FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012607246> ?p ?o ?g. }

• W2012607246 endingPage "46829" @default.
• W2012607246 startingPage "46822" @default.
• W2012607246 abstract "The enterohepatic circulation is essential for the maintenance of bile acids and cholesterol homeostasis. The ileal bile acid transporter on the apical membrane of enterocytes mediates the intestinal uptake of bile salts, but little is known about the bile salt secretion from the basolateral membrane of enterocytes into blood. In the basolateral membrane of enterocytes, an ATP-binding cassette transporter, multidrug resistance protein 3 (MRP3), is expressed, which has the ability to transport bile salts. We hypothesized that MRP3 might play a role in the enterohepatic circulation of bile salts by transporting them from enterocytes into circulating blood through the up-regulation of MRP3expression, so we investigated the transcriptional control ofMRP3 in response to bile salts. MRP3 mRNA levels were increased about 3-fold in human colon cells by chenodeoxycholic acid (CDCA), in a dose- and time-dependent manner. In the promoter assay, the promoter activity ofMRP3 was increased about 3-fold over the basal promoter activity when treated with CDCA, and the putative bile salt-responsive elements exist in the region −229/−138 including two α-1 fetoprotein transcription factor (FTF)-like elements. Constructs with a specific mutation in the consensus sequence of FTF elements showed no increase in basal transcriptional activity following CDCA treatment. In electrophoretic mobility shift assay with nuclear extracts, specific binding of FTF to FTF-like elements was observed when treated with CDCA. The expression of FTF mRNA levels were also markedly enhanced in response to CDCA, and overexpression of FTF specifically activated the MRP3 promoter activity about 4-fold over the basal promoter activity. FTF thus might play a key role not only in the bile salt synthetic pathway in hepatocytes but also in the bile salt excretion pathway in enterocytes through the regulation of MRP3 expression. MRP3 may contribute as a plausible bile salt-exporting transporter to the enterohepatic circulation of bile salts. The enterohepatic circulation is essential for the maintenance of bile acids and cholesterol homeostasis. The ileal bile acid transporter on the apical membrane of enterocytes mediates the intestinal uptake of bile salts, but little is known about the bile salt secretion from the basolateral membrane of enterocytes into blood. In the basolateral membrane of enterocytes, an ATP-binding cassette transporter, multidrug resistance protein 3 (MRP3), is expressed, which has the ability to transport bile salts. We hypothesized that MRP3 might play a role in the enterohepatic circulation of bile salts by transporting them from enterocytes into circulating blood through the up-regulation of MRP3expression, so we investigated the transcriptional control ofMRP3 in response to bile salts. MRP3 mRNA levels were increased about 3-fold in human colon cells by chenodeoxycholic acid (CDCA), in a dose- and time-dependent manner. In the promoter assay, the promoter activity ofMRP3 was increased about 3-fold over the basal promoter activity when treated with CDCA, and the putative bile salt-responsive elements exist in the region −229/−138 including two α-1 fetoprotein transcription factor (FTF)-like elements. Constructs with a specific mutation in the consensus sequence of FTF elements showed no increase in basal transcriptional activity following CDCA treatment. In electrophoretic mobility shift assay with nuclear extracts, specific binding of FTF to FTF-like elements was observed when treated with CDCA. The expression of FTF mRNA levels were also markedly enhanced in response to CDCA, and overexpression of FTF specifically activated the MRP3 promoter activity about 4-fold over the basal promoter activity. FTF thus might play a key role not only in the bile salt synthetic pathway in hepatocytes but also in the bile salt excretion pathway in enterocytes through the regulation of MRP3 expression. MRP3 may contribute as a plausible bile salt-exporting transporter to the enterohepatic circulation of bile salts. cholesterol 7α-hydroxylase farnesoid X receptor liver X receptor α-1 fetoprotein transcription factor Na+-taurocholic acid-cotransporting polypeptide bile salt-exporting pump multidrug resistance-associated protein multidrug resistance chenodeoxycholic acid taurochenodeoxycholic acid electrophoretic mobility shift assay CCAAT/enhancer-binding protein β base pair(s) polymerase chain reaction cytomegalovirus Bile salts are synthesized from cholesterol in the hepatocytes, excreted into the bile duct (1Gerloff T. Stieger B. Hagenbuch B. Madon J. Landmann L. Roth J. Hofmann A.F. Meier P.J. J. Biol. Chem. 1998; 273: 10046-10050Abstract Full Text Full Text PDF PubMed Scopus (824) Google Scholar), and finally excreted into the gut, and more than 90% of bile salts are reabsorbed throughout enterocytes and return, via the portal blood, to the liver. This enterohepatic circulation is essential for the maintenance of bile salts and cholesterol homeostasis (2Russell D.W. Setchell K.D.R. Biochemistry. 