide sequences for primers are listed in Table I. The 5′-flanking region of AIRE promoter was subcloned into the pHIV-LTR-luc plasmid (Prof. Kalle Saksela, University of Tampere, Finland) encoding firefly luciferase reporter gene and named as pAP1235. The promoter region in the pAP1235 construct was verified by sequencing.Table IPrimer sequences used in this studyNameSequence (5′ → 3′)PurposeaEMSA, electrophoretic mobility shift assay; BS, bisulfite sequencingGR1/1FCGAGGCCAAGCGAGGGGCTGCCAGCloningGR1/1RGGACTATCCCTGGCTCACAGGGCCCloningPA1FTTTGCGGCCGCGAACACTCGTGCCCAGAGACCCloningPA2FTTTGCGGCCGCCCTGTCCAGGCCACAGCATCCCloningPA3FTTTGCGGCCGCTAGGGGCTCTCAGCTTGTGTGCloningPA4FTTTGCGGCCGCCACAGAGCGAGTCTCTGTCCCCloningPA5FTTTGCGGCCGCCCTCCATCACAGGGAAGTGTCCloningPA6FTTTGCGGCCGCGGAGCGGCCTTTGCTCTTTGCCloningPA1RTTTGGATCCGGGCGCGGGGACCCGGGGCTGCloningAIRE TATA boxGGTCGCGGGGGTCGAACAGCGGCGCGmutagenesisAIRE AP-1CTGGTGGGTGAGCAAGGCCAGGCCCGmutagenesisAIRE NF-YCTGGCCCTGATTAAGCGCCGGGGCGGAGmutagenesisAIRE Sp1GATTGGGCGCCGAAGCGAAGCGGCCTTTGCmutagenesisAIRE AP-1TGGTGGGTGAGTCAGGCCAGGCEMSAAIRE AP-1 mut.TGGTGGGAAAGTCAGGCCAGGCEMSAAP-1 consensusCGCTTGATGAGTCAGCCGGAAEMSAAIRE NF-YGAGGCCCTGGCCCTGATTGGGCGCCGEMSAAIRE NF-Y mut.GGCCCTGATTAAGCGCCGGGGCEMSANF-Y consensusGAGATTAACCAATCACGTACGGTEMSAAIRE Sp1GGCGCCGGGGCGGAGCGGCCTTEMSAAIRE Sp1 mut.GGCGCCGAAGCGAAGCGGCCTTEMSASp1 consensusATTCGATCGGGGCGGGGCGAGCEMSABITSA 1 fwdGGATAGGGTTATATTTGGAAGTGABSBITSA 1 revCTAACTCACAAAACCTAAAAACAABSBITSA 2 fwdTGTTTTTAGTTTTTAAGGTAGTTGBSBITSA 2 revTACAACAATAAAAAAACACTATCCBSa EMSA, electrophoretic mobility shift assay; BS, bisulfite sequencing Open table in a new tab Computer Analysis—Transcription factor binding sites were predicted by using the MatchTM program, which uses TRANSFAC 5.0 matrices (core similarity 1.0 and matrix similarity 0.9). The presence of CpG islands was analyzed with the EMBOSS program CpGplot using the algorithms of Gardiner-Garden and Frommer (12Gardiner-Garden M. Frommer M. J. Mol. Biol. 1987; 196: 261-282Crossref PubMed Scopus (2652) Google Scholar). According to this analysis, a CpG-rich region is defined as stretches of DNA in which both the moving average of percentage of G plus C nucleotides is greater than 50 and the moving average of observed/expected CpG is greater than 0.6. Construction of Deletion and Mutant Reporter Plasmids—The pAP1235 plasmid construct containing the 5′-flanking region was used as a template to synthesize a series of deletion reporter gene constructs. The forward and reverse primers containing NotI and BamHI restriction sites, respectively, were used in cloning of deletion constructs (Table I and Fig. 1). Site-directed mutagenesis of the pAP1235 construct was performed using the GeneEditor in vitro site-directed mutagenesis system (Promega). Mutations were introduced into putative DNA binding sites for the AP-1, NF-Y, and Sp1 transcription factors, as well as into the putative TATA box. Primer sequences used in site-directed mutagenesis are given below in Table I. All mutations were confirmed by DNA sequencing. Transient Transfections and Luciferase Reporter Assays—Cells (1.5 × 105) were transiently transfected with 2.5 μg of DNA (2 μg of luciferase reporter plasmid, 0.5 μg of β-galactosidase expression vector pEF-BOS (Prof. Kalle Saksela, University of Tampere, Finland)) using ExGen 500 transfection reagent (Fermentas) following the manufacturer's instructions. After 24 h, the cells were lysed to measure the luciferase activity using the Luciferase Assay System (Promega). The luciferase activities were normalized for transfection efficiency according to β-galactosidase activities. The transfections were performed in triplicate. Electrophoretic Mobility Gel Shift Assay—Nuclear extracts were made from HeLa and TEC1A3 cells with the variation of the method of Dignam et al. (13Dignam J.D. Martin P.L. Shastry B.S. Roeder R.G. Methods Enzymol. 