FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012808819> ?p ?o ?g. }

• W2012808819 endingPage "30537" @default.
• W2012808819 startingPage "30526" @default.
• W2012808819 abstract "To delineate the functional protein domains necessary for the biological activity of hepatocyte growth factor-like protein (HGFL), we created various site-directed and deletion mutated cDNAs coding for this protein. Wild-type and mutated versions of HGFL were produced after transfection of the corresponding cDNAs into tissue culture cells. The biological importance of the domains within HGFL was then examined by addition of recombinant wild-type or mutant forms of HGFL to assays aimed at elucidating regions involved in the stimulation of DNA synthesis, the induction of shape changes in macrophages, and the ability to stimulate cell scattering. Mutant proteins lacking the serine protease-like domain (light chain) were not biologically active in any of the assays tested and could not compete with wild-type HGFL in cell scattering experiments. These data, in addition to direct enzyme-linked immunosorbent assay analyses, suggest that the light chain may play an important role in the interaction of HGFL with its receptor, Ron. Elimination of the proposed protease cleavage site between the heavy and light chains (by mutation of Arg-483 to Glu) produced a protein with activity comparable to wild-type HGFL. Further studies with this mutated protein uncovered an additional proteolytic cleavage site that produces biologically active protein. Deletion of the various kringle domains or the amino-terminal hairpin loop had various effects in the multiple assays. These data suggest that the heavy chain may play a pivotal role in determining the functional aspects of HGFL. To delineate the functional protein domains necessary for the biological activity of hepatocyte growth factor-like protein (HGFL), we created various site-directed and deletion mutated cDNAs coding for this protein. Wild-type and mutated versions of HGFL were produced after transfection of the corresponding cDNAs into tissue culture cells. The biological importance of the domains within HGFL was then examined by addition of recombinant wild-type or mutant forms of HGFL to assays aimed at elucidating regions involved in the stimulation of DNA synthesis, the induction of shape changes in macrophages, and the ability to stimulate cell scattering. Mutant proteins lacking the serine protease-like domain (light chain) were not biologically active in any of the assays tested and could not compete with wild-type HGFL in cell scattering experiments. These data, in addition to direct enzyme-linked immunosorbent assay analyses, suggest that the light chain may play an important role in the interaction of HGFL with its receptor, Ron. Elimination of the proposed protease cleavage site between the heavy and light chains (by mutation of Arg-483 to Glu) produced a protein with activity comparable to wild-type HGFL. Further studies with this mutated protein uncovered an additional proteolytic cleavage site that produces biologically active protein. Deletion of the various kringle domains or the amino-terminal hairpin loop had various effects in the multiple assays. These data suggest that the heavy chain may play a pivotal role in determining the functional aspects of HGFL. Hepatocyte growth factor-like protein (HGFL) 1The abbreviations used are: HGFL, hepatocyte growth factor-like protein; HGF, hepatocyte growth factor; CHO, Chinese hamster ovary; STI, soybean trypsin inhibitor; PBS, phosphate-buffered saline; WT, wild-type; BrdUrd, 5-bromo-2′-deoxyuridine; MDCK, Madin-Darby canine kidney; DMEM, Dulbecco's modified Eagle's medium; ELISA, enzyme-linked immunosorbent assay. 1The abbreviations used are: HGFL, hepatocyte growth factor-like protein; HGF, hepatocyte growth factor; CHO, Chinese hamster ovary; STI, soybean trypsin inhibitor; PBS, phosphate-buffered saline; WT, wild-type; BrdUrd, 5-bromo-2′-deoxyuridine; MDCK, Madin-Darby canine kidney; DMEM, Dulbecco's modified Eagle's medium; ELISA, enzyme-linked immunosorbent assay. was initially isolated by virtue of its sequence homology to domains in proteins involved in blood coagulation and fibrinolysis (1Han S. Stuart L.A. Degen S.J.F. Biochemistry. 