FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012593791> ?p ?o ?g. }

• W2012593791 endingPage "19303" @default.
• W2012593791 startingPage "19295" @default.
• W2012593791 abstract "We are investigating the folding of the 81-residue recombinant dimeric DNA binding domain of the E2 protein from human papillomavirus and how it is coupled to the binding of its DNA ligand. Modifications in buffer composition, such as ionic strength and phosphate, cause an ∼5.0 kcal mol−1stabilization of the domain to urea unfolding, based on very similar conformational changes as measured by far UV circular dichroism. Binding of DNA produces an even greater stabilization, magnitude similar to that caused by the nonspecific polymer ligand heparin, which shifts the urea midpoint 2.5-fold. The DNA-bound complex displays substantial changes similar to those caused by ionic strength and phosphate in terms of overall secondary structure. Bis-8-anilino-1-naphthalenesulfonate provides a very sensitive conformational probe, which shows alterations in the domain caused by the above mentioned compounds. In general terms, binding of DNA involves an overall conformational readjustment in the protein but maintains the β-barrel scaffold intact. This conformational plasticity seems to be of importance in the regulatory functions of this type of DNA-binding protein. The extremely long half-life of the E2-DNA complex, together with its very high stability, suggests that, in the absence of other factors that may affect its stability in vivo, the possibility of dissociation once formed is restricted. We are investigating the folding of the 81-residue recombinant dimeric DNA binding domain of the E2 protein from human papillomavirus and how it is coupled to the binding of its DNA ligand. Modifications in buffer composition, such as ionic strength and phosphate, cause an ∼5.0 kcal mol−1stabilization of the domain to urea unfolding, based on very similar conformational changes as measured by far UV circular dichroism. Binding of DNA produces an even greater stabilization, magnitude similar to that caused by the nonspecific polymer ligand heparin, which shifts the urea midpoint 2.5-fold. The DNA-bound complex displays substantial changes similar to those caused by ionic strength and phosphate in terms of overall secondary structure. Bis-8-anilino-1-naphthalenesulfonate provides a very sensitive conformational probe, which shows alterations in the domain caused by the above mentioned compounds. In general terms, binding of DNA involves an overall conformational readjustment in the protein but maintains the β-barrel scaffold intact. This conformational plasticity seems to be of importance in the regulatory functions of this type of DNA-binding protein. The extremely long half-life of the E2-DNA complex, together with its very high stability, suggests that, in the absence of other factors that may affect its stability in vivo, the possibility of dissociation once formed is restricted. Molecular interaction between proteins and DNA play a central role in the regulation of gene function in the biological world. DNA-binding proteins interact with specific target sequences in the DNA, and the basis for the recognition process at the molecular level has been the focus of intense research (1von Hippel P.H. Science. 1994; 263: 769-770Crossref PubMed Scopus (130) Google Scholar). Often, the interaction leads to substantial changes in the conformation of both the nucleic acid and the protein, compared with their free forms, with direct implications for their function (2Weiss M.A. Ellenberger T. Wobbe C.R. Lee J.P. Harrison S.C. Struhl K. Nature. 1990; 347: 575-578Crossref PubMed Scopus (338) Google Scholar, 3Petersen J.M. Skalicky J.J. Donaldson L.W. McIntosh L.P. Alber T. Graves B.J. Science. 1995; 269: 1866-1869Crossref PubMed Scopus (174) Google Scholar, 4Spronk C.A. Slijper M. van Broom J.H. Kaptein R. Boelens R. Nat. Struct. Biol. 1996; 3: 916-919Crossref PubMed Scopus (77) Google Scholar). The formation of a protein-DNA complex yields a new and different thermodynamic and structural entity; both processes, DNA binding and conformational changes in the free forms of both macromolecular partners, are highly coupled. This is more dramatic in the case of dimeric transcription factors with intertwined folding topologies such that their dissociated monomers are unfolded, and the process of folding and association and DNA binding are tightly linked (5Brown B.M. Bowie J.U. Sauer R.T. Biochemistry. 