FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012597218> ?p ?o ?g. }

• W2012597218 endingPage "19907" @default.
• W2012597218 startingPage "19898" @default.
• W2012597218 abstract "Signals transduced by the T cell antigen receptor (TCR) regulate developmental transitions in the thymus and also mediate the immunologic activation of mature, peripheral T cells. In both cases TCR stimulation leads to the assembly of the NFAT transcription complex as a result of the calcium-dependent nuclear translocation of cytosolic subunits, NFATc, and the Ras/protein kinase C-dependent induction of a nuclear subunit, NFATn. To further understand the diverse roles of antigen receptor signaling throughout T cell development, we have identified a new NFATc family member, NFATc3, that is expressed at highest levels in the thymus. NFATc3 is the product of a gene on murine chromosome 8 that is not linked to the other NFATc genes. NFATc3, like other NFATc family members, contains a conserved rel similarity domain, and also defines a region conserved among NFATc family members, the SP repeat region, characterized by the repeated motif SPxxSPxxSPrxsxx(D/E)(D/E)swl. NFATc3 activates NFAT site-dependent transcription when overexpressed, yet exhibits a pattern of DNA site specificity distinct from other NFATc proteins. Additionally, thymic NFATc3 undergoes modifications in response to agents that mimic T cell receptor signaling, including a decrease in apparent molecular mass upon elevation of intracellular calcium that is inhibited by the immunosuppressant FK506. Given the preferential expression of NFATc3 in the thymus, NFATc family members may regulate distinct subsets of genes during T cell development. Signals transduced by the T cell antigen receptor (TCR) regulate developmental transitions in the thymus and also mediate the immunologic activation of mature, peripheral T cells. In both cases TCR stimulation leads to the assembly of the NFAT transcription complex as a result of the calcium-dependent nuclear translocation of cytosolic subunits, NFATc, and the Ras/protein kinase C-dependent induction of a nuclear subunit, NFATn. To further understand the diverse roles of antigen receptor signaling throughout T cell development, we have identified a new NFATc family member, NFATc3, that is expressed at highest levels in the thymus. NFATc3 is the product of a gene on murine chromosome 8 that is not linked to the other NFATc genes. NFATc3, like other NFATc family members, contains a conserved rel similarity domain, and also defines a region conserved among NFATc family members, the SP repeat region, characterized by the repeated motif SPxxSPxxSPrxsxx(D/E)(D/E)swl. NFATc3 activates NFAT site-dependent transcription when overexpressed, yet exhibits a pattern of DNA site specificity distinct from other NFATc proteins. Additionally, thymic NFATc3 undergoes modifications in response to agents that mimic T cell receptor signaling, including a decrease in apparent molecular mass upon elevation of intracellular calcium that is inhibited by the immunosuppressant FK506. Given the preferential expression of NFATc3 in the thymus, NFATc family members may regulate distinct subsets of genes during T cell development. INTRODUCTIONThe antigen receptor of T lymphocytes subserves diverse functions during development. In the thymus, signals from the antigen receptor rescue from death those cells that have low avidity receptors for self-antigens bound to major histocompatability complex molecules (positive selection), whereas high avidity self-antigens induce programmed cell death (negative selection)(1Ashton-Rickardt P.G. Tonegawa S. Immunol. Today. 1994; 15: 362-366Abstract Full Text PDF PubMed Scopus (17) Google Scholar). In mature, peripheral T cells, interaction with foreign antigen leads to immunologic activation. In each case characteristic sets of genes are activated or repressed by signals emanating from the antigen receptor. For example, antigen receptor-induced repression of the RAG-1 and RAG-2 genes (2Turka L.A. Schatz D.G. Oettinger M.A. Chun J.J. Gorka C. Lee K. McCormack W.T. Thompson C.B. Science. 1991; 253: 778-781Crossref PubMed Scopus (223) Google Scholar) and activation of the CD69 gene (3Yamashita I. Nagata T. Tada T. Nakayama T. Int. Immunol. 