1991; 30: 9768-9780Crossref PubMed Scopus (159) Google Scholar, 2Han S. Degen S.J.F. Goldberg I.D. Rosen E. Hepatocyte Growth Factor/Scatter Factor and the c-Met Receptor. Birkhauser Verlag Co., Basel, Switzerland1993: 61-105Google Scholar, 3Degen S.J.F. Stuart L.A. Han S. Jamison C.S. Biochemistry. 1991; 30: 9781-9791Crossref PubMed Scopus (67) Google Scholar) and by virtue of its functional ability to induce macrophage activation (4Leonard E. Skeel A. Exp. Cell Res. 1978; 114: 117-126Crossref PubMed Scopus (57) Google Scholar, 5Leonard E. Skeel A. Exp. Cell Res. 1976; 102: 434-438Crossref PubMed Scopus (94) Google Scholar). HGFL has been shown to be synthesized as a single polypeptide chain that is proteolytically cleaved to an active disulfide-linked heterodimer. The large α or heavy chain encodes an amino-terminal hairpin loop structure, homologous to the preactivation peptide in plasminogen, and four kringle domains. Kringle domains are triple disulfide-bonded loop structures composed of approximately 80 amino acids that are thought to be important in protein:protein interactions. The small β or light chain contains a serine protease-like domain in which the three active site amino acids have been changed such that protease activity is unlikely. The cDNA for HGFL codes for a protein of approximately 80 kDa containing 711 amino acids and three potential N-linked carbohydrate addition sites (1Han S. Stuart L.A. Degen S.J.F. Biochemistry. 1991; 30: 9768-9780Crossref PubMed Scopus (159) Google Scholar). However, the exact size of the two chains of HGFL as determined by Western analysis has been placed at anywhere from 45 kDa to 62 kDa for the heavy chain and approximately 25–35 kDa for the light chain (6Bezerra J.A. Laney Jr., D.W. Degen S.J.F. Biochem. Biophys. Res. Commun. 1994; 203: 666-673Crossref PubMed Scopus (25) Google Scholar, 7Bezerra J.A. Han S. Danton M.J.S. Degen S.J.F. Protein Sci. 1993; 2: 666-668Crossref PubMed Scopus (22) Google Scholar, 8Wang M.-H. Skeel A. Yoshimura T. Copeland T.D. Sakaguchi K. Leonard E.J. J. Leukocyte Biol. 1993; 54: 289-295Crossref PubMed Scopus (29) Google Scholar). HGFL has been classified in the same growth factor family as hepatocyte growth factor (HGF), with both proteins having a strikingly similar domain structure composed of the NH2-terminal hairpin loop, four kringle domains, and a serine protease-like domain. Because of this similarity, HGFL is thought to elicit a broad range of functions as has been determined for HGF. However, in contrast to the wide expression patterns of HGF, HGFL has been shown to be produced primarily by liver hepatocytes (9Bezerra J.A. Witte D.P. Aronow B.M. Degen S.J.F. Hepatology. 1993; 18: 394-399PubMed Google Scholar). To date, several functions for HGFL have been determined, including the ability to stimulate mouse resident peritoneal macrophage (4Leonard E. Skeel A. Exp. Cell Res. 1978; 114: 117-126Crossref PubMed Scopus (57) Google Scholar), to induce cellular proliferation (10Gaudino G. Follenzi A. Naldini L. Collesi C. Santoro M. Gallo K.A. Godowski P.J. Comoglio P.M. EMBO J. 1994; 13: 3524-3532Crossref PubMed Scopus (291) Google Scholar, 11Wang M.-H. Skeel A. Leonard E.J. J. Clin. Invest. 1996; 97: 720-727Crossref PubMed Scopus (74) Google Scholar, 12Iwama A. Yamaguchi N. Suda T. EMBO J. 1996; 15: 5866-5875Crossref PubMed Scopus (124) Google Scholar), to induce cell motility (13Santoro M.M. Collesi C. Grisendi S. Gaudino G. Comoglio P.M. Mol. Cell. Biol. 1996; 16: 7072-7083Crossref PubMed Scopus (91) Google Scholar), to bring about cellular apoptosis (12Iwama A. Yamaguchi N. Suda T. EMBO J. 1996; 15: 5866-5875Crossref PubMed Scopus (124) Google Scholar), and to stimulate bone resorption (14Kurihara N. Iwama A. Tatsumi J. Ikeda K. Suda T. Blood. 1996; 87: 3704-3710Crossref PubMed Google Scholar). These functions are thought to be brought about by the binding of HGFL to its membrane-bound receptor, Ron (10Gaudino G. Follenzi A. Naldini L. Collesi C. Santoro M. Gallo K.A. Godowski P.J. Comoglio P.M. EMBO J. 1994; 13: 3524-3532Crossref PubMed Scopus (291) Google Scholar, 15Wang M.-H. Ronsin C. Gesnel M.-C. Coupey L. Skeel A. Leonard E.J. Breathnach R. Science. 1994; 266: 117-119Crossref PubMed Scopus (247) Google Scholar). However, the various functions of HGFL appear to be dependent on cell type and/or Ron expression levels, with no single cell performing all functions. As is the case for the ligands, the Ron gene product displays strong structural homology with the HGF receptor, Met (16Iwama A. Okano K. Sudo T. Matsuda Y. Suda T. Blood. 