FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012507842> ?p ?o ?g. }

• W2012507842 endingPage "10114" @default.
• W2012507842 startingPage "10104" @default.
• W2012507842 abstract "Glycolipids are mainly found in phototrophic organisms (like plants and cyanobacteria), in Gram-positive bacteria, and a few other bacterial phyla. Besides the function as bulk membrane lipids, they often play a role under phosphate deprivation as surrogates for phospholipids. The Gram-negative Agrobacterium tumefaciens accumulates four different glycolipids under phosphate deficiency, including digalactosyl diacylglycerol and glucosylgalactosyl diacylglycerol synthesized by a processive glycosyltransferase. The other two glycolipids have now been identified by mass spectrometry and nuclear magnetic resonance spectroscopy as monoglucosyl diacylglycerol and glucuronosyl diacylglycerol. These two lipids are synthesized by a single promiscuous glycosyltransferase encoded by the ORF atu2297, with UDP-glucose or UDP-glucuronic acid as sugar donors. The transfer of sugars differing in their chemistry is a novel feature not observed before for lipid glycosyltransferases. Furthermore, this enzyme is the first glucuronosyl diacylglycerol synthase isolated. Deletion mutants of Agrobacterium lacking monoglucosyl diacylglycerol and glucuronosyl diacylglycerol or all glycolipids are not impaired in growth or virulence during infection of tobacco leaf discs. Our data suggest that the four glycolipids and the nonphospholipid diacylglyceryl trimethylhomoserine can mutually replace each other during phosphate deprivation. This redundancy of different nonphospholipids may represent an adaptation mechanism to enhance the competitiveness in nature. Glycolipids are mainly found in phototrophic organisms (like plants and cyanobacteria), in Gram-positive bacteria, and a few other bacterial phyla. Besides the function as bulk membrane lipids, they often play a role under phosphate deprivation as surrogates for phospholipids. The Gram-negative Agrobacterium tumefaciens accumulates four different glycolipids under phosphate deficiency, including digalactosyl diacylglycerol and glucosylgalactosyl diacylglycerol synthesized by a processive glycosyltransferase. The other two glycolipids have now been identified by mass spectrometry and nuclear magnetic resonance spectroscopy as monoglucosyl diacylglycerol and glucuronosyl diacylglycerol. These two lipids are synthesized by a single promiscuous glycosyltransferase encoded by the ORF atu2297, with UDP-glucose or UDP-glucuronic acid as sugar donors. The transfer of sugars differing in their chemistry is a novel feature not observed before for lipid glycosyltransferases. Furthermore, this enzyme is the first glucuronosyl diacylglycerol synthase isolated. Deletion mutants of Agrobacterium lacking monoglucosyl diacylglycerol and glucuronosyl diacylglycerol or all glycolipids are not impaired in growth or virulence during infection of tobacco leaf discs. Our data suggest that the four glycolipids and the nonphospholipid diacylglyceryl trimethylhomoserine can mutually replace each other during phosphate deprivation. This redundancy of different nonphospholipids may represent an adaptation mechanism to enhance the competitiveness in nature. Although phospholipids are widespread constituents in biological membranes, the occurrence of glycolipids is mainly restricted to plants, cyanobacteria, Gram-positive bacteria, and a few other bacterial phyla (1.Hölzl G. Dörmann P. Structure and function of glycoglycerolipids in plants and bacteria.Prog. Lipid Res. 2007; 46: 225-243Crossref PubMed Scopus (196) Google Scholar). Glycolipids are characterized by a high headgroup diversity, which is determined by the number and type of sugars (glucose, galactose, mannose, or charged