1990; 29: 11189-11195Crossref PubMed Scopus (58) Google Scholar, 6Harrison S.C. Aggarwal A.K. Annu. Rev. Biochem. 1990; 59: 933-969Crossref PubMed Scopus (494) Google Scholar, 7Pabo C.O. Sauer R.T. Annu. Rev. Biochem. 1992; 61: 1053-1095Crossref PubMed Scopus (1232) Google Scholar). Thus, DNA-binding domains may undergo local and global folding processes upon binding to their operator sequences. The E2 transcriptional activator of the human papillomavirus regulates the expression of most viral transcripts and participates in the DNA replication process. The protein consists of a C-terminal DNA-binding and dimerization domain (E2-DBD) 1The abbreviations used are: E2-DBD, E2 DNA binding domain; bis-ANS, bis-8-anilino-1-naphthalenesulfonate; HPV, human papillomavirus; BPV, bovine papillomavirus; Bis-Tris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)-propane-1,3-diol. and an N-terminal transactivation domain, separated by a flexible region (8McBride A.A. Romanczuk H. Howley P.M. J. Biol. Chem. 1991; 266: 18411-18414Abstract Full Text PDF PubMed Google Scholar). The E2-DBD is an ∼80-residue per monomer domain that can be overexpressed recombinantly in bacteria as a stable and soluble dimer (9Sanders C.M. Maitland N.J. Nucleic Acids Res. 1994; 22: 4890-4897Crossref PubMed Scopus (36) Google Scholar, 10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). Its biological importance is shown by the three forms of the protein produced by alternative splicing: the full-length protein (E2-TA), which acts as a transcriptional activator, and two shorter forms (E2-TR and E2/E8) produced from alternative splicing, acting as repressors (11Howley P.M. Fields B.N. Knipe D.M. Howley P.M. Papillomaviridae: The Viruses and Their Replication. Lippincott-Raven Press, Philadelphia1996: 2045-2076Google Scholar). All forms have in common the entire C-terminal DNA binding domain. The structure of a homologous E2-DBD from the bovine papillomavirus (BPV-1) bound to its DNA target was determined by x-ray crystallography and established a new folding topology, the dimeric β-barrel (12Hegde R.S. Grossman S.R. Laimins L.A. Sigler P.B. Nature. 1992; 359: 505-512Crossref PubMed Scopus (329) Google Scholar). This particular fold is shared by the EBNA1 protein from the Epstein-Barr virus, the crystallographic structures of free and DNA-bound forms were recently described (13Bochkarev A. Barwell J.A. Pfuetzner R.A. Furey W. Edwards A.M. Frappier L. Cell. 1995; 83: 39-46Abstract Full Text PDF PubMed Scopus (130) Google Scholar, 14Bochkarev A. Barwell J.A Pfuetzner R. Bochkareva A.E. Frappier L. Edwards A.M. Cell. 1996; 84: 791-800Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). The NMR solution structure of the highly homologous HPV E2-DBD (strain 31) domain free in solution showed a complete conservation of the overall fold of the BPV protein (15Liang H. Petros A.M. Meadows R.P. Yoon H.S. Egan D. Walter A.K. Holzman T.F. Robins T. Fesik S.W. Biochemistry. 1996; 35: 2095-2103Crossref PubMed Scopus (59) Google Scholar). The HPV-16 E2-DBD was shown to undergo a concomitant dissociation and unfolding following an apparent two-state model, with folded dimers or unfolded monomers, and no intermediates accumulated (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). A highly populated transient intermediate was found on its kinetic folding pathway, possibly of non-native characteristics (16Mok Y.-K. Bycroft M. Prat-Gay G.de Nat. Struct. Biol. 1996; 3: 711-717Crossref PubMed Scopus (33) Google Scholar). To approach the problem of coupling between folding and DNA binding processes, in the present work we tackle the analysis of the effect of an oligonucleotide comprising its DNA target and other ligand, such as heparin, on the stability and conformation of the domain. We evaluate the effect of ionic strength and phosphate anions and discuss the relationship between conformational changes and stabilization in the effectors studied. For the analysis of stability and conformation we use fluorescence and circular dichroism spectroscopy, and we probe conformational changes making use of the hydrophobic dye bis-ANS. All reagents and buffers used were of maximal purity available. Water was twice distilled and deionized prior to use. Urea