1993; 5: 1139-1150Crossref PubMed Scopus (197) Google Scholar) are hallmarks of thymic selection. In mature T cells, antigen receptor-induced expression of growth factor genes such as IL-2 1The abbreviations used are: ILinterleukinNFATnuclear factor of activated T cellsNFATccytosolic component of NFATPMAphorbol 12-myristate 13-acetateTCRT cell antigen receptorARREantigen receptor response elementGM-CSFgranulocyte-macrophage colony-stimulating factorTNFtumor necrosis factorPCRpolymerase chain reactionbpbase pair(s)PIPES1,4-piperazinediethanesulfonic acidRSDrel similarity domain(s). and genes that encode cell-cell interaction molecules, such as the CD40 ligand, are essential for immunologic function and proliferation. How these diverse cell fates and functions are initiated by the T cell antigen receptor (TCR) is not understood, but likely involve the use of distinct antigen receptor response elements to activate genes essential for specific developmental transitions.T cell antigen receptor response elements (ARREs) were initially described in the IL-2 gene of mature T cells(4Durand D.B. Shaw J.P. Bush M.R. Replogle R.E. Belagaje R. Crabtree G.R. Mol. Cell. Biol. 1988; 8: 1715-1724Crossref PubMed Scopus (374) Google Scholar). The protein complex that binds to one of these elements, designated nuclear factor of activated T cells (NFAT; (5Shaw J.P. Utz P.J. Durand D.B. Toole J.J. Emmel E.A. Crabtree G.R. Science. 1988; 241: 202-205Crossref PubMed Scopus (10) Google Scholar)), appears to integrate Ras- and calcium-dependent signals initiated by the antigen receptor through the assembly of cytosolic (NFATc) and nuclear (NFATn) components. NFATc is present in the cytosol of resting lymphocytes in a transcriptionally active form and translocates to the nucleus within 5 min of T cell activation(6Flanagan W.M. Corthesy B. Bram R.J. Crabtree G.R. Nature. 1991; 352: 803-807Crossref PubMed Scopus (946) Google Scholar). This translocation event, as well as NFAT complex formation and NFAT site-dependent transcription, is calcium- and calcineurin-dependent and completely blocked by the immunosuppressive drugs FK506 and cyclosporin A(6Flanagan W.M. Corthesy B. Bram R.J. Crabtree G.R. Nature. 1991; 352: 803-807Crossref PubMed Scopus (946) Google Scholar, 7Emmel E.A. Verweij C.L. Durand D.B. Higgins K.M. Lacy E. Crabtree G.R. Science. 1989; 246: 1617-1620Crossref PubMed Scopus (571) Google Scholar, 8Clipstone N.A. Crabtree G.R. Nature. 1992; 357: 695-697Crossref PubMed Scopus (1463) Google Scholar, 9O'Keefe S.J. Tamura J. Kincaid R.L. Tocci M.J. O'Neill E.A. Nature. 1992; 357: 692-694Crossref PubMed Scopus (781) Google Scholar). NFATn is synthesized within 20 min of T cell activation by a Ras/protein kinase C-dependent pathway and can be replaced by high levels of AP1(6Flanagan W.M. Corthesy B. Bram R.J. Crabtree G.R. Nature. 1991; 352: 803-807Crossref PubMed Scopus (946) Google Scholar, 10Northrop J.P. Ullman K.S. Crabtree G.R. J. Biol. Chem. 1993; 268: 2917-2923Abstract Full Text PDF PubMed Google Scholar, 11Jain J. McCaffrey P.G. Miner Z. Kerppola T.K. Lambert J.N. Verdine G.L. Curran T. Rao A. Nature. 1993; 365: 352-355Crossref PubMed Scopus (673) Google Scholar). In addition to the NFAT site within the IL-2 gene promoter, putative NFAT DNA binding sites have been identified in the promoters of several genes that are transcriptionally induced upon antigen receptor activation in a CsA/FK506-sensitive manner, including IL-3/GM-CSF(12Cockerill P.N. Shannon M.F. Bert A.G. Ryan G.R. Vadas M.A. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2466-2470Crossref PubMed Scopus (175) Google Scholar), IL-4(13Szabo S.J. Gold J.S. Murphy T.L. Murphy K.M. Mol. Cell. Biol. 1993; 13: 4793-4805Crossref PubMed Scopus (234) Google Scholar, 14Matsuda I. Masuda E.S. Tsuboi A. Behnam S. Arai N. Arai K. Biochem. Biophys. Res. Commun. 1994; 199: 439-446Crossref PubMed Scopus (18) Google Scholar, 15Rooney J.W. Hodge M.R. McCaffrey P.G. Rao A. Glimcher L.H. EMBO J. 1994; 13: 625-633Crossref PubMed Scopus (149) Google Scholar), TNFα(16Goldfeld A.E. McCaffrey P.G. Strominger J.L. Rao A. J. Exp. Med. 1993; 178: 1365-1379Crossref PubMed Scopus (191) Google Scholar), CD40L(17Fuleihan R. Ramesh N. Horner A. Ahern D. Belshaw P.J. Alberg D.G. Stamenkovic I. Harmon W. Geha R.S. J. Clin. Invest. 