sugars like glucuronic acid or sulfoquinovose) with different anomeric configurations (α and β) and linkages to each other (1→2, 1→3, 1→4, and 1→6). In Gram-positive bacteria, glycolipids represent building blocks for membranes or serve as membrane anchors for lipoteichoic acids (1.Hölzl G. Dörmann P. Structure and function of glycoglycerolipids in plants and bacteria.Prog. Lipid Res. 2007; 46: 225-243Crossref PubMed Scopus (196) Google Scholar, 2.Reichmann N.T. Gründling A. Location, synthesis and function of glycolipids and polyglycerolphosphate lipoteichoic acid in Gram-positive bacteria of the phylum Firmicutes.FEMS Microbiol. Lett. 2011; 319: 97-105Crossref PubMed Scopus (131) Google Scholar). Glycolipids also play an important role in several members of Gram-negative bacteria (Proteobacteria) under phosphate deprivation, similar to plants and cyanobacteria, where they replace phospholipids to save phosphate required for the synthesis of phosphate-containing metabolites (1.Hölzl G. Dörmann P. Structure and function of glycoglycerolipids in plants and bacteria.Prog. Lipid Res. 2007; 46: 225-243Crossref PubMed Scopus (196) Google Scholar, 3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). Besides glycolipids, further phosphate-free lipids are often involved in this physiological stress response in bacteria (5.Geiger O. González-Silva N. López-Lara I.M. Sohlenkamp C. Amino acid-containing membrane lipids in bacteria.Prog. Lipid Res. 2010; 49: 46-60Crossref PubMed Scopus (105) Google Scholar). Two representatives of such nonphospholipids are diacylglyceryl trimethylhomoserine (DGTS) 2The abbreviations used are: DGTSdiacylglyceryl trimethylhomoserineOLornithine lipidSQDsulfoquinovosyl diacylglycerolDGDdigalactosyl diacylglycerolGGDglucosylgalactosyl diacylglycerolMGlcDmonoglucosyl diacylglycerolDGlcDdiglucosyl diacylglycerolalMGSMGlcD synthase from A. laidlawiiMGDmonogalactosyl diacylglycerolDAGdiacylglycerolUDP-GlcUAUDP-glucuronic acidUDP-GlcUDP-glucoseQ-TOF MSquadrupole-time-of-flight mass spectrometryGlcADglucuronosyl diacylglycerolPCphosphatidylcholineUDP-GalUDP-galactoseTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. or the glycerol-free ornithine lipid (OL). diacylglyceryl trimethylhomoserine ornithine lipid sulfoquinovosyl diacylglycerol digalactosyl diacylglycerol glucosylgalactosyl diacylglycerol monoglucosyl diacylglycerol diglucosyl diacylglycerol MGlcD synthase from A. laidlawii monogalactosyl diacylglycerol diacylglycerol UDP-glucuronic acid UDP-glucose quadrupole-time-of-flight mass spectrometry glucuronosyl diacylglycerol phosphatidylcholine UDP-galactose N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. These two lipids accumulate in different Proteobacteria, like in the nodule-forming bacterium Sinorhizobium meliloti (Rhizobiaceae and Rhizobiales) when grown under phosphate deprivation. Sinorhizobium further contains the charged glycolipid sulfoquinovosyl diacylglycerol (SQD), which is also increased under these conditions (6.Weissenmayer B. Geiger O. Benning C. Disruption of a gene essential for sulfoquinovosyldiacylglycerol biosynthesis in Sinorhizobium meliloti has no detectable effect on root nodule symbiosis.Mol. Plant Microbe Interact. 2000; 13: 666-672Crossref PubMed Scopus (25) Google Scholar). The plant pathogen Agrobacterium tumefaciens (Rhizobiaceae) or the nodule-forming bacterium Mesorhizobium loti (Phyllobacteriaceae and Rhizobiales) were recently shown to synthesize a series of further glycolipids grown under phosphate starvation, i.e. digalactosyl diacylglycerol (DGD), glucosylgalactosyl diacylglycerol (GGD), different triglycosyl diacylglycerols, with all sugars bound in β-anomeric configuration, and two unidentified glycolipids (U1 and U2) (3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). Irrespective of