and heparin were purchased from Sigma and bis-ANS from Molecular Probes (Eugene, OR). The recombinant E2-DBD from HPV-16 was overexpressed and purified as described previously (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). The protein concentration was measured using the extinction coefficient of 41,900m−1 cm−1, determined from model compounds (17Pace C.N. Vajdos F. Fee L. Grimsley G. Gray T. Protein Sci. 1995; 4: 2411-2423Crossref PubMed Scopus (3472) Google Scholar), in very good agreement with the colorimetric method that we used in previous work (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). We used a synthetic highly palindromic oligonucleotide of 36 base pairs with the following consensus sequence: 5′ TTTGTAGCTTCAACCGAATTCGGTTGCATGCT TTTT 3′, and the complementary strand (recognition sequence is underlined). Extra bases were included at each side of the consensus sequence to stabilize it further. For the annealing, we mixed equimolar concentrations of the complementary strands in 10 mmTris-HCl, pH 7.8, heated at 90 °C for 10 min, and cooled slowly to ∼30 °C. As a source of soluble heparin, we used the porcine intestinal mucosa glycosaminoglycan (M r∼3,000). We made a concentrated stock solution in water and used it for the experiments. Fluorescence spectra were obtained with a Hitachi F4500 spectrofluorometer. For high quality spectra, we accumulated 10 spectra using the software provided by the manufacturer. These spectra were used for the derivative analysis, unsmoothed data were derived successively (stepwise) up to the fourth derivative. In all cases, the buffer plus added compound base line was subtracted, and the temperature was tightly controlled at 25 °C. The base-line subtraction minimizes the contribution of the Raman peak, which nevertheless occurs below 320 nm, out of the range of the analysis of our spectra. Excitation wavelength was at 280 nm, and the emission spectrum was recorded from 300 to 450 nm. Urea equilibrium denaturation was carried out in 50 mmBis-Tris, pH 7.0, and 1 mm dithiothreitol unless otherwise stated. The temperature in all experiments was 25 °C, and protein/denaturant solutions were pre-equilibrated at that temperature for 2 h before measurements. In these experiments, fluorescence spectra were recorded on an ISS K2 spectrofluorometer (Champaign, IL) with an excitation wavelength of 280 nm and emission scanned from 300 to 450 nm. The fluorescence spectra at urea concentration “u” were quantified by specifying the center of spectral mass <νu> (Equation 1),〈vu〉−ΣviFi/ΣFiEquation 1 where F i indicates the fluorescence emitted at wave number ν i, and the summation is carried out over the range of appreciable values of F. We observed that following fluorescence intensity at a fixed point is extremely sensitive to small changes in temperature, pH, or ionic strength, most likely due to an exposed tryptophan (Trp-56) in E2-DBD, located facing the solvent in the minor α-helix (Fig. 1). Since we want to compare different conditions, in the present work we follow the center of spectral mass that will report only changes on the environment of the two tryptophan residues located at the center of the barrel, which constitutes the dimeric interface. In this manner, we eliminate changes in fluorescence quantum yield at small changes in denaturant concentration, ionic strength, or temperature. The quantum yield of E2-DBD is increased by 30% at urea concentrations lower than 0.2 m (not shown); however, the center of mass is not affected. This takes place in a range in which there is no major unfolding, and it is most likely due to the exposed Trp residue. The unfolding parameters obtained using the center of mass are in excellent agreement with those previously obtained (see bottom of Table I). The analysis of the unfolding curves was carried out using a two-state model that considers protein concentration and was described previously in detail (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). The ΔG values obtained correspond to standard free energy changes.Table IEffect of salt, phosphate, heparin, and DNA on the fluorescence spectra and conformational stability of E2-DBDSpectral areaλmaxDifference in center of mass[Urea]50%ΔG unlm%nmcm −1mkcal mol −1m −1 kcal mol −1Buffer10034702.212.5 ± 0.72.0 ± 0.3NaCl86347144.917.5 ± 0.81.9 ± 0.2Phosphate93347194.316.9 ± 0.62.0 ± 