FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2012956711> ?p ?o ?g. }

• W2012956711 endingPage "8830" @default.
• W2012956711 startingPage "8821" @default.
• W2012956711 abstract "Overexpression of some ATP-binding cassette (ABC) membrane transporters such as ABCB1/P-glycoprotein/MDR1 and ABCC1/MRP1 causes multidrug resistance in cancer chemotherapy. It has been thought that half-ABC transporters with one nucleotide-binding domain and one membrane-spanning domain (MSD) likely work as dimers, whereas full-length transporters with two nucleotide-binding domains and two or three MSDs function as monomers. In this study, we examined the oligomeric status of the human full-length ABC transporter ABCC1/MRP1 using several biochemical approaches. We found 1) that it is a homodimer, 2) that the dimerization domain is located in the amino-terminal MSD0L0 (where L0 is loop 0) region, and 3) that MSD0L0 has a dominant-negative function when coexpressed with wild-type ABCC1/MRP1. These findings suggest that ABCC1/MRP1 may exist and function as a dimer and that MSD0L0 likely plays some structural and regulatory functions. It is also tempting to propose that the MSD0L0-mediated dimerization may be targeted for therapeutic development to sensitize ABCC1/MRP1-mediated drug resistance in cancer chemotherapy. Overexpression of some ATP-binding cassette (ABC) membrane transporters such as ABCB1/P-glycoprotein/MDR1 and ABCC1/MRP1 causes multidrug resistance in cancer chemotherapy. It has been thought that half-ABC transporters with one nucleotide-binding domain and one membrane-spanning domain (MSD) likely work as dimers, whereas full-length transporters with two nucleotide-binding domains and two or three MSDs function as monomers. In this study, we examined the oligomeric status of the human full-length ABC transporter ABCC1/MRP1 using several biochemical approaches. We found 1) that it is a homodimer, 2) that the dimerization domain is located in the amino-terminal MSD0L0 (where L0 is loop 0) region, and 3) that MSD0L0 has a dominant-negative function when coexpressed with wild-type ABCC1/MRP1. These findings suggest that ABCC1/MRP1 may exist and function as a dimer and that MSD0L0 likely plays some structural and regulatory functions. It is also tempting to propose that the MSD0L0-mediated dimerization may be targeted for therapeutic development to sensitize ABCC1/MRP1-mediated drug resistance in cancer chemotherapy. Multidrug resistance is a serious problem in successful cancer chemotherapy. Studies using model cell lines have suggested that overexpression of some ATP-binding cassette (ABC) 6The abbreviations used are: ABC, ATP-binding cassette; LTC4, leukotriene C4; MSD, membrane-spanning domain; NBD, nucleotide-binding domain; PFO, perfluorooctanoic acid; L0, loop 0; DSP, dithiobis(succinimidyl propionate); HA, hemagglutinin; PVDF, polyvinylidene difluoride; DTT, dithiothreitol.6The abbreviations used are: ABC, ATP-binding cassette; LTC4, leukotriene C4; MSD, membrane-spanning domain; NBD, nucleotide-binding domain; PFO, perfluorooctanoic acid; L0, loop 0; DSP, dithiobis(succinimidyl propionate); HA, hemagglutinin; PVDF, polyvinylidene difluoride; DTT, dithiothreitol. membrane transporters such as P-glycoprotein (ABCB1/MDR1) and MRP1 (multidrug resistance-associated protein 1; ABCC1) causes multidrug resistance. These ABC transporters actively efflux anticancer drugs out of cells and thus effectively reduce the intracellular accumulation and cytotoxicity of these drugs (1Gottesman M.M. Fojo T. Bates S.E. Nat. Rev. Cancer. 2002; 2: 48-58Crossref PubMed Scopus (4493) Google Scholar, 2Han B. Zhang J.-T. Curr. Med. Chem. Anti-Cancer Agents. 2004; 4: 31-42Crossref PubMed Scopus (68) Google Scholar, 3Leslie E.M. Deeley R.G. Cole S.P.C. Toxicol. Appl. Pharmacol. 2005; 204: 216-237Crossref PubMed Scopus (1113) Google Scholar, 4Krishnamurthy P. Schuetz J.D. Annu. Rev. Pharmacol. Toxicol. 