1994; 83: 3160-3169Crossref PubMed Google Scholar). The Met receptor family encodes a variety of transmembrane tyrosine kinase receptors including the HGFL receptor, Ron, and avian SEA (17Huff J.L. Jelinek M.A. Borgman C.A. Lansing T.J. Parsons T.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6140-6144Crossref PubMed Scopus (122) Google Scholar). Ron is a heterodimeric transmembrane glycoprotein expressed relatively late in development in the central and peripheral nervous system, in cells of developing bones and in epithelia along the digestive tract, skin, and lungs (18Quantin B. Schuhbaur B. Gesnel M.-C. Dolle P Breathnach R. Dev. Dyn. 1995; 204: 383-390Crossref PubMed Scopus (37) Google Scholar, 19Gaudino G. Avantaggiato V. Follenzi A. Acampora D. Simeone A. Comoglio P.M. Oncogene. 1995; 11: 2627-2637PubMed Google Scholar). Ron is synthesized as a single-chain precursor of 185 kDa. After synthesis, Ron is cleaved into a disulfide linked heterodimer consisting of a 35-kDa α chain and 150-kDa β chain. The α chain and amino-terminal region of the β chain are present at the cell surface. The cytoplasmic portion of Ron contains the kinase domain and phosphorylation sites required for eliciting activity through HGFL binding. Based on the pleiotropic effects of HGFL, the aims of the experiments presented in this paper were to elucidate the essential regions or domains in HGFL that may be required to elicit preferential biological activities. To accomplish this goal, a series of HGFL cDNAs lacking various domains or containing point mutations were constructed. Representative recombinant proteins were then produced and assayed for their ability to elicit cellular proliferation, macrophage activation, and cell scattering functions. Our findings represent an initial dissection of HGFL protein function and suggest the necessity of the light chain containing the serine protease-like domain for HGFL activity. Further, our results demonstrate the requirement of the various kringle domains for modulating protein activity. All mutants were generated using the pAlter1 mutagenesis kit (Promega, Madison, WI) with the appropriate mutagenic oligonucleotide listed in Table I and a wild-type human HGFL cDNA cloned into pAlter1. The wild-type HGFL cDNA is the cDNA presented in Han et al. (1Han S. Stuart L.A. Degen S.J.F. Biochemistry. 1991; 30: 9768-9780Crossref PubMed Scopus (159) Google Scholar), with the sequence from exon 1 included at its 5′ end. Mutants were identified by polymerase chain reaction and sequence analysis (ΔK1, ΔK2, ΔK3, ΔK4, ΔK1K2, and ΔPAP) or by sequence analysis alone (Glu, Xa, IIa, ΔL, and K1K2). All mutants were cloned into theEcoRI site of the eukaryotic expression vector pcDNA3 (Invitrogen, Carlsbad, CA) in the proper orientation for expression after transient and stable transfections.Table IOligonucleotides used in creating wild-type and mutant forms of HGFLMutantNucleotidesHGFL sequenceStrandΔPAP146–165, 235–254ATGTGGCAGATGCTGAAGAGCAACTGCTGCCATGGACTCACodingΔK1308–327, 559–578AGAAAGACTACGTACGGACCCGGGAGGCCGCGTGTGTCTGCodingΔK2539–558, 805–824GCTGCGGCATCAAATCCTGCGGGTCCGAGGCACAGCCCCGCodingΔK3827–846, 1084–1103AAGAGGCCACAACTGTCAGCACAGACGACGTGCGGCCCCACodingΔK41088–1107, 1345–1364ACGACGTGCGGCCCCAGGACGCTGATGACCAGCCGCCATCCodingΔK1K2308–327, 805–824AGAAAGACTACGTACGGACCGGGTCCGAGGCACAGCCCCGCodingΔL1435–14641-aInserted stop codon (lowercase).CGTTCCAAGCTGCGCtagGTGGTTGGGGGCCATCodingK1K2805–8341-aInserted stop codon (lowercase).GGGTCCGAGGCACAGtagCCCCGCCAAGAGGCCCodingGlu1432–14641-bNucleotide substitutions to replace activation site with Glu for Arg-483, thrombin (Leu-Val-Pro-Arg), or factor Xa (Ile-Glu-Gly-Arg) recognition sequence (lowercase).CGGCGTTCCAAGCTGgagGTGGTTGGGGGCCATCodingXa1423–14611-bNucleotide substitutions to replace activation site with Glu for Arg-483, thrombin (Leu-Val-Pro-Arg), or factor Xa (Ile-Glu-Gly-Arg) recognition sequence (lowercase).CTGGATCAGCGGCGTatcgaaggtCGCGTGGTTGGGGGCCodingIIa1423–14611-bNucleotide substitutions to replace activation site with Glu for Arg-483, thrombin (Leu-Val-Pro-Arg), or factor Xa (Ile-Glu-Gly-Arg) recognition sequence (lowercase).CTGGATCAGCGGCGTctggttccgCGCGTGGTTGGGGGCCoding48G24–531-cDifference with Ref. 20.CCAGGGACCCCTAAGcATTGAGTCAGAAGCNon-coding1-a Inserted stop codon (lowercase).1-b Nucleotide substitutions to replace activation site with Glu for Arg-483, thrombin (Leu-Val-Pro-Arg), or factor Xa (Ile-Glu-Gly-Arg) recognition sequence (lowercase).1-c Difference with Ref. 20Yoshimura T. Yuhki N. Wang M.