0.1Heparin104345477.2DNA oligonucleotide82345777.0 Open table in a new tab CD spectra were obtained with a Jasco J-710 spectropolarimeter, using a 0.1-cm path length quartz cuvette. Spectra were the average of 5 scans at a 50 nm/min speed, and the buffer base lines were subtracted. Only the far UV region from 200 to 260 nm was analyzed, due to increased noise at shorter wavelengths. Bis-ANS binding was performed at 25 °C in 50 mm Bis-Tris, pH 7.0, and 1 mmdithiothreitol unless otherwise stated. Fluorescence measurements were recorded on a Hitachi F-4500 spectrofluorometer. The excitation wavelength was set at 360 nm, and the emission was measured from 400 to 600 nm. The titrations were performed by adding small amounts of a concentrated solution of bis-ANS to a fixed amount of E2-DBD and allowed to equilibrate for 5 min prior to the measurements. There were no time-dependent changes in fluorescence spectra between 5 and 60 min. The same procedure was applied when titrating with increasing concentrations of protein. In all cases, maximal dilution was 10%, and the data were corrected accordingly. Maximum emission wavelengths were calculated from the first derivative of the spectra. The structure of the first described E2-DBD from BPV-1 consists of a dimeric 8-stranded β-barrel with 4 strands of each monomer forming the interface, and two α-helices making cross-over contacts on the outside of the barrel (12Hegde R.S. Grossman S.R. Laimins L.A. Sigler P.B. Nature. 1992; 359: 505-512Crossref PubMed Scopus (329) Google Scholar). The majority of the two helices in E2-DBD is the portion of the protein that binds the palindromic DNA target ACCG-N4-CGGT (Fig. 1). The solution structure of the highly homologous E2-DBD of HPV-31 shows an identical topology to the bovine virus protein (15Liang H. Petros A.M. Meadows R.P. Yoon H.S. Egan D. Walter A.K. Holzman T.F. Robins T. Fesik S.W. Biochemistry. 1996; 35: 2095-2103Crossref PubMed Scopus (59) Google Scholar). The outer strands of the monomers are connected by a hydrogen bonding network, and many hydrophobic side chains protrude to the interior of the barrel. In HPV-16 E2-DBD, as in HPV-31, two tryptophan residues separated by a histidine (residues 34–36) are stacked and interacting, and face inward in the central cavity of the barrel (15Liang H. Petros A.M. Meadows R.P. Yoon H.S. Egan D. Walter A.K. Holzman T.F. Robins T. Fesik S.W. Biochemistry. 1996; 35: 2095-2103Crossref PubMed Scopus (59) Google Scholar), and are most likely responsible for the fluorescence changes that take place upon denaturation/dissociation. Another tryptophan residue is located in the minor helix, facing the solvent. The amino acid sequence of E2-DBD from HPV-16 is 80% homologous to the HPV-31 domain. Tryptophan fluorescence was used as a first approach to investigate conformational changes and stability of the E2 domain. The fluorescence spectrum of E2-DBD at pH 7.0 without any addition is shown in Fig. 2 a (inset). We are interested in the study of the effect of compounds such as ionic strength, phosphate, heparin, and the specific DNA oligonucleotide on the conformation and stability of E2-DBD. Among other parameters in the cellular environment, ionic strength may affect the proteins that bind DNA, since these often present a large number of positively charged residues exposed to the solvent. Modifications in ionic strength also constitute a tool to investigate the contribution of the types of interactions that stabilize specific local or global conformations of a particular protein fold. We analyzed the effect of NaCl on the fluorescence spectra of folded E2-DBD. There is a small decrease in the area of the spectrum, but the center of spectral mass and the wavelength maximum remain virtually unchanged (Table I). This suggests that if there was a significant conformational change it does not seem to involve the exposure of the Trp residues of the interface to the solvent and, therefore, no disruption of the dimeric interface or major unfolding. Upon addition of phosphate anion, the fluorescence spectrum shows a minimal change in spectral area, with no apparent changes on its center of spectral mass or wavelength maximum (Table I). The interaction of the E2-DBD with its DNA target and the changes induced are crucial for understanding the basis of the molecular mechanism for the action of this transcription factor. For this