the high variety of bacterial glycolipids, only a few lipid glycosyltransferases have been cloned so far (1.Hölzl G. Dörmann P. Structure and function of glycoglycerolipids in plants and bacteria.Prog. Lipid Res. 2007; 46: 225-243Crossref PubMed Scopus (196) Google Scholar, 2.Reichmann N.T. Gründling A. Location, synthesis and function of glycolipids and polyglycerolphosphate lipoteichoic acid in Gram-positive bacteria of the phylum Firmicutes.FEMS Microbiol. Lett. 2011; 319: 97-105Crossref PubMed Scopus (131) Google Scholar). The best studied glycosyltransferases synthesizing monoglucosyl diacylglycerol (MGlcD) and diglucosyl diacylglycerol (DGlcD), with all sugars bound in α-anomeric configuration, were isolated from cell wall-less bacterium Acholeplasma laidlawii (7.Berg S. Edman M. Li L. Wikström M. Wieslander A. Sequence properties of the 1,2-diacylglycerol 3-glucosyltransferase from Acholeplasma laidlawii membranes. Recognition of a large group of lipid glycosyltransferases in eubacteria and archaea.J. Biol. Chem. 2001; 276: 22056-22063Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). The two enzymes MGlcD synthase (alMGS) and DGlcD synthase belong to the glycosyltransferase family 4 in the CAZy database (8.Cantarel B.L. Coutinho P.M. Rancurel C. Bernard T. Lombard V. Henrissat B. The carbohydrate-active EnZymes database (CAZy): an expert resource for glycogenomics.Nucleic Acids Res. 2009; 37: D233-D238Crossref PubMed Scopus (4111) Google Scholar). This database classifies glycosyltransferases into different families based on protein sequence similarities. Further glycosyltransferases belonging to glycosyltransferase family 4 are the MGlcD synthases from Deinococcus radiodurans and Thermotoga maritima and the monogalactosyl diacylglycerol (MGD) synthase from Borrelia burgdorferi, as the first cloned galactosyltransferase forming MGD with α-anomeric configuration of the sugar (9.Ostberg Y. Berg S. Comstedt P. Wieslander A. Bergström S. Functional analysis of a lipid galactosyltransferase synthesizing the major envelope lipid in the Lyme disease spirochete Borrelia burgdorferi.FEMS Microbiol. Lett. 2007; 272: 22-29Crossref PubMed Scopus (24) Google Scholar, 10.Hölzl G. Zähringer U. Warnecke D. Heinz E. Glycoengineering of cyanobacterial thylakoid membranes for future studies on the role of glycolipids in photosynthesis.Plant Cell Physiol. 2005; 46: 1766-1778Crossref PubMed Scopus (34) Google Scholar). The two glycosyltransferases synthesizing the agrobacterial or mesorhizobial glycolipids DGD, GGD, and triglycosyl diacylglycerols were characterized as processive glycosyltransferases, designated Pgt (3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). They transfer both glucose and galactose, with diacylglycerol (DAG) as primary acceptor. The two enzymes with high sequence similarity are members of GT21 (11.Hölzl G. Leipelt M. Ott C. Zähringer U. Lindner B. Warnecke D. Heinz E. Processive lipid galactosyl/glucosyltransferases from Agrobacterium tumefaciens and Mesorhizobium loti display multiple specificities.Glycobiology. 2005; 15: 874-886Crossref PubMed Scopus (33) Google Scholar). The identification and characterization of the enzyme(s) responsible for the synthesis of the two unknown glycolipids U1 and U2 in Agrobacterium and the elucidation of the glycolipid headgroup structures are part of this study. A. tumefaciens strain C58C1 (pGV2260) was grown at 28 °C in YEP medium in the presence of rifampicin (60 mg/liter) (4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). Gentamicin (25 mg/liter) was used for selection of the single mutant Δagt; gentamicin and kanamycin (50 mg/liter) were used for the selection of the double mutant Δagt Δpgt. Escherichia coli strains ElectroSHOX (Bioline) and BL21 (DE3) (Novagen) were used as expression hosts for atu2297. Growth curve experiments of Agrobacterium cells were performed as described (4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar) starting with an initial A600 of 0.05 in AB minimal medium (12.Schmidt-Eisenlohr H. Domke N. Angerer C. Wanner G. Zambryski P.C. Baron C. Vir proteins stabilize VirB5 and mediate its association with the T pilus of Agrobacterium tumefaciens.J. Bacteriol. 