2006; 46: 381-410Crossref PubMed Scopus (309) Google Scholar). In humans alone, the ABC transporters compose a 49-member superfamily, which is divided into seven subfamilies (ABCA–G; nutrigene.4t.com/humanabc.htm), although two of the members lack transmembrane domains and do not qualify as transporters by themselves.Human ABCC1/MRP1 (referred to hereafter as ABCC1) is 1 of the 13 members of the human ABCC subfamily. ABCC1 has been demonstrated to mediate ATP-dependent cellular efflux of a wide variety of anticancer drugs and xenobiotics and a broad spectrum of organic anions, including GSSG and GSH as well as anionic conjugates of GSH, glucuronide, and sulfate (3Leslie E.M. Deeley R.G. Cole S.P.C. Toxicol. Appl. Pharmacol. 2005; 204: 216-237Crossref PubMed Scopus (1113) Google Scholar, 5Kruh G.D. Belinsky M.G. Oncogene. 2003; 22: 7537-7552Crossref PubMed Scopus (548) Google Scholar). Endogenous organic anion substrates of ABCC1 include cysteinyl leukotriene C4 (LTC4) and conjugated estrogens β-estradiol 17-(β-d-glucuronide), estrone 3-sulfate, and dehydroepi-androsterone sulfate (6Leier I. Jedlitschky G. Buchholz U. Cole S.P.C. Deeley R.G. Keppler D. J. Biol. Chem. 1994; 269: 27807-27810Abstract Full Text PDF PubMed Google Scholar, 7Muller M. Meijer C. Zaman G.J. Borst P. Scheper R.J. Mulder N.H. de Vries E.G. Jansen P.L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 13033-13037Crossref PubMed Scopus (637) Google Scholar, 8Jedlitschky G. Leier I. Buchholz U. Barnouin K. Kurz G. Keppler D. Cancer Res. 1996; 56: 988-994PubMed Google Scholar, 9Qian Y.M. Song W.C. Cui H. Cole S.P.C. Deeley R.G. J. Biol. Chem. 2001; 276: 6404-6411Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 10Zelcer N. Reid G. Wielinga P. Kuil A. van der Heijden I. Schuetz J.D. Borst P. Biochem. J. 2003; 371: 361-367Crossref PubMed Scopus (259) Google Scholar).Unlike most of other human ABC transporters such as ABCB1/P-glycoprotein/MDR1, which contain a core structure of MSD1-NBD1-MSD2-NBD2 (Fig. 1), ABCC1, as well as ABCC2, ABCC3, ABCC6, and ABCC8–10, contains an additional MSD (MSD0) at the amino terminus that consists of five predicted transmembrane segments with a putative extracellular amino-terminal end (11Bakos E. Hegedus T. Hollo Z. Welker E. Tusnady G.E. Zaman G.J. Flens M.J. Varadi A. Sarkadi B. J. Biol. Chem. 1996; 271: 12322-12326Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 12Hipfner D.R. Almquist K.C. Leslie E.M. Gerlach J.H. Grant C.E. Deeley R.G. Cole S.P.C. J. Biol. Chem. 1997; 272: 23623-23630Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 13Kast C. Gros P. J. Biol. Chem. 1997; 272: 26479-26487Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 14Zhang J.-T. Biochem. J. 2000; 348: 597-606Crossref PubMed Google Scholar). Although it has recently been argued that the amino-terminal end (33 amino acids) may form a U-shaped structure and function as a gate (15Chen Q. Yang Y. Li L. Zhang J.-T. J. Biol. Chem. 2006; 281: 31152-31163Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar, 16Chen Q. Yang Y. Liu Y. Han B. Zhang J.-T. Biochemistry. 2002; 41: 9052-9062Crossref PubMed Scopus (18) Google Scholar), the functional role of MSD0 remains to be determined.Half-ABC transporters with a single MSD and a single NBD have been thought to function as dimers (2Han B. Zhang J.-T. Curr. Med. Chem. Anti-Cancer Agents. 2004; 4: 31-42Crossref PubMed Scopus (68) Google Scholar). However, the human half-ABC transporter ABCG2 has been shown recently to exist mainly as a homododecamer (17Xu J. Liu Y. Yang Y. Bates S. Zhang J.-T. J. Biol. Chem. 2004; 279: 19781-19789Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar), suggesting that it may function as a oligomer with 12 subunits. Previous studies using radiation inactivation of human erythrocytes (18Soszynski M. Kaluzna A. Rychlik B. Sokal A. Bartosz G. Arch. Biochem. Biophys. 