1994; 93: 1315-1320Crossref PubMed Scopus (133) Google Scholar, 18Tsitsikov E.N. Ramesh N. Geha R.S. Mol. Immunol. 1994; 31: 895-900Crossref PubMed Scopus (28) Google Scholar), and granzyme B(19Haddad P. Wargnier A. Bourge J.F. Sasportes M. Paul P. Eur. J. Immunol. 1993; 23: 625-629Crossref PubMed Scopus (19) Google Scholar). Thus, NFAT represents a multicomponent transcription factor complex that integrates signals transduced by the TCR through the use of constituents that are the targets of distinct signaling pathways.In addition to its role in the transcriptional induction of cytokine genes in mature T lymphocytes, NFAT may also be involved in T cell ontogeny in the thymus. Although ARREs have not been defined for TCR signaling in the thymus, the ability of thymocytes to induce NFAT DNA binding activity to the IL-2 ARRE appears to be developmentally regulated. This conclusion is based upon results demonstrating that in short term thymocyte cultures, NFAT is inducible in CD4-CD8- cells, noninducible in CD4+CD8+ thymocytes, and inducible in the single-positive populations(20Riegel J.S. Richie E.R. Allison J.P. J. Immunol. 1990; 144: 3611-3618PubMed Google Scholar, 21Chen D. Rothenberg E.V. Mol. Cell. Biol. 1993; 13: 228-237Crossref PubMed Scopus (88) Google Scholar). A role for NFAT in thymic maturation is also suggested by the observations that cyclosporin A or FK506, which inhibits calcineurin and completely blocks transcription directed by the NFAT site(6Flanagan W.M. Corthesy B. Bram R.J. Crabtree G.R. Nature. 1991; 352: 803-807Crossref PubMed Scopus (946) Google Scholar, 8Clipstone N.A. Crabtree G.R. Nature. 1992; 357: 695-697Crossref PubMed Scopus (1463) Google Scholar, 9O'Keefe S.J. Tamura J. Kincaid R.L. Tocci M.J. O'Neill E.A. Nature. 1992; 357: 692-694Crossref PubMed Scopus (781) Google Scholar), blocks the development of the CD4+CD8- and CD4-CD8+ subpopulations of thymocytes(22Jenkins M.K. Schwartz R.H. Pardoll D.M. Science. 1988; 241: 1655-1658Crossref PubMed Scopus (342) Google Scholar, 23Gao E.K. Lo D. Cheney R. Kanagawa O. Sprent J. Nature. 1988; 336: 176-179Crossref PubMed Scopus (277) Google Scholar). Thus, although a variety of studies suggest a role for the NFAT transcription factor complex in regulating development in the thymus, there is no clear understanding of the specific mechanism by which this occurs. This is due, in part, to a lack of understanding of the molecular characteristics of the NFAT complex in developing thymocytes and the lack of definition of ARREs for intrathymic signaling by the T lymphocyte receptor.The purification and molecular cloning of the preexisting or cytosolic component of NFAT resulted in the identification of two distinct genes, NFATp (24McCaffrey P.G. Luo C. Kerppola T.K. Jain J. Badalian T.M. Ho A.M. Burgeon E. Lane W.S. Lambert J.N. Curran T. Science. 1993; 262: 750-754Crossref PubMed Scopus (376) Google Scholar) and NFATc(25Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (522) Google Scholar), both of which encode proteins that are capable of binding to NFAT DNA sites and are present in the NFAT gel shift complex. These proteins share a conserved region of limited similarity (∼20% amino acid identity) to the rel homology domain of dorsal/rel/NFκB transcription factors, and therefore appear to define a distinct family or subfamily of transcription factors(25Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (522) Google Scholar). Whether this family will also be characterized by other features shared by NFATc and NFATp, such as their function as targets of calcium-dependent signal transduction, is uncertain. 2To facilitate study of these proteins, we have employed a system of nomenclature proposed by the Human Gene Nomenclature Committee (see footnote, (29Li X. Ho S.N. Luna J. Giacalone J. Thomas D.J. Timmerman L.A. Crabtree G.R. Francke U. Cytogenet. Cell. Genet. 1995; 68: 185-191Crossref PubMed Scopus (26) Google Scholar)) in which the family of NFATc- or NFATp-related transcription factor genes is designated NFATC (as known family members are cytosolic as originally described and to maintain the distinction between the separate components of the NFAT complex; (6Flanagan W.M. Corthesy B. Bram R.J. Crabtree G.R. Nature. 