1992; 31: 4737-4749Crossref PubMed Scopus (659) Google Scholar). Recent studies have described how bile salts/cholesterol homeostasis regulatory mechanisms are controlled through enterohepatic circulation at molecular levels (3Chawla A. Saez E. Evans R.M. Cell. 2000; 103: 1-4Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 4Walters J.R. Gut. 2000; 46: 308-309Crossref PubMed Scopus (20) Google Scholar, 5Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar, 6Russell D.W. Cell. 1999; 97: 539-542Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). In the synthetic pathway in the liver, bile salts exert negative feedback regulation on their own synthesis from cholesterol. CYP7A1,1 which is the first and rate-limiting enzyme in a major bile salt synthetic pathway, is under transcriptional control through a specific bile salt nuclear receptor, farnesoid X receptor (FXR) (7Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Crossref PubMed Scopus (2164) Google Scholar, 8Parks D.J. Blanchard S.G. Bledsoe R.K. Chandra G. Consler T.G. Kliewer S.A. Stimmel J.B. Willson T.M. Zavacki A.M. Moore D.D. Lehmann J.M. Science. 1999; 284: 1365-1368Crossref PubMed Scopus (1843) Google Scholar). Transcription of the CYP7A1 gene is turned down by bile acids through the interaction of an orphan nuclear receptor FTF with the supressor small heterodimer partner, which is up-regulated by binding of FXR to bile acids (7Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Crossref PubMed Scopus (2164) Google Scholar, 8Parks D.J. Blanchard S.G. Bledsoe R.K. Chandra G. Consler T.G. Kliewer S.A. Stimmel J.B. Willson T.M. Zavacki A.M. Moore D.D. Lehmann J.M. Science. 1999; 284: 1365-1368Crossref PubMed Scopus (1843) Google Scholar, 9del Castillo-Olivares A. Gil G. Nucleic Acids Res. 2000; 28: 3587-3593Crossref PubMed Google Scholar, 10Nitta M. Ku S. Brown C. Okamoto A.Y. Shan B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6660-6665Crossref PubMed Scopus (249) Google Scholar). In view of the excretion/efflux pathway of bile salts, several transporters that are expressed in the liver and/or gut confer enterohepatic circulation by exporting bile salts. In the liver, intracellular bile salts are uptaken from circulating blood through the basolateral membrane transporter, NTCP, and they are excreted into the bile duct mainly by BSEP in the canalicular membrane of the hepatocytes (1Gerloff T. Stieger B. Hagenbuch B. Madon J. Landmann L. Roth J. Hofmann A.F. Meier P.J. J. Biol. Chem. 1998; 273: 10046-10050Abstract Full Text Full Text PDF PubMed Scopus (824) Google Scholar). MRP2, a member of the MRP superfamily, expressed in the canalicular membrane of hepatocytes, may also export bile salts into the bile duct (11Kuipers F. Enserink M. Havinga R. van der Steen A.B. Hardonk M.J. Fevery J. Vonk R.J. J. Clin. Invest. 1988; 81: 1593-1599Crossref PubMed Scopus (132) Google Scholar). In the gut, bile salts enter the enterocytes through the ileal apical membrane sodium-dependent bile acid transporter and interact with FXR, resulting in up-regulation of the gene encoding cytosolic ileal bile acid-binding protein, which facilitates intracellular transport of bile salts and protects enterocytes from the detergent effects of bile salts (7Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Crossref PubMed Scopus (2164) Google Scholar, 12Oelkers P. Dawson P.A. Biochim. Biophys. Acta. 1995; 1257: 199-202Crossref PubMed Scopus (45) Google Scholar, 13Bahar R.J. Stolz A. Gastroenterol. Clin. North Am. 1999; 28: 27-58Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). However, little is known about how bile salts are secreted from basolateral membrane into blood (14Craddock A.L. Love M.W. Daniel R.W. Kirby L.C. Walters H.C. Wong M.H. Dawson P.A. Am. J. Physiol. 1998; 274: G157-G169PubMed Google Scholar, 15Wong M.H. Oelkers P. Dawson P.A. J. Biol. Chem. 1995; 270: 27228-27234Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 16Oelkers P. Kirby L.C. Heubi J.E. Dawson P.A. J. Clin. Invest. 1997; 99: 1880-1887Crossref PubMed Scopus (307) Google Scholar). Members of the MRP family mediate unidirectional ATP-dependent transport of anionic conjugates and amphiphilic anions (17Keppler D. Jedlitschky G. Leier I. Methods Enzymol. 1998; 292: 607-616Crossref PubMed Scopus (96) Google Scholar). Seven MRP members, MRP1–7, have been identified so far (18Kool M. de Haas M. Scheffer G.L. Scheper R.J. van Eijk M.J. Juijn J.A. Baas F. Cancer Res. 1997; 57: 3537-3547PubMed Google Scholar), and three of them, MRP1 (19Cole S.P. Bhardwaj G. Gerlach J.H. Mackie J.E. Grant C.E. Almquist K.C. Stewart A.J. Kurz E.U. Duncan A.M. Deeley R.G. Science. 1992; 258: 1650-1654Crossref PubMed Scopus (3010) Google Scholar), MRP2 (20Paulusma C.C. Bosma P.J. Zaman G.J.R. Bakker C.T.M. Otter M. Scheffer G.L. Scheper R.J. Borst P. Oude Elferink R.P. Science. 1996; 271: 1126-1128Crossref PubMed Scopus (802) Google Scholar, 21Taniguchi K. Wada M. Kohno K. Nakamura T. Kawabe T. Kawakami M. Kagotani K. Okumura K. Akiyama S. Kuwano M. Cancer Res. 1996; 56: 4124-4129PubMed Google Scholar), and MRP3 (22Kiuchi Y. Suzuki H. Hirohashi T. Tyson C.A. Sugiyama Y. FEBS Lett. 1998; 433: 149-152Crossref PubMed Scopus (207) Google Scholar, 23Uchiumi T. Hinoshita E. Haga S. Nakamura T. Tanaka T. Toh S. Furukawa M. Kawabe T. Wada M. Kagotani K. Okumura K. Kohno K. Akiyama S. Kuwano M. Biochem. Biophys. Res. Commun. 1998; 9: 103-110Crossref Scopus (85) Google Scholar), have been functionally characterized as conjugate export pumps. MRP2 is predominantly expressed in the canalicular membrane of hepatocytes (18Kool M. de Haas M. Scheffer G.L. Scheper R.J. van Eijk M.J. Juijn J.A. Baas F. Cancer Res. 1997; 57: 3537-3547PubMed Google Scholar, 21Taniguchi K. Wada M. Kohno K. Nakamura T. Kawabe T. Kawakami M. Kagotani K. Okumura K. Akiyama S. Kuwano M. Cancer Res. 1996; 56: 4124-4129PubMed Google Scholar, 24Ito, K., Suzuki, H., Hirohashi, T., Kume, K., Shimizu, T., and Sugiyama, Y. J. Biol. Chem. 273,1684–1688.Google Scholar). In contrast, MRP1 and MRP3 are expressed in the basolateral membrane of hepatocytes and enterocytes (19Cole S.P. Bhardwaj G. Gerlach J.H. Mackie J.E. Grant C.E. Almquist K.C. Stewart A.J. Kurz E.U. Duncan A.M. Deeley R.G. Science. 