1999; 181: 7485-7492Crossref PubMed Google Scholar) with high (25 mm) or low (20 μm) phosphate. The A600 was determined for 96 h. Leaf disc transformation was performed with Agrobacterium wild type, Δagt, or Δagt Δpgt with each strain in a separate experiment, as described (4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). The ORF atu2297 was amplified using the primers bn799 (CCTAGGTATGACGAGAATCACGATTGTC) and bn800 (GGATCCTCATGCAAGCCGCGAGCGC) containing XmaJI and BamHI restriction sites (as underlined). The PCR product was subcloned in the pGEM-T Easy vector (Promega) and released with XmaJI/BamHI. The vector pTnVagro (11.Hölzl G. Leipelt M. Ott C. Zähringer U. Lindner B. Warnecke D. Heinz E. Processive lipid galactosyl/glucosyltransferases from Agrobacterium tumefaciens and Mesorhizobium loti display multiple specificities.Glycobiology. 2005; 15: 874-886Crossref PubMed Scopus (33) Google Scholar) was used as an expression vector, linearized with XmaJI and BamHI, and ligated with the released ORF atu2297 (pTnV-atu2297). The empty vector (pTnV) was created by blunting the linearized pTnVagro vector (with the Klenow fragment, Thermo Scientific) and subsequent circularization. The mutant line Δagt was generated using the Agrobacterium strain C58C1 (pGV2260). The primers used for the amplification of the homologous sequences were bn934 (TCATCGGCCATCATGGCGC) and bn935 (TATACCATGGTTGCCGCCATTGTGGAACCA) to generate the 5′-flankingsequence with a 3′-NcoI restriction site, whereas bn936 (ATATACGCGTCATTCTGGAAGCGCTGGCCAG) and bn937 (CGTTATCATCTCGCCATCACG) were used for the amplification of the 3′-flanking sequence with a 5′-MluI restriction site. The gentamicin resistance cassette was cloned as described (4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar), containing 5′-MluI and 3′-NcoI restriction sites. All PCR products were subcloned in pGEM-T easy vectors. MluI, NcoI, and other restriction sites on the cloning vectors were used for further cloning. The two flanking sequences and the gentamicin resistance cassette were cloned in one step in pGEM-T Easy with the gentamicin resistance cassette inserted in antisense orientation relative to the flanking sequences. The double knock-out mutant Δagt Δpgt was generated in the Δpgt background by disruption of the atu2297 locus by insertion of a kanamycin resistance cassette (4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar, 11.Hölzl G. Leipelt M. Ott C. Zähringer U. Lindner B. Warnecke D. Heinz E. Processive lipid galactosyl/glucosyltransferases from Agrobacterium tumefaciens and Mesorhizobium loti display multiple specificities.Glycobiology. 2005; 15: 874-886Crossref PubMed Scopus (33) Google Scholar). For this purpose, the gentamicin resistance cassette in the deletion construct described above was replaced with a kanamycin resistance cassette. The cloning strategy was similar with the exception of using a PscI restriction site instead of NcoI for cloning of the kanamycin resistance cassette. NcoI and PscI produce compatible ends. The primers used for amplification of the kanamycin resistance cassette were bn1116 (ATATACGCGTCACGCTGCCGCAAGCACTCA) and bn1149 (TCATGACATGTTCAGAAGAACTCGTCAAGAAG). The Δagt single mutant was identified by PCR using the following primer pairs: bn938 (TTGCCCGTTACGTCACCGGA) and bn939 (GCCTCAAATACAGGTCGAGAT); bn249 (AGTGGCTCTCTATACAAAGTTG) and bn938 (TTGCCCGTTACGTCACCGGA); and bn250 (TTCGGTCAAGGTTCTGGACC) and