purpose, a synthetic oligonucleotide containing a consensus binding site was incubated with the domain, and a 20% change in the fluorescence spectral area and a small blue shift was observed (TableI). Any significant conformational change does not seem to involve major changes in the tryptophan residues at the interior of the domain. The glycosaminoglycan heparin is a heteropolymer composed of amino sugar disaccharide units. These type of polymers are highly negatively charged due to the presence of either carboxyl or sulfate groups on the sugar units, which repel each other and cause the polymer to adopt extended conformations. Immobilized heparin is frequently used as the method of choice for purification of nucleic acid binding proteins. In the case of E2-DBD, the protein binds to the heparin-modified matrix and is released only with concentrations higher than 1 msalt (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). This prompted us to study the binding of soluble heparin and to analyze possible effects on the conformation and stability of the folded dimer. Adding heparin to folded E2-DBD led to a 2-nm blue shift in the fluorescence spectra, with no change in the fluorescence intensity. The possibility to obtain high quality fluorescence spectra allows us to approach a derivative analysis to discriminate different contributions in the spectrum, extending the sensitivity of the technique. A discrete number of bands can be resolved by this procedure, which originates in the transitions of electrons from the excited singlet state returning to different vibrational levels in the ground state (18Butler W.L. Methods Enzymol. 1979; 56: 501-515Crossref PubMed Scopus (68) Google Scholar, 19Plotkin B.J. Sherman W.V. Biochemistry. 1984; 23: 5353-5360Crossref PubMed Scopus (18) Google Scholar). Using N-acetyl tryptophanamide as a model compound, three sharp bands were observed in the fourth derivative, at 326, 346, and 364 nm, respectively (20Restall C.J. Coke M. Phillips E. Chapman D. Biochim. Biophys. Acta. 1986; 874: 305-311Crossref PubMed Scopus (18) Google Scholar). In that study it was shown that the shift in emission maximum with change in the polarity of the environment is the result of changes in the relative contribution of these bands. The fourth derivative of the fluorescence spectrum of folded E2-DBD is shown in Fig. 2 a; the bands are broader than model compounds, and this is due to the different tryptophan residues present whose contributions overlap. Two distinctive wavelength maxima are observed at 332 and 342 nm and a third one at 365 nm. Addition of NaCl and phosphate produced a similar effect, an increase in the band at 332 nm and a decrease at 342 nm (Fig. 2 b). Addition of heparin shows a large increase at 342 nm and a decrease at 332 nm (Fig. 2 c). The band at 365 nm does not change in most conditions tested. The E2-DBD·DNA complex shows very little change in the intensity of the peaks, but a small red shift in the 342 nm peak is observed. The band at 365 nm changes slightly, and a small band around 375 nm is also evident in the complex. However, it is not possible to assign these marginal changes to alterations in the conformation at this stage. The E2-DBD from human papillomavirus strain 16 showed concerted denaturation and dissociation processes induced by urea (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). We intend to compare the stability of E2-DBD to urea unfolding with addition of salts, phosphate, or its DNA ligand in similar conditions of pH. Fig. 3 shows a urea unfolding curve at pH 7.0 in which changes in the center of spectral mass are followed (see “Experimental Procedures”). The change in the center of mass upon complete unfolding is ∼800 cm−1, corresponding to a ∼10-nm red shift. The inset of Fig. 3 shows the fluorescence spectra of folded and urea unfolded E2 domain, to illustrate the total change. For the analysis of the effect of ionic strength on the stability of the domain, we chose the urea concentration that causes near 100% unfolding of E2-DBD (Fig. 3). At 3.0 m denaturant, increasing the salt concentration generates a change in the center of spectral mass, indicative of a recovery of the folded conformation (∼29,000 cm−1). Fig. 4 a shows that the maximal recovery takes place between 0.5 and 1.0 mNaCl, similar concentrations have a negligible effect on the center of