1983; 101: 582-598Crossref PubMed Scopus (745) Google Scholar). Briefly, 3 × 107 cells were washed twice with ice-cold phosphate-buffered saline and resuspended in buffer A (20 mm HEPES, pH 7.9, 1.5 mm MgCl2, 10 mm KCl, 0.1 mm EDTA, 0.5 mm DTT, 0.5 mm phenylmethylsulfonyl fluoride, 1 μg/ml leupeptin, and 2 μg/ml aprotinin) and left on ice for 15 min. The lysates were passed several times through a 25-gauge needle. The nuclei were recovered by brief centrifugation at full speed and resuspended in buffer C (20 mm HEPES, pH 7.9, 1.5 mm MgCl2, 420 mm NaCl, 0.2 mm EDTA, 20% glycerol, 1 mm DTT, 1 μg/ml leupeptin, and 2 μg/ml aprotinin), followed by sonication and incubation on ice for 30 min. The reaction mix was centrifuged for 15 min at full speed, and the supernatant was collected and stored at -70 °C until use. Protein concentrations were determined using the Bio-Rad Dc protein assay (Bio-Rad Laboratories, Hercules, CA). The oligonucleotides used in EMSA are listed in Table I. Pre-binding of nuclear extract to poly(dI-dC) (Roche Applied Science) was carried out in a 10-μl reaction volume at 30 °C for 30 min in a buffer containing 10 mm Tris-HCl, pH 7.5, 25 mm NaCl, 0.5 mm DTT, 0.5 mm EDTA, 1 mm MgCl2, 4% glycerol, and 0.05 mg/ml poly(dI-dC)·poly(dI-dC). For competition experiments, unlabeled competing oligonucleotides at 100-fold molecular excess were included in preincubation mixture. For antibody supershift experiments, corresponding antibody (2 μg) was included in the preincubation mixture. Purified 32P-end-labeled, double-stranded oligonucleotide was then added to the reaction mix and incubated at 30 °C for 30 min. The reaction mixtures were subjected to native 4.5% polyacrylamide gel electrophoresis. Following the electrophoresis, the gel was dried and exposed for autoradiography (Kodak Biomax MS-1, Sigma). The Sp1 and AP-1 consensus oligonucleotides were purchased from Promega. The Sp1, pan-Jun, and pan-Fos antibodies were purchased from Santa Cruz Biotechnology. Anti-NF-YA and anti-NF-YB antibodies were a gift from Dr. Roberto Mantovani (University of Milano, Italy). In Vitro DNA Methylation—SssI methylase (New England BioLabs) was used to methylate AIRE promoter luciferase reporter construct pAP1235. Briefly, plasmid DNA was incubated with 1 unit of methylase per 1 μg of DNA in 50 mm NaCl, 10 mm Tris-HCl, 10 mm MgCl2, 1 mm DTT, pH 7.9, supplemented with 160 μmS-adenosylmethionine. Reactions were carried out at 37 °C overnight. The methylated plasmid DNA was purified through a Wizard DNA Clean-Up system (Promega) and transfected into TEC1A3 and COS-7 cells in parallel with the unmethylated pAP1235 construct. Genomic DNA Isolation—Genomic DNA was extracted from TEC1A3, HeLa, THP-1, and U937 cells according to Sambrook et al. (14Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Briefly, the genomic DNA was isolated by cell lysis with proteinase K (Promega) digestion and extraction with phenol/chloroform. After the precipitation, the genomic DNA was digested with restriction enzymes SmaI and SacI, separated on a 1.5% agarose gel with 1× TAE buffer (40 mm Tris-HCl, 1 mm EDTA, pH 8), blotted on nylon membrane, and hybridized with the radioactive probe corresponding to the genomic sequence (-568 to -195 bp). After hybridization and subsequent washing, the filters were exposed to autoradiography film. Sodium Bisulfite Genomic DNA Sequencing—Bisulfite genomic sequencing was performed as described previously (15Frommer M. McDonald L.E. Millar D.S. Collis C.M. Watt F. Grigg G.W. Molloy P.L. Paul C.L. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1827-1831Crossref PubMed Scopus (2515) Google Scholar, 16Grunau C. Clark S.J. Rosenthal A. Nucleic Acids Res. 2001; 29: e65-e77Crossref PubMed Scopus (583) Google Scholar). The genomic DNA (2 μg) was denatured in 0.3 m NaOH at 37 °C for 15 min. After the addition of 3 m sodium bisulfite (Sigma) and 10 mm hydroquinone (Sigma), samples were mixed, overlaid with mineral oil, and incubated at 50 °C for 16 h. The modified DNA was purified through the Wizard DNA Clean-Up system (Promega) and denatured by addition of 0.3 m NaOH at 37 °C for 15 min. The bisulfite-reacted DNA was precipitated and resuspended in 1 mm Tris-HCl, pH 8, and used immediately or stored at -20 °C. The sequence of interest in the bisulfite-reacted