1992; 258: 1650-1654Crossref PubMed Scopus (3010) Google Scholar, 25Loe D.W. Almquist K.C. Cole S.P. Deeley R.G. J. Biol. Chem. 1996; 271: 9683-9689Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar, 26Nies A.T. Cantz T. Brom M. Leier I. Keppler D. Hepatology. 1998; 28: 1332-1340Crossref PubMed Scopus (78) Google Scholar, 27Koenig J. Rost D. Cui Y.H. Keppler D. Hepatology. 1999; 29: 1156-1163Crossref PubMed Scopus (435) Google Scholar). In rats receiving common bile duct ligation, estrogen treatment, and administration of endotoxin as acquired cholestasis models, basolateral Ntcp was down-regulated by transcriptional mechanisms, and also canalicular Bsep was initially diminished but partially recovered as common bile duct ligation continues (28Gartung C. Ananthanarayanan M. Rahman M.A. Schuele S. Nundy S. Soroka C.J. Stolz A. Suchy F.J. Boyer J.L. Gastroenterology. 1996; 110: 199-209Abstract Full Text PDF PubMed Scopus (243) Google Scholar, 29Lee J.M. Trauner M. Soroka C.J. Stieger B. Meier P.J. Boyer J.L. Gastroenterology. 2000; 118: 163-172Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar). The expression of Mrp2 is down-regulated in these animal models of cholestasis through both transcriptional and post-transcriptional events (30Lee J. Boyer J.L. Semin. Liver Dis. 2000; 20: 373-384Crossref PubMed Scopus (114) Google Scholar), and the expression of Mrp3 was induced (31Hirohashi T. Suzuki H. Ito K. Ogawa K. Kume K. Shimizu T. Sugiyama Y. Mol. Pharmacol. 1998; 53: 1068-1075PubMed Google Scholar, 32Ortiz D.F. Li S. Lyer R. Zhang X. Novikoff P. Arias I.M. Am. J. Physiol. 1999; 276: G1493-G1500PubMed Google Scholar). In humans, Dubin-Johnson syndrome, an autosomal recessive disease, is characterized by a defect in the transfer of endogenous and exogenous anionic conjugates from hepatocytes into the bile because of mutations in MRP2 gene (33Paulusma C.C. Kool M. Bosma P.J. Scheffer G.L. ter Borg F. Scheper R.J. Tytgat G.N. Borst P. Baas F. Oude, Elferink R.P. Hepatology. 1997; 25: 1539-1542Crossref PubMed Scopus (500) Google Scholar, 34Wada M. Toh S. Taniguchi K. Nakamura T. Uchiumi T. Kohno K. Yoshida I. Kimura A. Sakisaka S. Adachi Y. Kuwano M. Hum. Mol. Genet. 1998; 7: 203-207Crossref PubMed Scopus (240) Google Scholar, 35Toh S. Wada M. Uchiumi T. Inokuchi A. Makino Y. Horie Y. Adachi Y. Sakisaka S. Kuwano M. Am. J. Hum. Genet. 1999; 64: 739-746Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 36Tsujii H. Koenig J. Rost D. Stoeckel B. Leuschner U. Keppler D. Gastroenterology. 1999; 117: 653-660Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). It was reported that MRP3 was up-regulated in a patient with Dubin-Johnson syndrome (27Koenig J. Rost D. Cui Y.H. Keppler D. Hepatology. 1999; 29: 1156-1163Crossref PubMed Scopus (435) Google Scholar). MRP3 thus appears to compensate for the impaired function of MRP2 in the liver and respond to bile salts at transcriptional levels. These experiments suggest that bile salt transporters in hepatocytes respond to cholestasis in a direction that tends to diminish retention of bile salts in the liver, resulting in protection of the tissue from further injury (30Lee J. Boyer J.L. Semin. Liver Dis. 2000; 20: 373-384Crossref PubMed Scopus (114) Google Scholar). Relevant studies demonstrated that MRP3 transports the bile salts, 17β-estradiol, and some anti-cancer drugs (23Uchiumi T. Hinoshita E. Haga S. Nakamura T. Tanaka T. Toh S. Furukawa M. Kawabe T. Wada M. Kagotani K. Okumura K. Kohno K. Akiyama S. Kuwano M. Biochem. Biophys. Res. Commun. 1998; 9: 103-110Crossref Scopus (85) Google Scholar, 37Kool M. van der Linden M. de Haas M. Scheffer G.L. de Vree J.M. Smith A.J. Jansen G. Peters G.J. Ponne N. Scheper R.J. Elferink R.P. Baas F. Borst P. Proc. Natl. Sci. U. S. A. 1999; 96: 6914-6919Crossref PubMed Scopus (591) Google Scholar). While the expression of MRP1 and MDR1 is high in hepatocytes, expression of both MRP1 and MDR1 as well as BSEP is very low or absent in enterocytes. By contrast, expression of MRP3 appears in the basolateral enterocyte membrane of humans and rats, suggesting that MRP3 might be responsible for the intestinal transport of organic anions (18Kool M. de Haas M. Scheffer G.L. Scheper R.J. van Eijk M.J. Juijn J.A. Baas F. Cancer Res. 1997; 57: 3537-3547PubMed Google Scholar, 27Koenig J. Rost D. Cui Y.H. Keppler D. Hepatology. 1999; 29: 1156-1163Crossref PubMed Scopus (435) Google Scholar, 31Hirohashi T. Suzuki H. Ito K. Ogawa K. Kume K. Shimizu T. Sugiyama Y. Mol. Pharmacol. 1998; 53: 1068-1075PubMed Google Scholar). Since MRP3, which transports bile salts, is localized in the basolateral membrane of enterocytes, MRP3 may play a role in the enterohepatic circulation of bile salts by transporting them from enterocytes into circulating blood to prevent the accumulation of intracellular bile salts. Furthermore, since expression of apical bile salt transporter is induced by bile salts (38Stravitz R.T. Sanyal A.J. Pandak W.M. Vlahcevic Z.R. Beets J.W. Dawson P.A. Gastroenterology. 1997; 113: 1599-1608Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar), we hypothesize that MRP3 expression could be up-regulated in a coordinated fashion in response to bile salts in the enterocytes. In this study, MRP3 mRNA was found to be up-regulated in response to bile salts in enterocytes, and we examined whether bile salts affect transcriptional control ofMRP3 gene in enterocytes. We observed that FTF-like elements are responsible for the up-regulation of MRP3 gene in response to bile salts. We would propose a novel idea that MRP3 may play a role in bile salts homeostasis through enterohepatic circulation at transcriptional levels. As an in vitro model, we used Caco2 cells from a human colon adenocarcinoma cell line, which retain many of the characteristics of normal enterocytes (39Meunier V. Bourrie M. Berger Y. Fabre G. Cell Biol. Toxicol. 