1998; 354: 311-316Crossref PubMed Scopus (22) Google Scholar) and electron microscopy imaging of purified ABCC1 (19Rosenberg M.F. Mao Q. Holzenburg A. Ford R.C. Deeley R.G. Cole S.P.C. J. Biol. Chem. 2001; 276: 16076-16082Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar) have suggested that ABCC1 may be a dimer. In this study, we examined the oligomeric status of human ABCC1 using multiple approaches, including perfluorooctanoic acid (PFO)-PAGE, nondenaturing PAGE, gel filtration chromatography, sucrose density gradient sedimentation, chemical cross-linking, and co-immunoprecipitation. We demonstrate that human ABCC1 is a homodimer and that MSD0L0 is essential and sufficient for homodimerization of human ABCC1. Although coexpression of MSD0L0 inhibits the LTC4 transport activity of full-length ABCC1 possibly by forming a heterodimer with the full-length molecule, the carboxyl-terminal core domain lacks dimerization activity and does not inhibit the LTC4 transport function of full-length ABCC1.EXPERIMENTAL PROCEDURESMaterials—PFO and dithiobis(succinimidyl propionate) (DSP) were purchased from Oakwood Products, Inc., and Pierce, respectively. Monoclonal antibody MRPr1 and anti-hemagglutinin (HA) antibody were from Kamiya Biomedical Co. and Covance Inc., respectively. Anti-FLAG antibody M2, horseradish peroxidase-conjugated goat anti-mouse IgG and rabbit anti-rat IgG, β-galactosidase, Triton X-100, and LTC4 were from Sigma. Radioactive [3H]LTC4 was purchased from PerkinElmer Life Sciences. Polyvinylidene difluoride (PVDF) membranes, concentrated protein assay dye reagents, and precast polyacrylamide gradient gels were from Bio-Rad. Lipofectamine, G418, and cell culture media and reagents were obtained from Invitrogen. A Superose 6 HR column, thyroglobulin, ferritin, catalase, bovine serum albumin, and an enhanced chemiluminescence (ECL) system were from Amersham Biosciences. Laminin and protein G-agarose were from BD Biosciences and Santa Cruz Biotechnology, Inc., respectively. All other reagents were molecular biology grade and were purchased from Sigma or Fisher.Engineering Human ABCC1 Constructs—pcDNA3.1(+)-MRP1WT encoding human wild-type ABCC1 was constructed previously (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). The constructs encoding full-length ABCC1 with a FLAG or HA tag at its carboxyl terminus were engineered by amplifying a 754- or 763-bp fragment of ABCC1 using a forward primer (nucleotides 4012–4029 of human ABCC1 cDNA) with an EcoRI site (underlined) (5′-GTGGAATTCCGGAACTAC-3′) and a reverse primer with a NotI site (underlined) and a FLAG tag (italic) (5′-CCGCGGCCGCTCACTTGTCATCGTCGTCCTTGTAGTCCACCAAGCCGGCGTCTTTGGC) or an HA tag (italic) (5′-CCGCGGCCGCTCAGAGGCTAGCATAATCAGGAACATCATACGGATACACCAAGCCGGCGTCTTTGGC-3′). The PCR products were then digested with EcoRI and NotI to generate a 746-bp (FLAG) or 755-bp (HA) fragment, which was subsequently cloned into pcDNA3.1(+)-MRP1WT digested with EcoRI and NotI, resulting in pcDNA3.1(+)-ABCC1F-FLAG or pcDNA3.1(+)-ABCC1F-HA. To generate the human carboxyl-terminal core structure of ABCC1 with a FLAG tag at its carboxyl terminus, the 746-bp fragment from the PCR was inserted into previously constructed pcDNA3.1(+)-MRP1CORE (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) digested with EcoRI and NotI, resulting in pcDNA3.1(+)-ABCC1CORE-FLAG. To generate construct pcDNA3.1(+)-ABCC1281N encoding the first 281 amino acids of human ABCC1, pcDNA3.1(+)-MRP1WT (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) was digested with BamHI and NotI and blunted with Klenow fragment. The DNA fragments were then self-ligated, resulting in pcDNA3.1(+)-ABCC1281N. Translation of ABCC1281N terminates at a stop codon in the vector, resulting in the addition of 9 amino acids (RPLESRGPV) following Asp281 of human ABCC1, as described previously (21Gao M. Yamazaki M. Loe D.W. Westlake C.J. Grant C.E. Cole S.P.C. Deeley