DNA was amplified by PCR in a reaction mixture containing 200 ng of DNA, 0.5 μm primers, 200 μm dNTPs, 1× buffer, 5% Me2SO, and 1 unit of Hercules polymerase (Stratagene). Each amplification reaction consisted of a 5-min incubation at 95 °C followed by 40 cycles of 1 min at 94 °C, 1 min at 56 °C, 1.5 min at 72 °C, and a final elongation step for 7 min at 72 °C. Primer sequences are listed in Table I. The modified DNA was further amplified by nested amplification, DNA fragments were gel-purified with a SephaglasTM Bandprep kit (Amersham Biosciences) and cloned into pCRII-TOPO vector (Invitrogen). Approximately 10 clones were sequenced per cell line. 5-AzaCdr and TSA Treatment—DNA methyltransferase inhibitor, 5-azaCdr, was added to cells at final concentrations from 0.2 to 15 μm for 72 h. Deacetylase inhibitor, TSA (100 ng/ml), was added for 24 h alone or at the end of the 5-azaCdr treatment, where indicated. Subsequently, cells were used for RNA isolation using the Total RNA Isolation system (Promega), and 3 μg of total RNA was converted to cDNA using the First-Strand cDNA Synthesis kit (Amersham Biosciences). Quantitative Real-time PCR—Real-time PCR was performed with the LightCycler instrument (Roche Applied Science) using a ready-to-use one-step QuantiTectTM SYBR® Green RT-PCR kit (Qiagen). Reactions were set up in 15 μl of final volume containing 2 μl of sample cDNA or standards, 0.5 μm primers, and 7.5 μl of 2× RT-PCR master mix. The amplification program for AIRE included an initial denaturation step at 95 °C for 15 min, followed by 55 cycles of denaturation at 94 °C for 15 s, annealing at 60 °C for 25 s, and extension at 72 °C for 20 s. SYBR® Green fluorescence was measured after each extension step. The specificity of amplification was subjected to melting curve analysis. The relative amount of the AIRE transcript was normalized to the amount of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript in each cDNA. The PCR conditions for GAPDH differed in that the annealing temperature was 58 °C and amplification consisted of 45 cycles. Cloned AIRE and GAPDH cDNAs were used as standards for quantification. Primer sequences to amplify the AIRE or GAPDH were as follows: AIRE-F, CCCTACTGTGTGTGGGTCCT; AIRE-R, ACGTCTCCTGAGCAGGATCT; GAPDH-F, CTGAGCTAGACGGGAAGCTC; and GAPDH-R, TCTGAGTGTGGCAGGGACT. Each of the PCR assays was run in triplicate, and the AIRE and GAPDH copy numbers were estimated from the threshold amplification cycle numbers using software supplied with the LightCycler thermal cycler. AIRE Proximal Promoter Contains Several Positive Regulatory Elements—We first isolated the human AIRE gene 5′-flanking region using PCR amplification of genomic DNA. The nucleotide sequence of the clone was found to be 100% identical with the genomic sequence in GenBankTM (accession number AB006684). The transcription initiation site, 128 bp upstream of the ATG codon, determined by rapid amplification of cDNA ends method, has been described earlier (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar). To demonstrate the activity of the AIRE promoter, the fragment was subsequently cloned in front of a luciferase reporter gene and transfected transiently into COS-7 and TEC1A3 cell lines. The luciferase activity with the pAP1235 reporter construct was 146- and 44-fold in COS-7 and TEC1A3 cells, respectively, compared with a promoterless control plasmid pBL-KS (Fig. 1), indicating cis-acting elements in the AIRE promoter region. To further map the regions responsible for transcriptional control we made deletion constructs of the pAP1235 plasmid from the 5′-end of the promoter fragment. Luciferase assays with the deletion constructs pAP940, pAP583, and pAP350 gave comparably similar activities in COS-7 cells, whereas the pAP248 construct resulted in significant decrease of the activity to 19% in COS-7 cells when compared with the pAP1235 construct. An even further decrease of the luciferase activity (to ∼3%) was seen with the pAP190 deletion construct. Essentially similar results were obtained using the TEC1A3 cell line. As a conclusion