spectral mass of the folded conformation (Table I). Since the binding site of E2-DBD and other DNA-binding proteins contains a large proportion of positively charged residues, and being DNA a polyphosphate polymer, we wanted to test the effect of phosphate on the conformation and stabilization of the native fold. In Fig.4 b, following the procedure of addition of increasing amounts of the anion to unfolded E2-DBD in 3.0 m urea, we observed a recovery of the spectral properties of the folded conformation, indicating a stabilization with a maximal effect at concentrations higher than 50 mm phosphate. To estimate the stabilization effect of salts and phosphate we carried out urea denaturation experiments, and the stabilization observed is quite pronounced (Fig. 5). Using a two-state approach as described previously, we obtained a ΔG unf, the free energy change on unfolding, of 17.5 and 16.9 kcal mol−1 for NaCl and phosphate (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). This corresponds to a stabilization (ΔΔG unf) of 5.0 and 4.5 kcal mol−1 for the same compounds. The [U]50%, the urea midpoint, was 4.9 m for NaCl and 4.3 mfor phosphate, and the m values, the parameter that measures the cooperativity of the transition, agree very well with the E2-DBD in buffer only (Table I), suggesting that the mechanism of unfolding at equilibrium is not altered. Effects of DNA on the stability were evaluated by adding increasing concentrations of the oligonucleotide to urea unfolded E2-DBD. Similar to what occurs in the presence of NaCl and phosphate, the DNA is able to fully recover the center of mass of the fluorescence spectrum of the domain, indicative of a folded conformation (Fig. 4 c). When unfolded E2-DBD (in 3.0 m urea) was titrated with increasing concentrations of heparin, the center of spectral mass showed a recovery to values corresponding to the tryptophan probes in the folded conformation as in the case of DNA, phosphate, and NaCl (Fig. 4 d). The effect of DNA and heparin on the stability of the E2 domain can be best quantified in urea unfolding experiments, in comparison with the free E2-DBD. Fig. 5 shows the large stabilization caused by both polymer ligands to a similar extent. The [U]50% was determined to be 7.0 m for DNA and 7.2 m for heparin. A detailed mathematical analysis for calculating free energies is not possible since there are several equilibria involved. If we were to assume the unfolding E2-DBD as the only event, we could approximate the analysis to a two-state model and use a linear relationship between [U]50% and ΔG unf. The stabilization (ΔΔG unf) caused by DNA and heparin would, therefore, be ∼9.0 kcal mol−1. This is only useful for a gross estimation of the otherwise obvious stabilizing effect. The far UV CD spectrum of E2-DBD showed two minima at 210 and 224 nm and a maximum at 195 nm, all corresponding to α-helix contribution (10Mok Y.-K. Prat Gay G.de Butler P.J. Bycroft M. Protein Sci. 1996; 5: 310-319Crossref PubMed Scopus (90) Google Scholar). As previously pointed out, the ellipticity minima differ slightly from those observed in most α-helices (208 and 222 nm); a high β-sheet content may influence the spectra and also the fact that the major helix may not be fully formed in the free domain in solution (15Liang H. Petros A.M. Meadows R.P. Yoon H.S. Egan D. Walter A.K. Holzman T.F. Robins T. Fesik S.W. Biochemistry. 1996; 35: 2095-2103Crossref PubMed Scopus (59) Google Scholar). Since we want to investigate effects of NaCl, phosphate, DNA, and heparin on the conformation of E2-DBD, we added concentrations of the above mentioned compounds bearing the maximal effect on the stability toward urea unfolding (see Fig. 4). Sodium chloride concentrations of 0.75m produced a decrease in negative molar ellipticity ([Θ]MRW) to approximately half of its value at 210 nm; a much smaller change was observed at 224 nm (Fig.6 a and Table I). An increase of 8,000 deg cm2 dmol−1 in [Θ]MRW is observed at 200 nm; although it cannot be determined precisely, this could be due either to an increase in the maximum at 195 nm or a shift of the maximum to the red. It is, nonetheless, a considerable spectral change. Concentrations of 100 mm phosphate cause a decrease of negative [Θ]MRW at 210 nm similar to high salt, which uncovers further the minimum at 224 nm, corresponding to the α-helix. The change resembles very much