bn939 (GCCTCAAATACAGGTCGAGAT). The Δagt Δpgt double mutant was identified using the following primer pairs: bn938 (TTGCCCGTTACGTCACCGGA) and bn939 (GCCTCAAATACAGGTCGAGAT); bn224 (GCGGACTGGCTTTCTACGTG) and bn938 (TTGCCCGTTACGTCACCGGA) and bn225 (TGCTCGACGTTGTCACTGAAG) and bn939 (GCCTCAAATACAGGTCGAGAT). Lipids and fatty acids were analyzed as described (3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). The fragmentation energy for MGlcD/U1 and GlcAD/U2 analyzed with Q-TOF MS/MS was 12 and 20 V, respectively. The solvent used for one-dimensional TLC was acetone/toluene/water (91:30:8). For two-dimensional TLC, chloroform/methanol/water (65:25:4) was used for the first dimension and chloroform/methanol/acetic acid/water (90:15:10:4) for the second dimension. For NMR spectroscopy, glycolipids from Agrobacterium and E. coli expressing atu2297 were separated by preparative one-dimensional TLC. Purification of U2 from Agrobacterium required two steps because of co-migrating lipids. In the first step, total lipid extracts from Agrobacterium were separated on TLC plates pretreated with ammonium sulfate (0.15 m) and activated by heat (120 °C, 2.5 h) prior to use. In this system, U2 is protonated and migrates clearly above MGD (4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). U2 and co-migrating lipids were scraped off and extracted from the silica material with chloroform/methanol (2:1) in an ultrasonic bath for 30 min. The extracted lipid mixture was subjected to a second TLC step using nontreated plates to obtain pure U2 lipid, which migrates similar to DGD in this TLC system (this study). For enzyme assays, E. coli (ElectroSHOX) cells containing pTnV-atu2297 were grown at 37 °C to an A600 of 0.6, induced with 500 μm isopropyl 1-thio-β-d-galactopyranoside, and incubated for 24 h at 16 °C. The culture was harvested by centrifugation, and the pellet was resuspended in 1 ml of buffer 1 (11.Hölzl G. Leipelt M. Ott C. Zähringer U. Lindner B. Warnecke D. Heinz E. Processive lipid galactosyl/glucosyltransferases from Agrobacterium tumefaciens and Mesorhizobium loti display multiple specificities.Glycobiology. 2005; 15: 874-886Crossref PubMed Scopus (33) Google Scholar) and disrupted with glass beads with the Precellys homogenizer (Peqlab). Cell debris was removed by centrifugation at 70 × g for 1 min. The assays were performed in a final volume of 205 μl with 100 μl of buffer 2 (15 mm Tricine/KOH, pH 7.2, 30 mm MgCl2, 3 mm DTT), 50 μl of UDP-glucuronic acid (UDP-GlcUA) or UDP-glucose (UDP-Glc) (40 pmol/μl), 50 μl of E. coli protein extract, and 5 μl of DAG-14:0/14:0 (10 nmol/μl in ethanol). After incubation for 60 min at 28 °C, the assays were terminated by the addition of 3 ml of chloroform/methanol (2:1) and 0.5 ml of NaCl solution (0.9%). The lipids were extracted as described (3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar) and separated by TLC. MGD and DGD were used as reference lipids to identify the positions of MGlcD and GlcAD on the TLC plate. Corresponding bands were scraped off the silica plate and extracted for 30 min with chloroform/methanol (2:1) in an ultrasonic bath. The extracted reaction products were analyzed with the Q-TOF mass spectrometer (Agilent) by direct nanospray infusion in the positive mode as described (3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar) using fragmentation energies of 12 V for MGlcD and 20 V for GlcAD. To confirm the nature of hexose and hexuronic acid, samples were hydrolyzed with 2 m HCl/MeOH at 85 °C for 2 h, followed by acetylation (85 °C, 10 min) and detection by GC-MS (Hewlett-Packard HP 5890 (series II) gas chromatograph equipped with a fused silica SPB-5 column (Supelco, 30 m × 0.25 mm × 0.25-μm film thickness), flame ionization detector, and MS 5989A mass spectrometer with vacuum gauge