of deletion construct analysis, the results showed that the sequence elements required for the minimal AIRE promoter activity reside within the first 350 bp upstream of the translation start site. Characterization of Factors Binding to the Promoter—Analysis of the 350-bp promoter region with the MatchTM program indicated the presence of high score potential binding sites for transcription factor complexes such as a GC box (at position -202 to -188), an inverted CCAAT box (position -212 to -200), and a binding site for transcription factor AP-1 (position -307 to -296). To characterize the transcription factors that interact with putative binding sites in the AIRE promoter region, EMSA, coupled with supershift assays, was performed. A shifted band appeared with the AP-1 site double-stranded oligonucleotide (-313 to -291) as a probe (Fig. 2A). The complex disappeared by the addition of a 100-molar excess amount of the unlabeled probe but was not affected by addition of the same amount of unrelated oligonucleotide to the reaction mix as a competitor. The mutated oligonucleotide probe from the AP-1 site was unable to form the complex, further underlining the specificity of the AP-1 site. To further characterize the complex, we performed a supershift assay by using antibodies raised against pan-Jun and pan-Fos proteins. The shifted band that appeared with the AIRE AP-1 site was supershifted by the addition of pan-Jun antibody, however, not by pan-Fos antibody (Fig. 2A). Similar DNA-protein complexes and supershift results were observed in both cell lines. As a control probe, we used a previously described AP-1 consensus site in complex formation and supershift analysis (Fig. 2A). The relevance of the CCAAT box in AIRE gene regulation was determined with probes coding for the CCAAT box sequence. DNA-binding reactions showed a shifted protein-DNA complex, which was fully abolished by addition of a 100-fold molar excess of cold oligonucleotide (Fig. 2B). Only a CCAAT box-specific oligonucleotide inhibited the formation of complex, because the protein-DNA complex was not competed away by a nonspecific competitor as a probe. In contrast, as an indication of protein binding specificity, mutations introduced into the AIRE CCAAT box consensus sequence abolished protein-DNA complex formation. To identify whether the protein within the specific protein-DNA complex was in fact NF-Y, supershift assays were performed with antibodies against A and B subunits of the NF-Y transcription complex. Both anti-NF-YA and anti-NF-YB antibodies were able to supershift the protein-DNA complexes, resembling the supershifted complex obtained with the CCAAT consensus sequence (Fig. 2B). Furthermore, the importance of the GC box in the AIRE promoter was tested. The shifted complex obtained with the AIRE Sp1 probe was similar to the complex obtained with a control consensus Sp1 element (Fig. 2C). The complex disappeared with the addition of the unlabeled competitor but was not influenced by excess amount of unrelated oligonucleotide. The mutated AIRE Sp1 oligonucleotide used as probe resulted in no complex formation. The identity of the complex was further confirmed using an antibody specific for the Sp1 transcription factor. The Sp1 antibody was able to specifically interfere with the formation of the protein complex with the AIRE promoter element as well as with the consensus Sp1 element in supershift assays. Taken together, these results indicated that the AIRE promoter contains at least three specific regulatory elements, which form protein-DNA complexes with AP-1, NF-Y, and Sp1 transcription family members. Functional Analysis of TATA Box, AP-1, NF-Y, and Sp1 Regulatory Elements—In addition to the AP-1, NF-Y, and Sp1 regulatory elements, the AIRE promoter contains a TATA box located at the position 33 bp upstream of the transcriptional start site. To study the functional significance of the TATA box and transcriptional complexes in the AIRE promoter, mutations were introduced into the pAP1235 luciferase reporter construct using site-directed oligonucleotide