1991; 352: 803-807Crossref PubMed Scopus (946) Google Scholar)), and each member of this family is numbered sequentially. Thus, NFATC1 and NFATC2 are used to indicate the NFATc and NFATp genes, respectively (Nfatc1 and Nfatc2 refer to the murine genes). Here we refer to the NFATC-encoded RNA/cDNA or protein as NFATc. To further investigate the role of the NFATc family of transcription factors in signal transduction and T cell development, a cDNA library derived from thymocytes induced to undergo negative selection (26Liu Z.G. Smith S.W. McLaughlin K.A. Schwartz L.M. Osborne B.A. Nature. 1994; 367: 281-284Crossref PubMed Scopus (495) Google Scholar) was screened for additional NFATc family members. An additional cDNA was isolated that encodes a novel NFATc family member, NFATc3. Characterization of this cDNA indicates that NFATc3 RNA is preferentially expressed in thymus, spleen, and lymph node and that NFATc3 exhibits DNA binding specificity distinct from that of other NFATc family members. Furthermore, thymic NFATc3 undergoes alterations in apparent molecular mass in response to increases in intracellular calcium that are reversed by the immunosuppressant FK506, suggesting that NFATc3 is regulated by calcineurin in a manner similar to the other NFATc family members. These results extend our understanding of the molecular characteristics of NFATc proteins and should permit a more rigorous analysis of the role of the NFATc family of transcription factors in thymic development and signal transduction.MATERIALS AND METHODSNFATc3 cDNA CloningA cDNA library (kindly provided by B. Osborne) was derived from T cell receptor transgenic murine thymus stimulated in vivo by inducing negative selection with injected antigen(26Liu Z.G. Smith S.W. McLaughlin K.A. Schwartz L.M. Osborne B.A. Nature. 1994; 367: 281-284Crossref PubMed Scopus (495) Google Scholar). The library, constructed in the UNI-Zap XR vector (Stratagene), was screened using a radiolabeled DNA probe corresponding to the rel similarity domain of murine NFATc1 and NFATc2 (24McCaffrey P.G. Luo C. Kerppola T.K. Jain J. Badalian T.M. Ho A.M. Burgeon E. Lane W.S. Lambert J.N. Curran T. Science. 1993; 262: 750-754Crossref PubMed Scopus (376) Google Scholar). The probe was labeled by PCR amplification, as described(27Schowalter D.B. Sommer S.S. Anal. Biochem. 1989; 177: 90-94Crossref PubMed Scopus (181) Google Scholar). Oligonucleotides 5′-TGATCACCTCCAAGATATGGAAGACCAGTCC and 5′-GCGCGTCGACGGCAGAGCGCTGAGAGCA were used to amplify a fragment corresponding to nucleotides 434-1206 of the murine NFATc2 cDNA (24McCaffrey P.G. Luo C. Kerppola T.K. Jain J. Badalian T.M. Ho A.M. Burgeon E. Lane W.S. Lambert J.N. Curran T. Science. 1993; 262: 750-754Crossref PubMed Scopus (376) Google Scholar); oligonucleotides 5′-CGACACTCGAGTCAGTAAAAACCTCCTCTC and 5′-CTGCCCTCGAGTGGCAGCTCCCGTCACATTC were used to amplify a fragment corresponding to the homologous region of murine NFATc1. The murine NFATc1 cDNA clone used as a template in PCR reactions was obtained by low stringency screening of the same library using the full-length human NFATc1 clone (25Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (522) Google Scholar) as a probe. 3L. A. Timmerman and G. R. Crabtree, unpublished data. Colonies that hybridized under low stringency conditions only were isolated. The clone containing the longest cDNA insert, clone 3, was sequenced in its entirety on both strands using the dideoxynucleotide chain termination method with Sequenase version 2.0 (U. S. Biochemical Corp.). Analysis of the NFATc3 sequence, including data base searches, alignments, and motif searches, employed both the GCG version 7.4 (Genetics Computer Group, Inc., Madison, WI) and the Intelligenetics Suite release 5.4 (Intelligenetics, Inc., Mountain View, CA) software packages.Plasmid ConstructsThe NFATc3 expression construct was made as follows: a 3215-bp NFATc3 fragment was obtained from clone 3 by XhoI digestion (an XhoI site was present in the vector at the 3′ end of the clone), filling in of the 5′ overhang with the Klenow fragment of DNA polymerase, and digestion with XbaI (site present at nucleotide 404). This fragment was inserted in frame into the 5′ FLAG epitope-tagged expression vector pDF30 (kindly provided by D. Fiorentino) at the XbaI-MscI sites within the polylinker, resulting in the plasmid pSH250A. This vector is a derivative of the pBJ5 mammalian expression vector, which contains the SRα promoter(28Takebe Y. Seiki M. Fujisawa J. Hoy P. Yokota K. Arai K. Yoshida M. Arai N. Mol. Cell. Biol. 1988; 8: 466-472Crossref PubMed Google Scholar). The NFATc2 expression construct, pSH210, consists of a human NFATc2 cDNA fragment inserted into the pBJ5 vector. The human homolog of the murine NFATc2 cDNA (24McCaffrey P.G. Luo C. Kerppola T.K. Jain J. Badalian T.M. Ho A.M. Burgeon E. Lane W.S. Lambert J.N. Curran T. Science. 