controller 59827A). The temperature program was 150 °C for 3 min and then 5 °C/min to 330 °C. The sugars were identified by comparison with the authentic standards. The determination of the absolute configuration of the constituents was performed as described (13.Gerwig G.J. Kamerling J.P. Vliegenthart J.F. Determination of the absolute configuration of mono-saccharides in complex carbohydrates by capillary G.L.C.Carbohydr. Res. 1979; 77: 10-17Crossref PubMed Scopus (548) Google Scholar). NMR spectroscopy experiments were carried out in CDCl3 with tetramethylsilane (δH 0.00 and δC 0.00) as an internal standard. 1H,13C, and two-dimensional homonuclear (1H and 1H) COSY, TOCSY, and ROESY, as well as (1H and 13C) HSQC-DEPT, coupled HSQC, and HMBC experiments were recorded at 27 °C with a Bruker DRX Avance 700-MHz spectrometer (operating frequencies 700.75 MHz for 1H NMR and 176.2 MHz for 13C NMR), equipped with a 5-mm CPQCI multinuclear inverse cryo-probe head with a z gradient, and applying standard Bruker software. COSY, TOCSY, and ROESY experiments were recorded using data sets (t1 by t2) of 4096 by 512 points, COSY with 1 and TOCSY and ROESY with 8 scans. The TOCSY experiment was carried out in the phase-sensitive mode with mixing times of 60 ms and ROESY of 300 ms. Additionally, NMR spectra of U2 were carried out on a Bruker Avance AVIII 500 spectrometer equipped with a TCI cryoprobe. All spectra were measured in MeOD/CDCl3 (16.66/83.37%) at 27 °C. Double quantum-filtered COSY, TOCSY, and ROESY experiments were recorded using data sets (t1 by t2) of 2048 by 512 points, with 16 scans. The TOCSY experiment was carried out in the phase-sensitive mode with mixing times of 120 ms and ROESY of 300 ms. The presence of the unknown glycolipid U2 both in A. tumefaciens and M. loti (3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar) suggests the existence of glycosyltransferases with homologous sequences in the two organisms. For the identification, we first searched for annotated glycosyltransferase sequences for A. tumefaciens in the CAZy database (8.Cantarel B.L. Coutinho P.M. Rancurel C. Bernard T. Lombard V. Henrissat B. The carbohydrate-active EnZymes database (CAZy): an expert resource for glycogenomics.Nucleic Acids Res. 2009; 37: D233-D238Crossref PubMed Scopus (4111) Google Scholar). To restrict the number of genes, we selected only candidates with homologous sequences in Agrobacterium and Mesorhizobium. This search revealed 14 sequences, which were all cloned from Agrobacterium and expressed in E. coli ElectroSHOX or BL21 (DE3). Only one of the open reading frames (atu2297; glycosyltransferase family 4, containing α-glycosyltransferases) led to the accumulation of two new glycolipids in E. coli BL21 (DE3) migrating slightly above MGD or below DGD, respectively (Fig. 1A). Expression in E. coli ElectroSHOX led to the accumulation of only one glycolipid migrating slightly above MGD (data not shown). One explanation for the absence of the second glycolipid may be a reduced availability of the respective sugar donor in this E. coli strain. Compositional and structural analysis with NMR spectroscopy confirmed one of the lipids as MGlcD with α-d-configuration of the glucose (Fig. 1B). The α-configuration was confirmed by the 3J(1,2) value of 3.6 Hz measured from the 1H spectrum. Therefore, the ORF atu2297 codes for an α-glycosyltransferase (Agt) synthesizing MGlcD. The second glycolipid expressed in E. coli migrates similar to U2 from Agrobacterium and Mesorhizobium on TLC plates (3.Devers E.A. Wewer V. Dombrink I. Dörmann P. Hölzl G. A processive glycosyltransferase involved in glycolipid synthesis during phosphate deprivation in Mesorhizobium loti.J. Bacteriol. 