that observed in the presence of NaCl except from the more pronounced change in [Θ]MRW at 224 nm in the case of phosphate (Fig. 6 a and TableII). Upon binding of the DNA target, a large spectral change also in the region of the minimum at 210 nm becomes evident. The spectrum of E2-DBD·DNA resembles that of the domain in high salt and is virtually identical to E2-DBD in phosphate. All three share the large increase in [Θ]MRW at 200 nm.Table IIEffect of salt, phosphate, heparin, and DNA on the conformation of E2-DBD as measured from circular dichroism and bis-ANS binding experimentsSpectral areaλmaxK 0.5202 nm[θ]MRW (deg·cm2 dmol−1) 210 nm224 nm%nmμmBuffer1004970.8−1236−70135629NaCl504970.511597−3563−5510Phosphate604980.662275−3319−4758Heparin734970.76−837−5955−5338DNA oligonucleotide384941.312435−3657−4783 Open table in a new tab The assignment of the conformational changes upon DNA binding to a particular type of structure and the extent of that change are not straightforward to interpret from the mere inspection of the far UV CD spectra, except in the case of pure helical proteins. E2-DBD has high β-sheet type structures, including antiparallel β-strands and β-hairpins, as well as many aromatic residues. All this structural heterogeneity precludes an accurate estimation of the precise structural change (21Borén K. Freskgård P.O. Carlsson U. Protein Sci. 1996; 5: 2479-2484Crossref PubMed Scopus (18) Google Scholar). For example, a β-hairpin or a turn could translate into a positive band between 210 and 220 nm, and this cannot be discerned from a decrease in negative ellipticity that could correspond to helix local unfolding. What is clear is that the domain has a large flexibility in response to salts, phosphate, and ligands, leading possibly to generalized conformational changes. The difference between free and DNA-bound E2-DBD can also be visualized from comparing the sum of the spectra of free E2-DBD and DNA, with the spectrum of the complex (Fig. 6 b). As described in the earlier crystallographic studies of the bovine virus E2-DBD, the DNA binds in a particular bent conformation (12Hegde R.S. Grossman S.R. Laimins L.A. Sigler P.B. Nature. 1992; 359: 505-512Crossref PubMed Scopus (329) Google Scholar). A conformational change in the DNA oligonucleotide is observed from the difference spectrum of the bound DNA in comparison to the free DNA, shown in the inset of Fig. 6 b. Soluble heparin was also analyzed for its ability to induce conformational changes since it is known to bind to the protein, and it was found to cause a large stabilization toward urea denaturation, described in previous sections. The presence of heparin concentrations similar to those causing maximal stabilization toward urea unfolding (Fig. 4) produces only a small change in the far UV CD spectrum, compared with DNA, phosphate, and salt. No change is observed around 200 nm, suggesting once more that changes in both regions,i.e. 210–224 and below 200 nm, are reporting the same type of structural modification (Fig. 6 a). Binding of hydrophobic probes from the" @default.
• W2012593791 created "2016-06-24" @default.
• W2012593791 creator A5057365319 @default.
• W2012593791 creator A5076138614 @default.
• W2012593791 date "1997-08-01" @default.
• W2012593791 modified "2023-09-30" @default.
• W2012593791 title "Conformational Changes and Stabilization Induced by Ligand Binding in the DNA-binding Domain of the E2 Protein from Human Papillomavirus" @default.
• W2012593791 cites W1448494757 @default.
• W2012593791 cites W1521958691 @default.
• W2012593791 cites W1537495001 @default.
• W2012593791 cites W1554158004 @default.
• W2012593791 cites W1832523854 @default.
• W2012593791 cites W1985173600 @default.
• W2012593791 cites W1994439020 @default.
• W2012593791 cites W1996372353 @default.
• W2012593791 cites W2003781135 @default.
• W2012593791 cites W2010891200 @default.
• W2012593791 cites W2028231353 @default.
• W2012593791 cites W2034457918 @default.
• W2012593791 cites W2036384511 @default.
• W2012593791 cites W2043849417 @default.
• W2012593791 cites W2052368967 @default.
• W2012593791 cites W2056672272 @default.
• W2012593791 cites W2063316846 @default.
• W2012593791 cites W2066590497 @default.
• W2012593791 cites W2068182885 @default.
• W2012593791 cites W2084179126 @default.
• W2012593791 cites W2087640316 @default.
• W2012593791 cites W2088717436 @default.