mutagenesis and transfected into the COS-7 and TEC1A3 cell lines (Fig. 3). The mutations introduced into the TATA box decreased AIRE promoter activity to 48% in COS-7 and to 69% in TEC1A3 cells, respectively. Mutations in the CCAAT box reduced the promoter activity to 44% in COS-7 cells, compared with 78% in TEC1A3 cells. Nucleotide substitutions within the GC box resulted in 75% activity in COS-7 and 52% in TEC1A3 cells compared with the full-length pAP1235 construct. Similarly, mutations in the AP-1 binding site decreased the promoter activity to 18% in COS-7 and to 35% in TEC1A3 cells. Thus, the results of these experiments showed that the TATA box, the AP-1 binding site, the inverted CCAAT box, and the GC box are functional. Moreover, the factors binding to these sites are essential for the AIRE gene regulation. AIRE Promoter Contains CpG Island and the Activity Is Blocked by in Vitro Methylation—We noted that the region surrounding the AIRE proximal promoter is GC-rich. The CpG dinucleotide distribution within the 1.2-kb genomic fragment was statistically analyzed as described by the method of Gardiner-Garden and Frommer (12Gardiner-Garden M. Frommer M. J. Mol. Biol. 1987; 196: 261-282Crossref PubMed Scopus (2652) Google Scholar). Correspondingly, a 390-bp CpG island was located at the AIRE promoter region, starting from about 300 bp upstream of the translational start site and encompassing the first exon (Fig. 4A). The effect of in vitro methylation on the promoter of the AIRE gene was tested in a transient expression assay using the pAP1235 promoter construct. After methylation with SssI methylase, which methylates cytosines residues within CpG dinucleotide, the methylated and unmethylated reporter constructs were transfected into TEC1A3 cells and assayed for expression. As a result in vitro methylation completely suppressed AIRE promoter activity compared with the unmethylated promoter construct (Fig. 4B). Similar results were obtained with experiments using the COS-7 cell line (data not shown). AIRE Promoter Is Less Methylated in the Thymic Epithelial Cell Line—The methylation status of CpG sites in the AIRE promoter region was first studied in TEC1A3 and THP-1 cell line genomic DNA using the methyl-sensitive restriction enzyme SmaI inside of a methylation-insensitive SacI fragment spanning the AIRE promoter. Subsequent hybridization with the AIRE promoter-specific probe revealed uncleaved SacI fragments, suggesting methylated status of the SmaI sites (data not shown). The DNA from HeLa, TEC1A3, and from two monocyte cell lines, THP-1 and U937, was further analyzed by bisulfite genomic sequencing. Genomic DNA was treated with sodium bisulfite under conditions where cytosines are converted to uracils, while methylated cytosines remain unmodified. The promoter region contained 47 CpG sites, covering a 390-bp fragment of the AIRE promoter. All tested CpG sites showed a heavy methylation pattern in monocytic cell lines (THP-1 and U937 cells, Fig. 5). Results obtained from HeLa cells were consistent with the res" @default.
• W2012477137 created "2016-06-24" @default.
• W2012477137 creator A5033369123 @default.
• W2012477137 creator A5067888978 @default.
• W2012477137 creator A5072346042 @default.
• W2012477137 date "2003-05-01" @default.
• W2012477137 modified "2023-10-18" @default.
• W2012477137 title "Characterization of Regulatory Elements and Methylation Pattern of the Autoimmune Regulator (AIRE) Promoter" @default.
• W2012477137 cites W116460816 @default.
• W2012477137 cites W12952247 @default.
• W2012477137 cites W1484293540 @default.
• W2012477137 cites W1486257535 @default.
• W2012477137 cites W1507254050 @default.
• W2012477137 cites W1784857457 @default.
• W2012477137 cites W1968205037 @default.
• W2012477137 cites W1972894823 @default.
• W2012477137 cites W1979273476 @default.
• W2012477137 cites W2002495914 @default.
• W2012477137 cites W2024310422 @default.
• W2012477137 cites W2028222510 @default.
• W2012477137 cites W2036224418 @default.
• W2012477137 cites W2047147604 @default.
• W2012477137 cites W2051346727 @default.