2011; 193: 1377-1384Crossref PubMed Scopus (20) Google Scholar, 4.Geske T. Vom Dorp K. Dörmann P. Hölzl G. Accumulation of glycolipids and other non-phosphorous lipids in Agrobacterium tumefaciens grown under phosphate deprivation.Glycobiology. 2013; 23: 69-80Crossref PubMed Scopus (29) Google Scholar). It was further analyzed with Q-TOF MS/MS where it was detected as an ammonium adduct (in the positive ion mode), with one out of several main molecular species (Fig. 1C). The calculated m/z of the parental ion was 774.5727. The neutral loss of 211.0660 of the fragmented lipid indicates the loss of hexuronic acid as ammonia adduct representing the lipid headgroup. The different fragment ions in the spectrum are derived from DAG-16:0/17:0c (m/z 563.4999) and from monoacyl glyceryl-16:0 (m/z 313.2718) and −17:0c (m/z 325.2716). Therefore, this second glycolipid isolated from E. coli represents monohexuronosyl diacylglycerol. To reveal the structural details of the agrobacterial glycolipids U1 and U2, we separated them via two-dimensional TLC and analyzed the isolated lipids with Q-TOF MS/MS. This analysis does not allow distinguishing between different epimeric and anomeric configurations of the sugars. The fragmentation spectra of a main molecular species of each agrobacterial lipid are shown in Fig. 2. The neutral losses of 197.0905 and 211.0748 are derived from hexose and hexuronic acid, respectively, as ammonia adducts (Fig. 2). The fragment ion m/z 617.5498 (or 617.5448) was derived from DAG-18:1/19:0c, whereas the fragment ions 339.2873 (or 339.2854) and 353.3052 (or 353.3032) were derived from monoacylglycerol-18:1 and −19:0c, respectively. Therefore, U1 and U2 represent two glycerolipids containing hexose or hexuronic acid in their headgroups, respectively (Fig. 2). These results were confirmed further by GC analyses together with NMR spectroscopy that allowed determining the nature as well as absolute and anomeric configuration of the headgroups of the two lipids. U1 could be identified as MGlcD (Table 1) with α-d-Glcp, and U2 as GlcAD with α-d-GlcpA linked to DAG (Table 2). The 1JH1,C1 value of 172.26 Hz proved the α-configuration of U2.TABLE 11H and 13C chemical shifts of U1 identified as 1,2-diacyl-3-α-d-Glcp-sn-Gro reported (internal standard, tetramethylsilane)1a1b23a3b456a6bα-d-GlcpH (δ)4.85 (3J1,2 2.6 Hz)3.503.723.583.593.813.83C (δ)99.1372.1674.3070.0571.8561.84GroH (δ)4.394.155.243.813.60C (δ)62.4169.8566.35 Open table in a new tab TABLE 21H and 13C chemical shifts of 1,2-diacyl-3-α-d-GlcpA-sn-Gro (U2) reported (internal standard, tetramethylsilane, δH 0.00, δC 0.00)1a1b23a3b456a6bα-d-GlcpAH (δ)4.903.513.693.594.10C (δ)99.50 (1JH1, C1 173 Hz)71.6173.3171.8970.95172.26GroH (δ)4.434.185.253.883.68C (δ)62.4770.0366.78 Open table in a new tab The accumulation of MGlcD and of monohexosyl diacylglycerol in E. coli transformed with the ORF atu2297 suggests that the native function of Agt encoded by this ORF is the synthesis of MGlcD and/or GlcAD in Agro" @default.
• W2012507842 created "2016-06-24" @default.
• W2012507842 creator A5031242086 @default.
• W2012507842 creator A5054884012 @default.
• W2012507842 creator A5056192303 @default.
• W2012507842 creator A5067390711 @default.
• W2012507842 date "2014-04-01" @default.
• W2012507842 modified "2023-10-03" @default.
• W2012507842 title "A Bifunctional Glycosyltransferase from Agrobacterium tumefaciens Synthesizes Monoglucosyl and Glucuronosyl Diacylglycerol under Phosphate Deprivation" @default.
• W2012507842 cites W1513144982 @default.
• W2012507842 cites W1554915150 @default.
• W2012507842 cites W1589380598 @default.
• W2012507842 cites W1874562853 @default.
• W2012507842 cites W1916574382 @default.
• W2012507842 cites W1942502379 @default.
• W2012507842 cites W1976213625 @default.
• W2012507842 cites W1976261720 @default.
• W2012507842 cites W1978195377 @default.
• W2012507842 cites W1984116513 @default.