-H. Skeel A. Leonard E.J. J. Biol. Chem. 1993; 268: 15461-15468Abstract Full Text PDF PubMed Google Scholar. Open table in a new tab One additional mutation was generated at nucleotide 48 in the signal sequence. Our original cDNA had an A at this position, whereas a G was present in the gene. This resulted in a tyrosine at amino acid 13 in the cDNA and a cysteine at this position in the gene. Because we were not sure what this difference would have on the expression of recombinant HGFL, we performed site-directed mutagenesis using the Chameleon kit (Stratagene, La Jolla, CA) and oligonucleotide 48G. The appropriate substitution was identified by DNA sequence analysis. CMT-93 (mouse rectum carcinoma), 293 (transformed human primary kidney), HT-29 (human colon adenocarcinoma), and CHO (Chinese hamster ovary) cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, 2 mml-glutamine, and 50 μg/ml gentamicin. For production of recombinant HGFL and HGFL mutant proteins, the corresponding cDNAs were transfected into tissue culture cells as described previously (21Waltz S.E. Gould F.K. Air E.L. McDowell S.A. Friezher-Degen S.J.F. J. Biol. Chem. 1996; 271: 9024-9032Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar). For transient protein expression, 293 cells were transfected and on the following day placed in serum-free medium for 5 additional days. For stable protein expression, CHO cells were transfected and placed in 400 μg/ml Geneticin (Life Technologies, Inc.). After selection, single colonies were isolated and cultured for 5 days in serum-free medium. The amount of recombinant HGFL protein from cell supernatants was measured by immunoblotting. For analysis of secreted recombinant protein, cell culture supernatants were resolved by SDS-polyacrylamide gel electrophoresis on 10% gels under denaturing conditions. After electrophoresis, the proteins were transferred by electrophoresis to polyvinylidene fluoride membranes in 25 mm Tris-HCl, 192 mm glycine, and 20% methanol at 4 °C for 4 h at 250 mA. The membrane was probed with a polyclonal anti-HGFL rabbit antibody. The polyclonal antibody extensively used for HGFL detection was raised in rabbits against a fusion protein of β-galactosidase and a 960-base pair cDNA fragment coding for 321 amino acids of human HGFL (including part of the second kringle to the carboxyl terminus of the protein, which included part of the serine protease-like domain). This antibody recognizes mouse, rat, and human HGFL (7Bezerra J.A. Han S. Danton M.J.S. Degen S.J.F. Protein Sci. 1993; 2: 666-668Crossref PubMed Scopus (22) Google Scholar). The membrane was then incubated with a biotinylated goat anti-rabbit antibody, followed by incubation with a preformed avidin and biotinylated horseradish peroxidase complex (Vector Laboratories, Burlingame, CA). A horseradish peroxidase luminescent visualization system (ECL, Amersham Life Science) was applied, and the membrane was exposed to x-ray film. A known amount of HGFL was used as a standard to determine the concentration of each recombinant protein by Western analysis. Recombinant protein was produced from all cDNA expression vectors with a range of concentrations from about 0.5 to 7 μg/ml in serum-free medium. Alternatively, an enzyme-linked immunosorbent assay (ELISA) was developed for protein quantification. Protein samples (native or reduced) were incubated in Nunc immunoplates overnight at 4 °C. Plates were washed and incubated with primary antibody, washed again, and incubated with a donkey anti-rabbit secondary antibody conjugated with horseradish peroxidase. Peroxidase substrate was added, and the absorbance measured at 490 nm after color development. Samples were assayed against a concentration curve of wild-type human HGFL protein as a standard. To analyze if activation of HGFL was important before or during the functional assays, HGFL functions were tested with recombinant protein, which was cleaved by porcine or human kallikrein (Enzyme Research Laboratories, South Bend, IN) at 50–100 nm. Kallikrein has been shown to cleave plasma HGFL into a functional heterodimer (22Wang M.