1995; 11: 187-194Crossref PubMed Scopus (323) Google Scholar, 40Hirohashi T. Suzuki H. Chu X.Y. Tamai I. Tsuji A. Sugiyama Y. J. Pharmacol. Exp. Ther. 2000; 292: 265-270PubMed Google Scholar). Cells were cultured in Dulbecco's modified Eagle's medium (Nissui Seiyaku, Tokyo, Japan) supplemented with 10% fetal calf serum, 0.1 mmnonessential amino acids (Invitrogen, Paisley, UK) in a humidified incubator (5% CO2, 37 °C). The medium contained 0.292 mg/ml glutamine, 100 mg/ml kanamycin, and 100 units/ml penicillin (41Tanaka T. Uchiumi T. Hinoshita E. Inokuchi A. Toh S. Wada M. Takano H. Kohno K. Kuwano M. Hepatology. 1999; 30: 1507-1512Crossref PubMed Scopus (84) Google Scholar). CDCA, TCDCA, taurocholic acid, taurolithocholic acid, and ursodeoxycholic acid were purchased from Sigma. To study the effect of bile salts treatment on intestinal MRP3 mRNA expression in vitro, cells were cultured for 48 h with 0–100 μm CDCA, TCDCA, taurocholic acid, taurolithocholic acid, or ursodeoxycholic acid and were treated with 100 μm CDCA for 0–48 h. For the preparation of nuclear extracts, cells were treated with 100 μm CDCA for 12 h. Total RNA was isolated using an Rneasy spin column (Quiagen, Hilden, Germany). RNA samples (15 μg/lane) were separated on a 1% formaldehyde-agarose gel and were transferred to a membrane as described by Tanaka et al. (41Tanaka T. Uchiumi T. Hinoshita E. Inokuchi A. Toh S. Wada M. Takano H. Kohno K. Kuwano M. Hepatology. 1999; 30: 1507-1512Crossref PubMed Scopus (84) Google Scholar). The membranes were prehybridized and hybridized with α-32P-labeled probes (41Tanaka T. Uchiumi T. Hinoshita E. Inokuchi A. Toh S. Wada M. Takano H. Kohno K. Kuwano M. Hepatology. 1999; 30: 1507-1512Crossref PubMed Scopus (84) Google Scholar). An MRP3 cDNA probe (285 bp) was produced by PCR using the primer pair 5′-GTCTTTGTTCCAGACGCAGTC-3′ and 5′-GGAGATGAAGAACAGGCAGG-3′. AFTF cDNA probe (1109 bp) was digested from the pCI-FTF vector by BamHI. Radioactivity was visualized by autoradiography and was analyzed using a Fujix Bas 2000 bioimaging analyzer (Fuji Photo Film Co., Tokyo, Japan). A human placental genomic library in λEMBL3 was screened with a fragment of the 5′-untranslated region ofMRP3 cDNA obtained by the 5′-rapid amplification of cDNA ends method. Several restriction fragments were subcloned into the pUC18 plasmid. Chain elongation and termination were performed using a BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Tokyo, Japan), and the nucleotides were sequenced using a DNA-sequencing system (model 377; Applied Biosystems). Data were analyzed using GeneWorks software (IntelliGenetics, Mountain View, CA). To functionally characterize the 5′-flanking region of the human MRP3 gene, a series of 5′ deletions ranging from −1958 to −13 bp of the upstream sequence from the ATG codon were amplified using PCR from the subcloned pUC18 plasmid with KOD Dash polymerase (TOYOBO, Tokyo, Japan). The upstream primers contained a 5′-flanking SacI restriction site, whereas the downstream primers were flanked by the HindIII site. The PCR product was cloned into pGEM-Teasy vector (Promega, Madison, WI), which was subsequently digested with SacI and HindIII. The fragments of the 5′ region of the MRP3 gene were ligated into the SacI and HindIII sites of pGL3-basic vector (Promega). All plasmids were analyzed by restriction digestion, and the promoter inserts were sequenced. Site-directed mutagenesis of the FTF in p-520 MRP3 Luci was performed by a PCR-based method. Two FTF-like elements exist in p-520 MRP3 Luci; we named the upper region site 1 and the lower region site 2. The promoter sequences were amplified first with Taq polymerase, a 5′-primer (GAGCTCAGCTTCCTGATTGAGC), and a 3′-primer that introduces a specific mutation into the FTF site 1 region (CGCCGTGCTACATGCCCCCCCAC) or into the FTF site 2 region (ACCTCTGCCCTACATTCCCTCCCA), and another pair, a 5′-primer that introduces specific mutation into the FTF site 1 region (GTGGGGGGGCATGTAGCACGGCG) or into the FTF site 2 region (TGGGAGGGAATGTAGGGCAGAGGT) and a 3′-primer (ACCGCGCTCGCCTTCCTTGC). A second PCR was then performed with Taq polymerase using the first PCR products as a template. The PCR product was cloned into pGEM-Teasy vector, which was subsequently digested withSacI and HindIII. The fragments were ligated into the SacI and HindIII sites of pGL3-basic vector (Promega). Cells were transiently transfected by the LipofectAMINE method. Briefly, a mixture of 50 μg of LipofectAMINE 2000 reagent (Invitrogen, Paisley, UK) and 1 μg of reporter plasmid was transfected into the cells and kept there for 6 h, and then fresh medium was added. The 100 ng of pRL-CMV (Promega) plasmid containing Renilla luciferase driven by the CMV promoter was co-transfected as a transfection control. The pGL3-control vector (Promega) containing SV40 promoter-enhancer and promoterless pGL3-basic vector were transfected as positive and negative controls of promoter activity, respectively. The 200 ng of pCI-FTF was transfected into COS7 cells with 1 μg of reporter plasmid and 100 ng of pRL-CMV. Luciferase activities were measured using the Dual Luciferase assay system (Promega). Promoter activities are given as mean ± S.D. of triplicate transfections. The level of significance of promoter activities in the presence of regular substrates was determined using Student's t test. Nuclear extracts (6 μg of protein) were prepared as described (42Furukawa M. Uchiumi T. Nomoto M. Takano H. Morimoto R.I. Naito S. Kuwano M. J. Biol. Chem. 1998; 273: 10550-10555Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) previously, and they were incubated for 30 min at room temperature in a final volume of 20 μl of reaction