1993; 262: 750-754Crossref PubMed Scopus (376) Google Scholar) was cloned by low stringency hybridization of a Jurkat cell cDNA library using as a probe a fragment of the murine NFATc2 cDNA obtained by PCR amplification. 4S. N. Ho, D. J. Thomas, and G. R. Crabtree, unpublished results. The NFATc1 expression construct, pSH107c, contains the human NFATc1 cDNA (25Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (522) Google Scholar) in the pBJ5 vector.Chromosomal Localization of Nfatc3Chromosomal localization of the Nfatc3 gene was performed by PCR analysis of DNAs from a mapping panel consisting of 19 mouse × Chinese hamster and two mouse × rat somatic cell hybrid lines as described(29Li X. Ho S.N. Luna J. Giacalone J. Thomas D.J. Timmerman L.A. Crabtree G.R. Francke U. Cytogenet. Cell. Genet. 1995; 68: 185-191Crossref PubMed Scopus (26) Google Scholar). Primers (forward: 5′ TCAGCTGTGGGAAACGAG and reverse: 5′ CTATGCAACCAGGTCACC) were designed from the 3′-untranslated region of the NFATc3 cDNA and gave rise to the expected 154-bp DNA fragment upon PCR amplification (95°C for 5 min followed by 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min with a final extension at 72°C for 7 min). Fluorescence chromosomal in situ hybridization (FISH) was carried out as described previously(30Milatovich A. Travis A. Grosschedl R. Francke U. Genomics. 1991; 11: 1040-1048Crossref PubMed Scopus (55) Google Scholar).Ribonuclease Protection AssaysRNA was isolated from whole tissues or cell lines by guanidinium thiocyanate lysis and cesium chloride centrifugation(31Chirgwin J.M. Przybyla A.E. MacDonald R.J. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16620) Google Scholar). A NFATc3 cDNA fragment (nucleotides 1191-1355) in pBluescriptIIKS+ and a 131-bp human γ-actin cDNA fragment in pSP64 (Promega) which cross-hybridizes to murine γ-actin were used as templates for the synthesis of antisense RNA labeled to high specific activity with [32P]UTP. Full-length RNA probes were isolated on a denaturing acrylamide gel and hybridized in excess to 10 μg of total RNA overnight at 42°C in 40 mM PIPES (pH 6.7), 400 mM NaCl, 1 mM EDTA, 80% formamide. Samples were incubated for 1 h at 42°C with 300 μl of digestion buffer consisting of 10 mM Tris (pH 7.5), 5 mM EDTA, 300 mM NaCl, 35 units of RNase TI, 1 μg of RNase AIII. Proteinase K (40 μg) and sodium dodecyl sulfate (20 μl of 10% solution) were added and the incubation continued for 20 min. Samples were then extracted twice with phenol:chloroform (1:1, v:v), precipitated, resuspended in gel loading buffer, and analyzed by 6% denaturing polyacrylamide gel electrophoresis.NFATc AntibodiesThe NFATc3 antiserum was raised against a 74-amino acid peptide of NFATc3 extending from residues 321 to 395 (Fig. 2A). This peptide was selected for the generation of antisera, because it did not overlap with either the conserved rel similarity domain or the SP repeat region and therefore could be expected to give rise to antisera that would not cross-react with other NFATc family members. The protein used for immunization consisted of a bacterially produced glutathione S-transferase-NFATc3 fusion protein. The bacterial expression construct was prepared by in-frame ligation of the 227-bp ScaI-MscI fragment from the NFATc3 cDNA clone (nucleotides 958-1185) into the EcoRI site of pGex3X (Pharmacia Biotech Inc.). The glutathione S-transferase fusion protein was purified on glutathione-agarose as specified by the manufacturer (Pharmacia) and used to immunize rabbits (Josman Laboratories). Antisera was affinity-purified on protein A-Sepharose CL-4B (Pharmacia). The NFATc1 (NFATc) monoclonal antibody 7A6 was described previously(25Northrop J.P. Ho S.N. Chen L. Thomas D.J. Timmerman L.A. Nolan G.P. Admon A. Crabtree G.R. Nature. 