-H. Yoshimura T. Skeel A. Leonard E.J. J. Biol. Chem. 1994; 269: 3436-3440Abstract Full Text PDF PubMed Google Scholar). No functional differences between kallikrein species were detected. Furthermore, the use of soybean trypsin inhibitor (STI) in macrophage stimulation assays has been shown to enhance function (11Wang M.-H. Skeel A. Leonard E.J. J. Clin. Invest. 1996; 97: 720-727Crossref PubMed Scopus (74) Google Scholar). All functional assays were also performed in combination with STI (Sigma). Identical results were obtained in all assays regardless of the use of kallikren, STI, or a combination of both before or during biological testing. CMT-93 cells were seeded in triplicate in 100 μl of complete medium at a concentration of 5 × 103 cells/well in a 96-well tissue culture plate. Two days later, the medium was aspirated and 200 μl of medium containing 0.5% serum was added. After 48 h, recombinant HGFL protein (a concentration of 200–400 ng/ml was found to be optimal) was added. Two days after recombinant protein addition, 10 μl of 5-bromo-2′-deoxyuridine (BrdUrd) was added for 16 h. The amount of BrdUrd incorporation was determined using an ELISA-based BrdUrd labeling and detection kit from Boehringer Mannheim according to the manufacturer's instructions. For the isolation of mouse resident peritoneal macrophages, the mouse was anesthetized and a small abdominal incision was made under sterile conditions. Ten milliliters of serum-free DMEM was introduced into the abdominal cavity, immediately withdrawn, and transferred to a 15-ml polypropylene tube. The cells were then centrifuged, resuspended in serum-free DMEM, and plated in six-well tissue culture dishes. Approximately 80% of the cells were macrophage, as determined microscopically. After 24 h, the cells were extensively washed with phosphate buffered saline (PBS) and recombinant protein (or untransfected conditioned medium) was added in a volume of 1–2 ml. The number of macrophage were counted after 3 h, and the percent of macrophage with shape changes were determined. After counting, the macrophage were fixed in 3% paraformaldehyde, stained with hematoxylin, and photographed. For the isolation of lung macrophage, the mice were anesthetized and an abdominal incision was made. The mouse was exsanguinated from a cut in the inferior vena cava and abdominal aorta. The anterior neck was dissected and the trachea cannulated with a 18-gauge catheter. The lungs were then perfused with 3 ml of serum-free DMEM, and the medium was immediately withdrawn and transferred to a polypropylene tube. This step was repeated to a total perfusion volume of 10 ml. The cells were then centrifuged, resuspended in serum-free DMEM, and plated in six-well tissue culture dishes. Approximately 80% of the cells were lung macrophage. Recombinant protein or control medium was applied as for peritoneal macrophages. A 293 cell line expressing the mouse Ron receptor was obtained by transfection with a full-length mouse Ron cDNA in pcDNA3 (Invitrogen). A clonal line (293/Ron) was isolated and used for further studies. For scattering assays, an approximately 70% confluent plate of 293/Ron cells was split 1:100 and placed in six-well tissue culture plates containing 5 ml of complete medium/well. The following day, the medium was aspirated and the cells were cultured with various concentrations of wild-type or deletion mutants of HGFL for 24–48 h. After culture, the cells were fixed in 3% paraformaldehyde and stained with hematoxylin. 293/Ron cells were grown to approximately 70% confluence in 60-mm tissue culture plates in complete medium. The cells were washed three times with ice-cold PBS, and recombinant protein (or appropriate controls) was added for 1 h at 37 °C. Detachment from the tissue culture plates was accomplished in 2 ml of Versene in PBS. The cells were rinsed twice in ice-cold PBS, followed by resuspension in a solution of PBS containing 1% bovine serum albumin and a 1:1 mixture of antibodies directed against HGFL and an anti-rabbit-fluorescein conjugate. After a 30-min incubation period on ice, the cells were washed twice with ice-cold PBS followed by fixation in PBS containing 1% paraformaldehyde. The cells were then analyzed by measuring fluorescence intensity on a Becton Dickinson FACScan flow cytometer. Results are expressed as the mean channel fluorescence of 10,000 cells using logarithmic amplification. The Ron protein was purified by an anti-Ron affinity column as described previously (42Wang M.