mixture containing 20 mm Tris-HCl (pH 8.0), 50 mm KCl, 0.2 mm EDTA, 10% (v/v) glycerol, 10 ng of poly(dI-dC), and 1 × 104 cpm of 32P-labeled oligonucleotide probe in the absence or presence of various competitors. Next, the samples were electrophoresed on 5% polyacrylamide gel (polyacrylamide/bisacrylamide ratio, 79:1) in a Tris borate buffer. The gel was exposed to an imaging plate and analyzed using a Fujix BAS 2000 bioimage analyzer (Fuji Photo Film Co.). The DNA sequence of the sense strand of each oligonucleotide is listed in Fig. 6 A. For supershift experiments, 1 μl of the crude serum was used. To examine whether the expression of ABC transporters appearing in enterocytes is altered by bile salts, we performed Northern blot analysis by using Caco2 cells. Treatment with 100 μm concentrations of several series of bile salts, CDCA, TCDCA, taurocholic acid, and taurolithocholic acid, for 48 h increased MRP3 mRNA levels about 3–5-fold in Caco2 cells, while ursodeoxycholic acid treatment did not enhanceMRP3 mRNA expression (Fig. 1 A). We next examined dose response to bile salt and time kinetics for up-regulation of the MRP3 gene by CDCA. Treatment with CDCA for 48 h increased mRNA levels of MRP3 about 2–5-fold in a dose-dependent manner, with a maximum increase observed at 10–100 μm (Fig. 1 B). By contrast, there was no increase of mRNA levels of the ABC transporters MDR1 and MRP2, which are expressed on the apical membrane of enterocytes by CDCA treatment (Fig. 1 B). In the time kinetic analysis with CDCA treatment,MRP3 mRNA levels were increased 2–4-fold when treated for more than 6 h with 100 μm CDCA, and maximal increase was observed at 12 h (Fig. 1 C). We determined by nuclear run-on assay that the up-regulation of MRP3 gene by CDCA was due to transcriptional control and observed enhanced transcription activity of MRP3 in the nuclear run-on assay when treated with bile salt (data not shown). We then cloned the MRP3 promoter region up to −1.9 kilobases from the ATG codon, and a series of promoter deletions were constructed in the reporter gene vector pGL3 basic vector (Fig. 2). By making a computer-aided analysis with the TFMATRIX transcription factor binding site profile data base, we identified several consensus motifs for transcription factor binding sites (Fig. 2). The luciferase activity by a series of 5′-deleted promoter constructs after 48 h of transfection without CDCA treatment (Fig. 2). Compared with p-311, the luciferase activity decreased to 50% when p-229 was assayed, suggesting that a putative positive cis-element was located in the −311/−229 region. Furthermore, we observed more than a 50% decrease in the luciferase activity by p-138 compared with p-311. These results suggest that a positive regulatory element is localized in the −311/−138 region in transfected cells. We next investigated which region of MRP3promoter was responsible for CDCA-induced activation. The luciferase activity of p-520, p-311, and p-229 was about 2–4-fold increased compared with the luciferase activity of untreated control when treated with 100 μm CDCA for 24 h. By contrast, the luciferase activity of p-138 was not increased by CDCA (Fig. 3). These results suggest that an element responsible for MRP3 promoter activation by CDCA is located between −229 and −138. This region contains two putative FTF binding elements (−222/−218 and −199/−195).Figure 3Alteration of MRP3 promoter-luciferase activity in response to CDCA in Caco2 cells. Cells were transiently transfected with one of these plasmids and pRL-CMV with or without a 100 μm concentration of the CDCA for 24 h and assayed for luciferase activity. Luciferase activities were corrected for differences in transfection efficiency byRenilla luciferase activity and were normalized to the activity of pGL3-basic vector transfected in cells. Data are shown as the means ± S.D. (error bars) of three independent experiments. ▪, none; ■, 100 μmCDCA. *, p < 0.01.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To examine whether mutations of the binding sites for FTF could affect the up-regulation of MRP3 promoter activity in response to CDCA, we made the constructs containing the promoter sequence with a specific mutation in each consensus sequence or both consensus sequences of two FTF binding elements, named p-520mut1, p-520mut2, and p-520mut3 (Fig. 4 A). Introduction of the specific mutation into either FTF1 or FTF2 and into both FTF1 and FTF2 completely inhibited CDCA-induced luciferase activity, suggesting that both of the two FTF-like elements have a regulatory role in the alteration of MRP3 expression in response to CDCA. The p-520mut1, p-520mut2, and p-520mut3 constructs showed no apparent change of the basal transcriptional activity in the absence of CDCA treatment, suggesting that these mutations did not affect the basalMRP3 promoter activity (Fig. 4 B). To investigate whetherMRP3 transcription activated by CDCA was altered by the interplay of FTF, we performed EMSA to study interaction ofMRP3 promoter with FTF sequence by using nuclear extracts of Caco2 cells after CDCA treatment for 12 h. The DNA sequence of the sense strand of oligonucleotide, FTF, is listed in Fig. 5 A. We also made three types of mutant oligonucleotides containing the internal mutations of FTF binding elements of oligonucleotides FTF1, FTF2, and FTF3 (Mut-FTF1, Mut-FTF2, and Mut-FTF3, respectively). In addition, we made Mut-FTF4, oligonucleotides containing the internal mutations between the two FTF binding elements (Fig. 5 A). EMSA was performed using the radiolabeled FTF as a probe. The retarded band (a) was observed when the probe FTF interacted with nuclear extracts of CDCA-treated cells (Fig. 5 B). The specificity of the DNA-protein interaction was