1994; 369: 497-502Crossref PubMed Scopus (522) Google Scholar). The NFATc2 (NFATp) monoclonal antibody 5H8 was used as a hybridoma culture supernatant and will be described elsewhere. 5L. Timmerman, manuscript in preparation. Cell Culture and TransfectionThe Jurkat TAg (SV40 T antigen) cell line (10Northrop J.P. Ullman K.S. Crabtree G.R. J. Biol. Chem. 1993; 268: 2917-2923Abstract Full Text PDF PubMed Google Scholar) and COS cells (obtained from ATCC) were grown in RPMI 1640 supplemented with 10% (v/v) fetal bovine serum, 100 units/ml penicillin G, 100 μg/ml streptomycin, and 2 mML-glutamine (complete media) in a 5% CO2, 95% air humidified atmosphere. Jurkat TAg cells (107) were transiently transfected with 3 μg of the indicated plasmid by electroporation in 0.4 ml of complete medium (Bio-Rad gene pulser; 960 μF, 250 V, 0.4-cm gap width). Cells were harvested after 24 h and aliquoted in triplicate into 96-well flat-bottom microtiter plates (2 × 105 cells/well in 100 μl of complete medium) and stimulated with various combinations of ionomycin (1 μM), phorbol myristate acetate (PMA, 20 ng/ml), or FK506 (2 ng/ml) in a final volume of 200 μl. Reporter gene activity was measured 12-24 h after stimulation. COS cells were grown to approximately 80% confluence in 150-mm2 plastic tissue culture dishes (Falcon) and transiently transfected by electroporation (960 μF, 230 V, 0.4-cm gap width) in 0.4 ml of complete medium.Reporter Gene AssaySecreted alkaline phosphatase activity was measured 16-24 h after stimulation, as described previously(32Berger J. Hauber J. Hauber R. Geiger R. Cullen B.R. Gene (Amst.). 1988; 66: 1-10Crossref PubMed Scopus (579) Google Scholar, 33Cullen B.R. Malim M.H. Methods Enzymol. 1992; 216: 362-368Crossref PubMed Scopus (164) Google Scholar). Briefly, microtiter plates were heated to 65°C for 1.5-2 h, and 100-μl aliquots from each well were incubated with an equal volume of 2 M diethanolamine bicarbonate (pH 10.0), 1 mM methylumbelliferyl phosphate (Sigma) at 37°C. Relative alkaline phosphatase activity was measured by quantitating the accumulation of fluorescent product using a Titertek Fluoroskan II (ICN) with an excitation wavelength of 355 nm and an emission wavelength of 460 nm.Preparation of Cell ExtractsNuclear extracts from Jurkat TAg and COS1 cells were prepared essentially as described previously (34Fiering S. Northrop J.P. Nolan G.P. Mattila P.S. Crabtree G.R. Herzenberg L.A. Genes & Dev. 1990; 4: 1823-1834Crossref PubMed Scopus (229) Google Scholar). Briefly, cells were washed once with cold phosphate-buffered saline, resuspended in buffer A (10 mM Hepes (pH 7.8), 15 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, 0.1 mM EDTA), pelleted by low speed centrifugation (Eppendorf microcentrifuge, setting 3 for 3 min), and resuspended in buffer A + 0.05% Nonidet P-40. The resulting nuclei were pelleted by low speed centrifugation and resuspended in buffer C (50 mM Hepes at pH 7.8, 50 mM KCl, 1 mM dithiothreitol, 0.1 mM EDTA, 10% glycerol). The nuclei were lysed by addition of 0.10 volume of 3 M ammonium sulfate (pH 7.9) followed by rotation at 4°C for 30 min. The nuclear debris was pelleted by high speed centrifugation at 100,000 rpm for 15 min (Beckman TL-100 tabletop ultracentrifuge, TLA 100.2 rotor). Protein in the supernatant was precipitated by addition of an equal volume of 3.0 M ammonium sulfate (pH 7.9), pelleted by centrifugation (50,000 rpm for 8 min), and resuspended in 50-100 μl of buffer C. All buffers were supplemented with protease inhibitors (1 μg/ml antipain, 1 μg/ml aprotinin, 1 mM benzamidine, 0.5 μg/ml leupeptin, 1 μg/ml pepstatin, and 1 mM phenylmethylsulfonyl fluoride). Extracts were stored at −75°C. Protein concentration was determined by the Bradford dye assay (Bio-Rad). Thymus, spleen, and lymph node extracts were prepared as above from unfractionated cell suspensions. Thymus whole cell extracts were prepared from an unfractionated cell suspension treated with the indicated stimuli for 15 min. Cells were subsequently washed once with phosphate-buffered saline and lysed in 20 mM Tris-HCl, pH 7.7, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 1 mM dithiothreitol, 0.5% Nonidet P-40, 10 mM β-glycerophosphate, 100 μM sodium vanadate, 1 mM sodium fluoride, 1 mMp-nitrophenyl phosphate and protease inhibitors (listed above). Lysates were cleared by ultracentrifugation. COS whole cell