• W2012593791 cites W2104017463 @default.
• W2012593791 cites W2113518661 @default.
• W2012593791 cites W2126103568 @default.
• W2012593791 cites W2133335149 @default.
• W2012593791 cites W2156976901 @default.
• W2012593791 doi "https://doi.org/10.1074/jbc.272.31.19295" @default.
• W2012593791 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9235925" @default.
• W2012593791 hasPublicationYear "1997" @default.
• W2012593791 type Work @default.
• W2012593791 sameAs 2012593791 @default.
• W2012593791 citedByCount "29" @default.
• W2012593791 countsByYear W20125937912013 @default.
• W2012593791 countsByYear W20125937912018 @default.
• W2012593791 countsByYear W20125937912022 @default.
• W2012593791 crossrefType "journal-article" @default.
• W2012593791 hasAuthorship W2012593791A5057365319 @default.
• W2012593791 hasAuthorship W2012593791A5076138614 @default.
• W2012593791 hasBestOaLocation W20125937911 @default.
• W2012593791 hasConcept C104317684 @default.
• W2012593791 hasConcept C107824862 @default.
• W2012593791 hasConcept C116569031 @default.
• W2012593791 hasConcept C12554922 @default.
• W2012593791 hasConcept C126322002 @default.
• W2012593791 hasConcept C134306372 @default.
• W2012593791 hasConcept C170493617 @default.
• W2012593791 hasConcept C185592680 @default.
• W2012593791 hasConcept C25166345 @default.
• W2012593791 hasConcept C2994532551 @default.
• W2012593791 hasConcept C33923547 @default.
• W2012593791 hasConcept C36503486 @default.
• W2012593791 hasConcept C51639874 @default.
• W2012593791 hasConcept C552990157 @default.
• W2012593791 hasConcept C55493867 @default.
• W2012593791 hasConcept C70721500 @default.
• W2012593791 hasConcept C71924100 @default.
• W2012593791 hasConcept C86339819 @default.
• W2012593791 hasConcept C86803240 @default.
• W2012593791 hasConcept C94966510 @default.
• W2012593791 hasConcept C95444343 @default.
• W2012593791 hasConceptScore W2012593791C104317684 @default.
• W2012593791 hasConceptScore W2012593791C107824862 @default.
• W2012593791 hasConceptScore W2012593791C116569031 @default.
• W2012593791 hasConceptScore W2012593791C12554922 @default.
• W2012593791 hasConceptScore W2012593791C126322002 @default.
• W2012593791 hasConceptScore W2012593791C134306372 @default.
• W2012593791 hasConceptScore W2012593791C170493617 @default.
• W2012593791 hasConceptScore W2012593791C185592680 @default.
• W2012593791 hasConceptScore W2012593791C25166345 @default.
• W2012593791 hasConceptScore W2012593791C2994532551 @default.
• W2012593791 hasConceptScore W2012593791C33923547 @default.
• W2012593791 hasConceptScore W2012593791C36503486 @default.
• W2012593791 hasConceptScore W2012593791C51639874 @default.
• W2012593791 hasConceptScore W2012593791C552990157 @default.
• W2012593791 hasConceptScore W2012593791C55493867 @default.
• W2012593791 hasConceptScore W2012593791C70721500 @default.
• W2012593791 hasConceptScore W2012593791C71924100 @default.
• W2012593791 hasConceptScore W2012593791C86339819 @default.
• W2012593791 hasConceptScore W2012593791C86803240 @default.
• W2012593791 hasConceptScore W2012593791C94966510 @default.
• W2012593791 hasConceptScore W2012593791C95444343 @default.
• W2012593791 hasIssue "31" @default.
• W2012593791 hasLocation W20125937911 @default.
• W2012593791 hasOpenAccess W2012593791 @default.
• W2012593791 hasPrimaryLocation W20125937911 @default.
• W2012593791 hasRelatedWork W1988868350 @default.
• W2012593791 hasRelatedWork W1993308714 @default.
• W2012593791 hasRelatedWork W1993831923 @default.
• W2012593791 hasRelatedWork W2007339103 @default.
• W2012593791 hasRelatedWork W2009673058 @default.

• next