demonstrated by appropriate competition assays. The upper retarded band (a) was almost completely obscured by a 20-fold excess of the unlabeled oligonucleotides FTF, FTF1, and FTF2 (Fig. 5 B). The exogenous addition of excess amounts of mutant oligonucleotides Mut-FTF1 and Mut-FTF2, containing mutations of one of the FTF binding elements, and Mut-FTF4, containing the internal mutations between the two FTF binding elements, could also inhibit the protein binding to the probe FTF (Fig. 5 B). By contrast, Mut-FTF3, oligonucleotides containing mutations in both of the two FTF binding elements, did not obscure the retarded band (a) (Fig. 5 B). To examine whether the nuclear factor interacting with the FTF element on MRP3 promoter is FTF, we used a specific antibody developed against the FTF. Nuclear extract was preincubated with antibodies raised against a peptide corresponding to the DNA binding domain of FTF, and the retarded band was abolished (Fig. 6), but preimmune serum did not affect the retarded band. The protein that bound to the probe FTF appears to be FTF. We examined whether the expression of the FTF gene was affected by CDCA. In Northern blot analysis by using Caco2 cells treated with or without 100 μm of CDCA for 48 h, we observed that humanFTF mRNA levels were markedly increased by treatment with CDCA (Fig. 7). We next confirmed if FTF could directly modulate MRP3 promoter activity when FTF was overexpressed in COS7 cells (Fig. 8). The luciferase activity of p-520 was about 3-fold increased when 200 ng of pCI-FTF was co-transfected. By contrast, introduction of the specific mutation into either FTF1 or FTF2 and into both FTF1 and FTF2 completely inhibited FTF-induced luciferase activity.Figure 8Alteration of MRP3 promoter-luciferase activity by overexpression of FTF in COS7 cells. Cells were transiently transfected with one of these plasmids and pRL-CMV with or without 200 ng of pCI-FTF for 48 h and assayed for luciferase activity. Luciferase activities were corrected for differences in transfection efficiency by Renilla luciferase activity and were normalized to the activity of pGL3-basic vector transfected in cells. Data are shown as the means ± S.D. (error bars) of three independent experiments. ▪, none; ■, 200 ng of pCI-FTF. *, p < 0.01View Large Image Figure ViewerDownload Hi-res image Download (PPT) In our present study, we observed that the cellular mRNA levels of MRP3 were increased about 3-fold in human colon cells by various bile salts such as CDCA, TCDCA, and taurocholic acid, while the expression of the other ABC transporters MDR1 and MRP2 in apical enterocyte membrane was not enhanced (Fig. 1). These findings suggest that a basolateral export system via MRP3 may secrete bile salts into portal blood and protect enterocytes from further intracellular accumulation of bile salts. However, it remains to be determined whether MRP3 is directly involved in the efflux pathway for bile salts in enterocytes. We observed that transcriptional control by FTF was an underlying mechanism for the up-regulation of theMRP3 gene in enterocytes by bile salts. In our present study, the luciferase activity driven by p-520, p-311, and p-229 was increased about 3-fold over the basal level when treated with 100 μm of CDCA for 12 h, but the luciferase activity driven by p-138 was not changed, and the alteration of MRP3promoter activity was comparable with induction of cellularMRP3 mRNA levels. These findings suggested that putative bile salt-responsive elements existed in the region between −229 and −138 (Fig. 3). This region contains two FTF-like elements (−222/−218 and −199/−195), suggesting the close involvement of FTF in bile salt-induced up-regulation of the MRP3 gene in enterocytes. FTF, a member of the Ftz-F1 family of orphan receptors, is expressed in the liver, pancreas, and gut, and it plays a role in hepatocyte bile salt synthesis. Feedback repression by bile salts of theCYP7A1 gene is mediated through interaction of FTF with its heterodimeric partner, the small heterodimer partner, induced by bile salt receptor FXR (10Nitta M. Ku S. Brown C. Okamoto A.Y. Shan B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6660-6665Crossref PubMed Scopus (249) Google Scholar, 43Lu T.T. Makishima M. Repa J.J. Schoonjans K. Kerr T.A. Auwerx J. Mangelsdorf D.J. Mol. Cell. 2000; 6: 507-515Abstract Full Text Full Text PDF PubMed Scopus (1229) Google Scholar, 44Goodwin B. Jones S.A. Price R.R. Watson M.A. McKee D.D. Moore L.B. Galardi C. Wilson J.G. Lewis M.C. Roth M.E. Maloney P.R. Willson T.M. Kliewer S.A. Mol. Cell. 2000; 6: 517-526Abstract Full Text Full Text PDF PubMed Scopus (1515) Google Scholar). Furthermore, FTF appears to be essential for both expression and bile acid-mediated regulation of sterol 12α-hydroxylase (9del Castillo-Olivares A. Gil G. Nucleic Acids Res. 2000; 28: 3587-3593Crossref PubMed Google Scholar, 45del Castillo-Olivares A. Gil G. J. Biol. Chem. 2000; 275: 17793-17799Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). Taking into consideration these results together, FTF appears to play an important role in the maintenance of bile acids and cholesterol homeostasis. Several series of promoter constructs with a specific mutation in the consensus sequence of FTF showed no increase of the basal transcriptional activity by CDCA (Fig. 4 B). Both FTF-like elements seem likely to have a regulatory role in MRP3expression in response to CDCA. These mutations of FTF-like elements did not affect the basal transcriptional activity (Fig. 4 B). In contrast, FTF appears to play a key role in the basal gene expression of both CYP7A1 and 12α-hydroxylase (9del Castillo-Olivares A. Gil G. Nucleic Acids Res. 2000; 28: 3587-3593Crossref PubMed Google Scholar, 45del Castillo-Olivares A. Gil G. J. Biol. Chem. 2000; 275: 17793-17799Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). The regulatory involvement of FTF in MRP3 gene expression might be different from CYP7A1 and 12α-hydroxylase gene expression. One could argue if any other factor might have a regulatory role in the basal expression of MRP3 gene. Our previous study indicated that the liver-abundant transcription factor C/EBPβ at −356/−343 is required for the expression of another MRP family member, MRP2, in hepatocytes (41Tanaka T. Uchiumi T. Hinoshita E. Inokuchi A. Toh S. Wada M. Takano H. Kohno K. Kuwano M. Hepatology. 