extracts were similarly prepared.Electrophoretic Mobility Shift AssayDNA binding reactions were performed in a final volume of 15 μl containing 10 mM Tris (pH 7.5), 80 mM sodium chloride, 1 mM EDTA, 1 mM dithiothreitol, 5% glycerol, varying concentrations of poly(dI-dC) (Boehringer Mannheim), 10 μg of nuclear extract, and 0.1 ng of radiolabeled double-stranded oligonucleotide probe. After addition of nuclear extract, samples were incubated at room temperature for 45-60 min, loaded onto a prerun 4% polyacrylamide gel (acrylamide/bisacrylamide ratio of 30:0.8) cast in 1 × Tris borate-EDTA (TBE), and electrophoresed at 180 V for 2-2.5 h using 0.5 × TBE running buffer. Supershifts were performed by addition of 1 μL of a 1:10 dilution of an ascites preparation of the monoclonal antibody 7A6, or 2 μl of a hybridoma culture 5H8 supernatant, to the preformed gel shift complex and incubating for an additional 30 min on ice. Gel shift probes included: the murine IL-2 NFAT site, 5′ ACTGACCCCAAAGAGGAAAATTTGTTTCATGATC; the murine IL-4 NFAT site, 5′ CTTTACATTGGAAAATTTTAT(35Todd M.D. Grusby M.J. Lederer J.A. Lacy E. Lichtman A.H. Glimcher L.H. J. Exp. Med. 1993; 177: 1663-1674Crossref PubMed Scopus (104) Google Scholar); the murine TNFα k3 site, CTCGAGTACCCAAAGAGGTGG(16Goldfeld A.E. McCaffrey P.G. Strominger J.L. Rao A. J. Exp. Med. 1993; 178: 1365-1379Crossref PubMed Scopus (191) Google Scholar); and the IL-3/GM-CSF NFAT site (GM550), 5′ TGACAGGAGGAAAGCAAGAGTCATATAGGCTGTC(12Cockerill P.N. Shannon M.F. Bert A.G. Ryan G.R. Vadas M.A. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2466-2470Crossref PubMed Scopus (175) Google Scholar).Immunoprecipitation and Western AnalysisProtein A-Sepharose CL-4B (Pharmacia) was prebound with an excess of rabbit NFATc3 antiserum, washed three times with lysis buffer, and added to whole cell extracts. After a 1-h incubation on ice, the Sepharose was washed three times with lysis buffer and subject to SDS-polyacrylamide gel electrophoresis. Western blotting was performed using protein A-purified rabbit anti-NFATc3 antiserum (1:500 dilution) and protein A-peroxidase (Sigma) as the secondary (1:2500 dilution).RESULTSMolecular Cloning of NFATc3DNA fragments encoding the rel similarity domains (RSD) of the murine NFATc1 and NFATc2 cDNA clones were used to screen a thymus cDNA library(26Liu Z.G. Smith S.W. McLaughlin K.A. Schwartz L.M. Osborne B.A. Nature. 1994; 367: 281-284Crossref PubMed Scopus (495) Google Scholar). Low stringency hybridization and washing resulted in 220 positive plaques (approximately 9 × 105 plaques screened). All but 21 of these plaques were resistant to high stringency wash conditions. The 21 plaques that hybridized under low stringency conditions only were characterized and found to represent overlapping clones of a common cDNA sequence. The longest of these clones (#3) contained a cDNA sequence spanning 3619 nucleotides (Fig. 1). The cDNA encodes a protein of 1065 amino acids with a predicted molecular mass of 115 kilodaltons, and contains a putative polyadenlyation signal 16 bp upstream of the poly(A) tail. However, it lacks a 5′ in-frame stop codon or translation initiation codon and therefore likely represents a partial cDNA clone. As expected, comparison of the cDNA sequence to sequences present in the Genbank.Figure 1:Nucleotide and predicted amino acid sequence of murine NFATc3. The SP repeat motifs are underlined, and the rel similarity domain is represented in italics.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The region of amino acid sequence similarity encompassed the RSD (Fig. 2, A and B), over which NFATc3 is 69% identical" @default.
• W2012597218 created "2016-06-24" @default.
• W2012597218 creator A5000656143 @default.
• W2012597218 creator A5016082098 @default.
• W2012597218 creator A5030783394 @default.
• W2012597218 creator A5033804830 @default.
• W2012597218 creator A5039341545 @default.
• W2012597218 creator A5082977812 @default.
• W2012597218 date "1995-08-01" @default.
• W2012597218 modified "2023-10-18" @default.
• W2012597218 title "NFATc3, a Lymphoid-specific NFATc Family Member That Is Calcium-regulated and Exhibits Distinct DNA Binding Specificity" @default.
• W2012597218 cites W1592296649 @default.
• W2012597218 cites W1601157315 @default.
• W2012597218 cites W1735455912 @default.