• W2012477137 cites W2051974123 @default.
• W2012477137 cites W2083737302 @default.
• W2012477137 cites W2084748297 @default.
• W2012477137 cites W2092952537 @default.
• W2012477137 cites W2106850730 @default.
• W2012477137 cites W2125540086 @default.
• W2012477137 cites W2140235682 @default.
• W2012477137 cites W2150004911 @default.
• W2012477137 cites W2165214298 @default.
• W2012477137 cites W2170947255 @default.
• W2012477137 cites W2331919277 @default.
• W2012477137 doi "https://doi.org/10.1074/jbc.m210437200" @default.
• W2012477137 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12651856" @default.
• W2012477137 hasPublicationYear "2003" @default.
• W2012477137 type Work @default.
• W2012477137 sameAs 2012477137 @default.
• W2012477137 citedByCount "55" @default.
• W2012477137 countsByYear W20124771372012 @default.
• W2012477137 countsByYear W20124771372013 @default.
• W2012477137 countsByYear W20124771372014 @default.
• W2012477137 countsByYear W20124771372015 @default.
• W2012477137 countsByYear W20124771372016 @default.
• W2012477137 countsByYear W20124771372017 @default.
• W2012477137 countsByYear W20124771372018 @default.
• W2012477137 countsByYear W20124771372019 @default.
• W2012477137 countsByYear W20124771372020 @default.
• W2012477137 countsByYear W20124771372021 @default.
• W2012477137 countsByYear W20124771372022 @default.
• W2012477137 crossrefType "journal-article" @default.
• W2012477137 hasAuthorship W2012477137A5033369123 @default.
• W2012477137 hasAuthorship W2012477137A5067888978 @default.
• W2012477137 hasAuthorship W2012477137A5072346042 @default.
• W2012477137 hasBestOaLocation W20124771371 @default.
• W2012477137 hasConcept C104317684 @default.
• W2012477137 hasConcept C165864922 @default.
• W2012477137 hasConcept C171250308 @default.
• W2012477137 hasConcept C192562407 @default.
• W2012477137 hasConcept C21592294 @default.
• W2012477137 hasConcept C2776566471 @default.
• W2012477137 hasConcept C2780841128 @default.
• W2012477137 hasConcept C33288867 @default.
• W2012477137 hasConcept C54355233 @default.
• W2012477137 hasConcept C6929976 @default.
• W2012477137 hasConcept C70721500 @default.
• W2012477137 hasConcept C86339819 @default.
• W2012477137 hasConcept C86803240 @default.
• W2012477137 hasConceptScore W2012477137C104317684 @default.
• W2012477137 hasConceptScore W2012477137C165864922 @default.
• W2012477137 hasConceptScore W2012477137C171250308 @default.
• W2012477137 hasConceptScore W2012477137C192562407 @default.
• W2012477137 hasConceptScore W2012477137C21592294 @default.
• W2012477137 hasConceptScore W2012477137C2776566471 @default.
• W2012477137 hasConceptScore W2012477137C2780841128 @default.
• W2012477137 hasConceptScore W2012477137C33288867 @default.
• W2012477137 hasConceptScore W2012477137C54355233 @default.
• W2012477137 hasConceptScore W2012477137C6929976 @default.
• W2012477137 hasConceptScore W2012477137C70721500 @default.
• W2012477137 hasConceptScore W2012477137C86339819 @default.
• W2012477137 hasConceptScore W2012477137C86803240 @default.
• W2012477137 hasIssue "22" @default.
• W2012477137 hasLocation W20124771371 @default.
• W2012477137 hasOpenAccess W2012477137 @default.
• W2012477137 hasPrimaryLocation W20124771371 @default.
• W2012477137 hasRelatedWork W2011162723 @default.
• W2012477137 hasRelatedWork W2043947355 @default.
• W2012477137 hasRelatedWork W2147390330 @default.
• W2012477137 hasRelatedWork W2156844276 @default.
• W2012477137 hasRelatedWork W2224247558 @default.
• W2012477137 hasRelatedWork W2354064740 @default.
• W2012477137 hasRelatedWork W2389923937 @default.
• W2012477137 hasRelatedWork W2891689657 @default.
• W2012477137 hasRelatedWork W37321379 @default.
• W2012477137 hasRelatedWork W4313351508 @default.
• W2012477137 hasVolume "278" @default.
• W2012477137 isParatext "false" @default.

• next