-H. Montero-Julian F.A. Dauny I. Leonard E.J. Oncogene. 1996; 13: 2167-2175PubMed Google Scholar). To study the interaction of Ron with multiple HGFL recombinant proteins, the Ron receptor was purified, placed in a 96-well ELISA plate at 50 ng/well, and incubated overnight at 4 °C. Supernatants were collected from cells transfected with different HGFL variant cDNAs, and equal amounts of HGFL recombinant proteins were added to the wells and incubated at 37 °C for 90 min. To measure the amount of captured recombinant protein, an antibody against HGFL was added (42Wang M.-H. Montero-Julian F.A. Dauny I. Leonard E.J. Oncogene. 1996; 13: 2167-2175PubMed Google Scholar). For detection analyses, an anti-rabbit IgG antibody conjugated with horseradish peroxidase (Boehringer Mannheim) was applied to the wells. The reaction was developed with substrate, and theA 405 was measured in an ELISA plate reader. Each sample was tested in duplicate. The single-chain form of HGFL (WT HGFL up, Fig. 9) was utilized initially for these experiments. However, it became apparent that processed preparations were needed for full activity. Thus, the wild-type (WT) HGFL in Fig. 9 contains significant amounts of proteolytically cleaved protein. In an effort to identify important structural domains involved in the function of HGFL, a panel of mutated cDNAs of HGFL were constructed. Fig. 1 shows a schematic representation of the structural domains contained within the wild-type human HGFL protein (wt). The schematics shown below wild-type HGFL consist of predicted translation products generated from transfection of HGFL mutant cDNAs. Eight deletion mutants and four site-directed mutants of HGFL were created by oligonucleotide-directed mutagenesis. The deletion mutants were created by deletion of the cDNA sequence corresponding to the HGFL domain of interest (ΔPAP, ΔK1, ΔK2, ΔK3, ΔK4, ΔK1K2, or sequence following kringle 2 as in K1K2). Deletion of the light chain of HGFL (ΔL) was accomplished by creating a stop codon (TAG) after amino acid 483, immediately preceding the activation site. To study the effect of proteolytic cleavage as it relates to HGFL function, a mutation that disrupts the putative cleavage site was also created with the substitution of Glu for Arg-483 at the activation site (Glu). Furthermore, two mutations were created in which an engineered processing site for factor Xa (Xa) or thrombin (IIa) was created at the putative activation site of HGFL. The Xa processing site changed amino acids Ser-480, Lys-481, Gly-482 to Ile-480, Glu-481, and Gly-482, whereas the IIa site was created by changing these amino acids to Leu, Val, and Pro, respectively. Not shown in Fig. 1 is a mouse HGFL clone containing the full-length cDNA for expression of recombinant mouse HGFL (mwtHGFL; Ref.3Degen S.J.F. Stuart L.A. Han S. Jamison C.S. Biochemistry. 1991; 30: 9781-9791Crossref PubMed Scopus (67) Google Scholar). All of the cDNAs for the corresponding proteins in Fig. 1 were cloned into the eukaryotic expression vector pcDNA3 and transfected either stably into CHO cells or transiently into 293 cells. Serum-free culture medium from the transfected cells was used as a source of recombinant HGFL. Fig. 2 shows representative samples of culture medium from wild-type and mutant HGFLs separated under reducing conditions by SDS-polyacrylamide gel electrophoresis analysis and immunoblotted with a polyclonal antibody against HGFL. A majority of the protein products appeared to consist of the single-chain form of HGFL. In culture medium from untransfected cells, as well as both stable and transient transfections with wild-type and mutant forms of HGFL, variable nonspecific background was also seen. The band migrating at approximately 65 kDa (Fig. 2,lanes WT, Glu, and IIa) is thought to represent bovine serum albumin for several reasons. This band diminishes with the addition of bovine serum albumin during antibody incubation (data not shown), and the intensity also decreases when the cells are extensively washed with PBS (four to six times) before incubation with serum-free medium (Fig. 2, lanes ΔK1,ΔK3, and K1K2). Furthermore, this band appears to originate from serum since addition of serum to untransfected and recombinant supernatants produces a band of similar mobility. Nevertheless, recombinant protein preparations with or without this band have identical functional activities. Further, recombinant