• W2012597218 cites W1969987028 @default.
• W2012597218 cites W1970842110 @default.
• W2012597218 cites W1976616117 @default.
• W2012597218 cites W1983380437 @default.
• W2012597218 cites W1984695968 @default.
• W2012597218 cites W1984754431 @default.
• W2012597218 cites W1989875191 @default.
• W2012597218 cites W1996068610 @default.
• W2012597218 cites W2002485919 @default.
• W2012597218 cites W2008374259 @default.
• W2012597218 cites W2011952922 @default.
• W2012597218 cites W2017842551 @default.
• W2012597218 cites W2026181894 @default.
• W2012597218 cites W2039766781 @default.
• W2012597218 cites W2040392199 @default.
• W2012597218 cites W2041512157 @default.
• W2012597218 cites W2046044724 @default.
• W2012597218 cites W2048085771 @default.
• W2012597218 cites W2051237803 @default.
• W2012597218 cites W2051349356 @default.
• W2012597218 cites W2053132428 @default.
• W2012597218 cites W2054969526 @default.
• W2012597218 cites W2055904083 @default.
• W2012597218 cites W2060333964 @default.
• W2012597218 cites W2070841778 @default.
• W2012597218 cites W2084324934 @default.
• W2012597218 cites W2084892947 @default.
• W2012597218 cites W2120478829 @default.
• W2012597218 cites W2144437446 @default.
• W2012597218 cites W2150278877 @default.
• W2012597218 cites W2161788277 @default.
• W2012597218 cites W2169274616 @default.
• W2012597218 cites W2239911109 @default.
• W2012597218 cites W894556329 @default.
• W2012597218 doi "https://doi.org/10.1074/jbc.270.34.19898" @default.
• W2012597218 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7650004" @default.
• W2012597218 hasPublicationYear "1995" @default.
• W2012597218 type Work @default.
• W2012597218 sameAs 2012597218 @default.
• W2012597218 citedByCount "162" @default.
• W2012597218 countsByYear W20125972182012 @default.
• W2012597218 countsByYear W20125972182013 @default.
• W2012597218 countsByYear W20125972182014 @default.
• W2012597218 countsByYear W20125972182015 @default.
• W2012597218 countsByYear W20125972182016 @default.
• W2012597218 countsByYear W20125972182018 @default.
• W2012597218 countsByYear W20125972182019 @default.
• W2012597218 countsByYear W20125972182020 @default.
• W2012597218 countsByYear W20125972182021 @default.
• W2012597218 countsByYear W20125972182023 @default.
• W2012597218 crossrefType "journal-article" @default.
• W2012597218 hasAuthorship W2012597218A5000656143 @default.
• W2012597218 hasAuthorship W2012597218A5016082098 @default.
• W2012597218 hasAuthorship W2012597218A5030783394 @default.
• W2012597218 hasAuthorship W2012597218A5033804830 @default.
• W2012597218 hasAuthorship W2012597218A5039341545 @default.
• W2012597218 hasAuthorship W2012597218A5082977812 @default.
• W2012597218 hasBestOaLocation W20125972181 @default.
• W2012597218 hasConcept C153911025 @default.
• W2012597218 hasConcept C185592680 @default.
• W2012597218 hasConcept C54355233 @default.
• W2012597218 hasConcept C552990157 @default.
• W2012597218 hasConcept C86803240 @default.
• W2012597218 hasConcept C95444343 @default.
• W2012597218 hasConceptScore W2012597218C153911025 @default.
• W2012597218 hasConceptScore W2012597218C185592680 @default.
• W2012597218 hasConceptScore W2012597218C54355233 @default.
• W2012597218 hasConceptScore W2012597218C552990157 @default.
• W2012597218 hasConceptScore W2012597218C86803240 @default.
• W2012597218 hasConceptScore W2012597218C95444343 @default.
• W2012597218 hasIssue "34" @default.
• W2012597218 hasLocation W20125972181 @default.
• W2012597218 hasOpenAccess W2012597218 @default.
• W2012597218 hasPrimaryLocation W20125972181 @default.
• W2012597218 hasRelatedWork W1828691184 @default.
• W2012597218 hasRelatedWork W1920751942 @default.
• W2012597218 hasRelatedWork W1977206230 @default.
• W2012597218 hasRelatedWork W1991523530 @default.
• W2012597218 hasRelatedWork W2002128513 @default.
• W2012597218 hasRelatedWork W2020824267 @default.
• W2012597218 hasRelatedWork W2031436818 @default.
• W2012597218 hasRelatedWork W2075354549 @default.
• W2012597218 hasRelatedWork W2119103177 @default.
• W2012597218 hasRelatedWork W2092874662 @default.

• next