1999; 30: 1507-1512Crossref PubMed Scopus (84) Google Scholar). The MRP3promoter also contains C/EBPβ at −820/−520 and C/EBPα at −520/−461 (Fig. 2). However, deletion constructs of these sequences at −820/−520 and at −520/−461 showed significant promoter activity in enterocytes (Fig. 2). The MRP3 gene is abundantly expressed in colon, small intestine, and liver in human (23Uchiumi T. Hinoshita E. Haga S. Nakamura T. Tanaka T. Toh S. Furukawa M. Kawabe T. Wada M. Kagotani K. Okumura K. Kohno K. Akiyama S. Kuwano M. Biochem. Biophys. Res. Commun. 1998; 9: 103-110Crossref Scopus (85) Google Scholar), but C/EBPα and C/EBPβ might not be responsible for expression of theMRP3 gene in human colon cells. Treatment with oxysterol, ligands of LXR, in fibroblasts or macrophages dramatically enhanced expression of the putative cholesterol/phospholipid ABC transporter ABCA1 through an oxysterol receptor, LXR (46Venkateswaran A. Laffitte B.A. Joseph S.B. Mak P.A. Wilpitz D.C. Edwards P.A. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12097-12102Crossref PubMed Scopus (844) Google Scholar). A relevant study by Repa et al. (47Repa J.J. Turley S.D. Lobaccaro J.A. Medina J. Li L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1150) Google Scholar) has also demonstrated that both LXR and FXR are the retinoid X receptor heterodimeric partners that mediate expression of ABCA1 andCYP7A1 genes, resulting in regulation of cholesterol homeostasis. Although the LXR motif exists at −311/−229 on the humanMRP3 promoter, our present study showed that the bile salt-responsive element was −229/−138. Moreover, MRP3promoter sequence does not contain the motifs corresponding to FXR and retinoid X receptor, suggesting the existence of pleiotropic regulatory mechanisms for expression of other relevant genes involving bile acids homeostasis. In EMSA, a specific protein-DNA binding activity was observed when treated with CDCA (Fig. 5 B). This protein-DNA binding activity was abolished when anti-FTF antibody was exogenously added, suggesting that the binding protein is in fact FTF (Fig. 6). Binding of the nuclear factor (FTF) to the oligonucleotide FTF binding sites was almost completely blocked by the unlabeled oligonucleotides and also by oligonucleotide containing the internal mutation of one of the two FTF sites (Fig. 5 B). By contrast, there appeared to be no competition resulting from the presence of the oligonucleotides containing mutation in both FTF sites. It appears likely that FTF binds to the two FTF sites on the MRP3 promoter and also that the FTF binding to both FTF sites is requisite for bile salt-inducedMRP3 promoter activation. The expression levels of FTF mRNA as well asMRP3 mRNA were markedly increased by CDCA (Fig. 7). Overexpression of FTF enhanced MRP3 promoter activity but not when mutations were introduced in one or two FTF-like elements in the MRP3 promoter (Fig. 8). These results suggested that bile salts might up-regulate the MRP3 gene through transcriptional control by altering the expression levels of FTF and also by interacting with as yet unidentified co-factors. Since bile acids do not act as ligand of FTF (45del Castillo-Olivares A. Gil G. J. Biol. Chem. 2000; 275: 17793-17799Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar), another factor mediating bile acid-dependent induction might be required. Further study is needed to know whether any other factor could also be responsible for bile acid-induced regulation in addition to FTF. Bile salts often exert negative feedback regulation on their own synthesis in hepatocytes and interruption of the enterohepatic circulation enhanced cholesterol and bile acid synthesis, suggesting that a similar molecular basis of interaction of FTF and its two sites is responsible for bile acid-induced regulation of cholesterol bile acid biosynthesis and bile acid efflux transporter, MRP3. A recent study reported that FTF was induced by bile acid-activated FXR in hepatocytes (48Chen W. Owsley E. Yang Y. Stroup D. Chiang J.Y.L. J. Lipid Res. 2001; 42: 1402-1412Abstract Full Text Full Text PDF PubMed Google Scholar) and might play its critical role in bile salt-induced alteration of relevant gene expression. FTF gene in enterocytes thus appears to be regulated in a way similar to the event in hepatocytes. In conclusion, bile acid enhanced the expression of an ABC transporter, MRP3, which is known to efflux bile acids in human colon cells. This up-regulation of MRP3 by bile acid was mediated through binding of FTF to its binding sites on the MRP3 promoter. The results of these recent studies indicate that during enterohepatic circulation of bile salts, the transcription factor FTF may play a key role not only in bile acid biosynthesis in the liver but also in expression of MRP3 in the gut in response to bile acids (Fig. 9). We suspect that the ABC transporter, MRP3, might also be involved in cholesterol/bile acid homeostasis. We thank Dr. David W. Russell for anti-FTF antibodies and Dr. Luc Belanger for pCI-FTF plasmid. We also thank Morimasa Wada, Toshiya Tanaka, Satoshi Toh, Sei Haga, and Takanori Nakamura for helpful discussion." @default.