proteins purified by heparin agarose isolation performed identically in biological assays to unpurified recombinant supernatants from transfected cells (data not shown). The concentration of each mutant was determined, and equal amounts of protein were applied to the various assays. Because of the fact that HGFL has the ability to induce a variety of effects, functional analyses were performed on cells that displayed the experimental phenotype. Scattering experiments using HGF have been primarily performed on MDCK cells because of the fact that these cells form tight monolayers and express the endogenous HGF receptor. MDCK cells were not responsive to recombinant HGFL, suggesting that the Ron receptor may not be expressed by these cells (data not shown). 293 cells were then chosen for scattering experiments because these cells are easily transfected and because they displayed the same phenotypic changes seen with HGF and MDCK cells after transfection with the mouse Ron receptor cDNA. A clonal line of 293 cells containing approximately wild-type levels of exogenous Ron, as judged by Western analysis with endogenously expressing Ron cell lines, was then chosen for further study. Equal amounts of the various recombinant HGFL proteins were tested for scattering activity on this 293/Ron cell line. Fig.3 A shows the morphogenic effects of various recombinant HGFL proteins on these cells. In the absence of HGFL protein, the 293/Ron cells show a coherent morphology. In contrast, with the addition of wild-type HGFL, the cells display a scattered phenotype. A striking scattering effect was observed in an optimal range of approximately 200–400 ng/ml of wild-type HGFL. The physiologic concentration of HGFL found in human plasma is approximately 400 ng/ml (7Bezerra J.A. Han S. Danton M.J.S. Degen S.J.F. Protein Sci. 1993; 2: 666-668Crossref PubMed Scopus (22) Google Scholar). The histogram in Fig. 3 B shows a summation of the ability of each of the recombinant HGFL mutants to cause cell scattering. As is demonstrated, deletions of kringles 2 and 3 along with deletion of the light chain of HGFL results in no effect on cell scattering. HGFL has been shown to cause dramatic morphological effects on mouse peritoneal macrophage (4Leonard E. Skeel A. Exp. Cell Res. 1978; 114: 117-126Crossref PubMed Scopus (57) Google Scholar, 5Leonard E. Skeel A. Exp. Cell Res. 1976; 102: 434-438Crossref PubMed Scopus (94) Google Scholar). Among these effects are the ability to activate macrophage contractile proteins for the ingestion of complement coated erythrocytes and the ability to assume elongated shapes with increased phagocytic vesicles (4Leonard E. Skeel A. Exp. Cell Res. 1978; 114: 117-126Crossref PubMed Scopus (57) Google Scholar, 5Leonard E. Skeel A. Exp. Cell Res. 1976; 102: 434-438Crossref PubMed Scopus (94) Google Scholar). To identify domains within HGFL that are responsible for stimulating the morphogenic phenotype of these cells, stimulation of both lung and peritoneal macrophage were examined. Recombinant supernatant from cells transfected with the wild-type and mutated forms of HGFL was applied to macrophage cultures. After 3 h, the number of stimulated macrophage were counted and photographed. Fig.4 shows representative results for various recombinant mutants tested. Wild-type and various mutated versions of HGFL (such as Glu and Xa) showed an increased ability to stimulate peritoneal macrophage, as indicated by elongated shape changes. Deletion of the light chain, the amino-terminal hairpi" @default.
• W2012808819 created "2016-06-24" @default.
• W2012808819 creator A5008823362 @default.
• W2012808819 creator A5014920554 @default.
• W2012808819 creator A5021110286 @default.
• W2012808819 creator A5031387848 @default.
• W2012808819 creator A5054237800 @default.
• W2012808819 creator A5071860009 @default.
• W2012808819 creator A5082586932 @default.
• W2012808819 creator A5087585309 @default.
• W2012808819 date "1997-11-01" @default.
• W2012808819 modified "2023-10-03" @default.
• W2012808819 title "Functional Characterization of Domains Contained in Hepatocyte Growth Factor-like Protein" @default.
• W2012808819 cites W106620489 @default.
• W2012808819 cites W117902596 @default.
• W2012808819 cites W1502579708 @default.
• W2012808819 cites W1536956249 @default.
• W2012808819 cites W1572726437 @default.
• W2012808819 cites W1579494178 @default.