• W2012507842 cites W1984148743 @default.
• W2012507842 cites W1986506035 @default.
• W2012507842 cites W1989341459 @default.
• W2012507842 cites W1989771465 @default.
• W2012507842 cites W1993182189 @default.
• W2012507842 cites W1997670423 @default.
• W2012507842 cites W1999135505 @default.
• W2012507842 cites W2000326267 @default.
• W2012507842 cites W2000830920 @default.
• W2012507842 cites W2001443926 @default.
• W2012507842 cites W2021977049 @default.
• W2012507842 cites W2022640490 @default.
• W2012507842 cites W2026372424 @default.
• W2012507842 cites W2028801786 @default.
• W2012507842 cites W2042058497 @default.
• W2012507842 cites W2048129273 @default.
• W2012507842 cites W2053812068 @default.
• W2012507842 cites W2061450617 @default.
• W2012507842 cites W2065426487 @default.
• W2012507842 cites W2070918603 @default.
• W2012507842 cites W2076438629 @default.
• W2012507842 cites W2089996664 @default.
• W2012507842 cites W2091799957 @default.
• W2012507842 cites W2092828220 @default.
• W2012507842 cites W2099927731 @default.
• W2012507842 cites W2103932848 @default.
• W2012507842 cites W2108929776 @default.
• W2012507842 cites W2117386882 @default.
• W2012507842 cites W2119101470 @default.
• W2012507842 cites W2120615761 @default.
• W2012507842 cites W2127050034 @default.
• W2012507842 cites W2128431439 @default.
• W2012507842 cites W2135950677 @default.
• W2012507842 cites W2137702329 @default.
• W2012507842 cites W2138694265 @default.
• W2012507842 cites W2141775316 @default.
• W2012507842 cites W2144039369 @default.
• W2012507842 cites W2144222183 @default.
• W2012507842 cites W2146900658 @default.
• W2012507842 cites W2150976173 @default.
• W2012507842 cites W2155745520 @default.
• W2012507842 cites W2156132940 @default.
• W2012507842 cites W2158521587 @default.
• W2012507842 cites W2159509595 @default.
• W2012507842 cites W2162673043 @default.
• W2012507842 cites W2223974765 @default.
• W2012507842 cites W2345332988 @default.
• W2012507842 doi "https://doi.org/10.1074/jbc.m113.519298" @default.
• W2012507842 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3974981" @default.
• W2012507842 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/24558041" @default.
• W2012507842 hasPublicationYear "2014" @default.
• W2012507842 type Work @default.
• W2012507842 sameAs 2012507842 @default.
• W2012507842 citedByCount "25" @default.
• W2012507842 countsByYear W20125078422014 @default.
• W2012507842 countsByYear W20125078422015 @default.
• W2012507842 countsByYear W20125078422016 @default.
• W2012507842 countsByYear W20125078422017 @default.
• W2012507842 countsByYear W20125078422018 @default.
• W2012507842 countsByYear W20125078422019 @default.
• W2012507842 countsByYear W20125078422020 @default.
• W2012507842 countsByYear W20125078422021 @default.
• W2012507842 countsByYear W20125078422022 @default.
• W2012507842 countsByYear W20125078422023 @default.
• W2012507842 crossrefType "journal-article" @default.
• W2012507842 hasAuthorship W2012507842A5031242086 @default.
• W2012507842 hasAuthorship W2012507842A5054884012 @default.
• W2012507842 hasAuthorship W2012507842A5056192303 @default.
• W2012507842 hasAuthorship W2012507842A5067390711 @default.
• W2012507842 hasBestOaLocation W20125078421 @default.
• W2012507842 hasConcept C104317684 @default.
• W2012507842 hasConcept C181199279 @default.
• W2012507842 hasConcept C195794163 @default.
• W2012507842 hasConcept C204241405 @default.
• W2012507842 hasConcept C2776162087 @default.
• W2012507842 hasConcept C2779656422 @default.
• W2012507842 hasConcept C36020004 @default.
• W2012507842 hasConcept C55493867 @default.
• W2012507842 hasConcept C86803240 @default.

• next