• W2012607246 created "2016-06-24" @default.
• W2012607246 creator A5011966088 @default.
• W2012607246 creator A5014628526 @default.
• W2012607246 creator A5053590502 @default.
• W2012607246 creator A5059010005 @default.
• W2012607246 creator A5082131946 @default.
• W2012607246 creator A5085314163 @default.
• W2012607246 date "2001-12-01" @default.
• W2012607246 modified "2023-10-05" @default.
• W2012607246 title "Enhanced Expression of the Human Multidrug Resistance Protein 3 by Bile Salt in Human Enterocytes" @default.
• W2012607246 cites W109648843 @default.
• W2012607246 cites W1570865673 @default.
• W2012607246 cites W1580386589 @default.
• W2012607246 cites W1862042053 @default.
• W2012607246 cites W1969721624 @default.
• W2012607246 cites W1978017146 @default.
• W2012607246 cites W1982640074 @default.
• W2012607246 cites W1988985926 @default.
• W2012607246 cites W1990819179 @default.
• W2012607246 cites W2002667678 @default.
• W2012607246 cites W2013019095 @default.
• W2012607246 cites W2037297309 @default.
• W2012607246 cites W2038081828 @default.
• W2012607246 cites W2044181209 @default.
• W2012607246 cites W2051040521 @default.
• W2012607246 cites W2053581007 @default.
• W2012607246 cites W2053706150 @default.
• W2012607246 cites W2053916731 @default.
• W2012607246 cites W2058442140 @default.
• W2012607246 cites W2058557591 @default.
• W2012607246 cites W2060297699 @default.
• W2012607246 cites W2061569374 @default.
• W2012607246 cites W2062858429 @default.
• W2012607246 cites W2064618358 @default.
• W2012607246 cites W2064966728 @default.
• W2012607246 cites W2068458442 @default.
• W2012607246 cites W2074134894 @default.
• W2012607246 cites W2081699679 @default.
• W2012607246 cites W2084490127 @default.
• W2012607246 cites W2085909854 @default.
• W2012607246 cites W2093296161 @default.
• W2012607246 cites W2094220461 @default.
• W2012607246 cites W2096204304 @default.
• W2012607246 cites W2134492379 @default.
• W2012607246 cites W2140403969 @default.
• W2012607246 cites W2141283740 @default.
• W2012607246 cites W2144668313 @default.
• W2012607246 cites W2144693938 @default.
• W2012607246 cites W2154283357 @default.
• W2012607246 cites W2168070336 @default.
• W2012607246 cites W2171398834 @default.
• W2012607246 cites W2171535154 @default.
• W2012607246 doi "https://doi.org/10.1074/jbc.m104612200" @default.
• W2012607246 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11590139" @default.
• W2012607246 hasPublicationYear "2001" @default.
• W2012607246 type Work @default.
• W2012607246 sameAs 2012607246 @default.
• W2012607246 citedByCount "108" @default.
• W2012607246 countsByYear W20126072462012 @default.
• W2012607246 countsByYear W20126072462013 @default.
• W2012607246 countsByYear W20126072462014 @default.
• W2012607246 countsByYear W20126072462015 @default.
• W2012607246 countsByYear W20126072462017 @default.
• W2012607246 countsByYear W20126072462018 @default.
• W2012607246 countsByYear W20126072462021 @default.
• W2012607246 crossrefType "journal-article" @default.
• W2012607246 hasAuthorship W2012607246A5011966088 @default.
• W2012607246 hasAuthorship W2012607246A5014628526 @default.
• W2012607246 hasAuthorship W2012607246A5053590502 @default.
• W2012607246 hasAuthorship W2012607246A5059010005 @default.
• W2012607246 hasAuthorship W2012607246A5082131946 @default.
• W2012607246 hasAuthorship W2012607246A5085314163 @default.
• W2012607246 hasBestOaLocation W20126072461 @default.
• W2012607246 hasConcept C104317684 @default.
• W2012607246 hasConcept C133936738 @default.
• W2012607246 hasConcept C147789679 @default.
• W2012607246 hasConcept C185592680 @default.
• W2012607246 hasConcept C2776371256 @default.
• W2012607246 hasConcept C2777882243 @default.
• W2012607246 hasConcept C2779604457 @default.
• W2012607246 hasConcept C501593827 @default.
• W2012607246 hasConcept C55493867 @default.
• W2012607246 hasConcept C6856738 @default.
• W2012607246 hasConcept C86803240 @default.
• W2012607246 hasConcept C95444343 @default.
• W2012607246 hasConceptScore W2012607246C104317684 @default.
• W2012607246 hasConceptScore W2012607246C133936738 @default.
• W2012607246 hasConceptScore W2012607246C147789679 @default.
• W2012607246 hasConceptScore W2012607246C185592680 @default.
• W2012607246 hasConceptScore W2012607246C2776371256 @default.
• W2012607246 hasConceptScore W2012607246C2777882243 @default.
• W2012607246 hasConceptScore W2012607246C2779604457 @default.
• W2012607246 hasConceptScore W2012607246C501593827 @default.
• W2012607246 hasConceptScore W2012607246C55493867 @default.
• W2012607246 hasConceptScore W2012607246C6856738 @default.
• W2012607246 hasConceptScore W2012607246C86803240 @default.
• W2012607246 hasConceptScore W2012607246C95444343 @default.

• next