• W2012808819 cites W1594507882 @default.
• W2012808819 cites W1607589687 @default.
• W2012808819 cites W1639729138 @default.
• W2012808819 cites W1971965542 @default.
• W2012808819 cites W1977171839 @default.
• W2012808819 cites W1981304601 @default.
• W2012808819 cites W1989297142 @default.
• W2012808819 cites W2004296886 @default.
• W2012808819 cites W2007904495 @default.
• W2012808819 cites W2009567346 @default.
• W2012808819 cites W2016433720 @default.
• W2012808819 cites W2023092063 @default.
• W2012808819 cites W2024721474 @default.
• W2012808819 cites W2041705218 @default.
• W2012808819 cites W2048367533 @default.
• W2012808819 cites W2057743033 @default.
• W2012808819 cites W2068612413 @default.
• W2012808819 cites W2071068525 @default.
• W2012808819 cites W2076029314 @default.
• W2012808819 cites W2077120503 @default.
• W2012808819 cites W2078658029 @default.
• W2012808819 cites W2079156086 @default.
• W2012808819 cites W2086267397 @default.
• W2012808819 cites W2089766601 @default.
• W2012808819 cites W2092528800 @default.
• W2012808819 cites W2113142255 @default.
• W2012808819 cites W2138950050 @default.
• W2012808819 cites W2143923628 @default.
• W2012808819 cites W2144520351 @default.
• W2012808819 cites W2155493449 @default.
• W2012808819 cites W2398346137 @default.
• W2012808819 cites W2404010186 @default.
• W2012808819 doi "https://doi.org/10.1074/jbc.272.48.30526" @default.
• W2012808819 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9374547" @default.
• W2012808819 hasPublicationYear "1997" @default.
• W2012808819 type Work @default.
• W2012808819 sameAs 2012808819 @default.
• W2012808819 citedByCount "49" @default.
• W2012808819 countsByYear W20128088192012 @default.
• W2012808819 countsByYear W20128088192013 @default.
• W2012808819 countsByYear W20128088192014 @default.
• W2012808819 countsByYear W20128088192015 @default.
• W2012808819 countsByYear W20128088192016 @default.
• W2012808819 countsByYear W20128088192018 @default.
• W2012808819 countsByYear W20128088192019 @default.
• W2012808819 countsByYear W20128088192022 @default.
• W2012808819 countsByYear W20128088192023 @default.
• W2012808819 crossrefType "journal-article" @default.
• W2012808819 hasAuthorship W2012808819A5008823362 @default.
• W2012808819 hasAuthorship W2012808819A5014920554 @default.
• W2012808819 hasAuthorship W2012808819A5021110286 @default.
• W2012808819 hasAuthorship W2012808819A5031387848 @default.
• W2012808819 hasAuthorship W2012808819A5054237800 @default.
• W2012808819 hasAuthorship W2012808819A5071860009 @default.
• W2012808819 hasAuthorship W2012808819A5082586932 @default.
• W2012808819 hasAuthorship W2012808819A5087585309 @default.
• W2012808819 hasBestOaLocation W20128088191 @default.
• W2012808819 hasConcept C170493617 @default.
• W2012808819 hasConcept C171250308 @default.
• W2012808819 hasConcept C185592680 @default.
• W2012808819 hasConcept C192562407 @default.
• W2012808819 hasConcept C202751555 @default.
• W2012808819 hasConcept C2776200302 @default.
• W2012808819 hasConcept C2776996007 @default.
• W2012808819 hasConcept C2780841128 @default.
• W2012808819 hasConcept C55493867 @default.
• W2012808819 hasConcept C86803240 @default.
• W2012808819 hasConcept C95444343 @default.
• W2012808819 hasConceptScore W2012808819C170493617 @default.
• W2012808819 hasConceptScore W2012808819C171250308 @default.
• W2012808819 hasConceptScore W2012808819C185592680 @default.
• W2012808819 hasConceptScore W2012808819C192562407 @default.
• W2012808819 hasConceptScore W2012808819C202751555 @default.
• W2012808819 hasConceptScore W2012808819C2776200302 @default.
• W2012808819 hasConceptScore W2012808819C2776996007 @default.
• W2012808819 hasConceptScore W2012808819C2780841128 @default.
• W2012808819 hasConceptScore W2012808819C55493867 @default.
• W2012808819 hasConceptScore W2012808819C86803240 @default.
• W2012808819 hasConceptScore W2012808819C95444343 @default.

• next