R.G. J. Biol. Chem. 1998; 273: 10733-10740Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 22Bakos E. Evers R. Szakacs G. Tusnady G.E. Welker E. Szabo K. de Haas M. van Deemter L. Borst P. Varadi A. Sarkadi B. J. Biol. Chem. 1998; 273: 32167-32175Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). All constructs were confirmed by double-strand DNA sequencing.Cell Culture, Transfection, and Membrane Preparations—HEK293 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum in the presence of 100 units/ml penicillin and 100 μg/ml streptomycin. To establish stable ABCC1F-HA clones, 5 μg of pcDNA3.1(+)-ABCC1F-HA were transfected into HEK293 cells in 100-mm cell culture dishes using Lipofectamine according to the manufacturer's instructions. Two days following transfection, 10% of the transfected cells were selected with 400 μg/ml G418 for 2 weeks. The G418-resistant cells were cloned using cloning cylinders and propagated for further experiments.For transient transfection, 15 μg of pcDNA3.1(+)-ABCC1F-FLAG, pcDNA3.1(+)-ABCC1281N, or pcDNA3.1(+)-ABCC1CORE-FLAG were transfected into HEK293 cells that did or did not express ABCC1F-HA in 150-mm dishes using Lipofectamine according to the manufacturer's instructions. Forty-eight hours after transfection, cells were harvested for preparation of cell lysates or membrane vesicles as described previously (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar).PFO-PAGE—Extractions of human ABCC1 from membranes with PFO and PFO-PAGE were performed as described previously (17Xu J. Liu Y. Yang Y. Bates S. Zhang J.-T. J. Biol. Chem. 2004; 279: 19781-19789Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar) with minor modifications. Briefly, 5 μg of plasma membranes in 250 mm sucrose, 10 mm Tris (pH 7.4), and 150 mm NaCl were mixed with an equal volume of 2× PFO extraction sample buffer (100 mm Tris (pH 8.0), 20% (v/v) glycerol, 0.005% bromphenol blue, 200 mm dithiothreitol (DTT), and 0.25–8% PFO) or 2 × SDS sample buffer (100 mm Tris-HCl (pH 6.8), 20% glycerol, 0.005% bromphenol blue, 200 mm DTT, and 4% SDS) and incubated at room temperature for 30 min, followed by centrifugation at 11,000 ×g for 10 min to remove insoluble materials. The supernatants were loaded onto freshly prepared 7.5% Tris/glycine-polyacrylamide gel without SDS. Electrophoresis was performed at 100 V at 4 °C using a running buffer containing 25 mm Tris (pH 8.5), 192 mm glycine, and 0.1% PFO. The proteins were then transferred to PVDF membranes, and human ABCC1 was detected using monoclonal antibody MRPr1. The signal was detected using horseradish peroxidase-conjugated rabbit anti-rat secondary antibody and the ECL system.Nondenaturing PAGE—Nondenaturing PAGE was performed as described previously (17Xu J. Liu Y. Yang Y. Bates S. Zhang J.-T. J. Biol. Chem. 2004; 279: 19781-19789Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar). Briefly, ∼10 μg of plasma membranes in 250 mm sucrose, 10 mm Tris (pH 7.4), and 150 mm NaCl were mixed with an equal volume of 2× Triton X-100 extraction sample buffer (100 mm Tris (pH 8.0), 40% glycerol, 0.005% bromphenol blue, 2% Triton X-100, and 200 mm DTT) or 2× SDS sample buffer and incubated at room temperature for 30 min, followed by centrifugation at 11,000 ×g for 10 min to remove insoluble materials. The supernatants were then loaded onto precast 4–15% gradient Tris/glycine-polyacrylamide gel, and electrophoresis was performed at 80 V at room temperature with a running buffer containing 25 mm Tris (pH 8.3) and 192 mm glycine, followed by transfer to PVDF membranes for Western blot analysis as described above.Sucrose Density Gradient Sedimentation—Plasma membranes (100 μg) were first extracted with 2× sample buffer (100 mm Tris-HCl (pH 8.0), 200 mm DTT, and 1% PFO or 2% SDS) as described above. The extracts were then loaded onto a 10–30% (w/v) continuous sucrose gradient containing 50 mm Tris-HCl (pH 7.4), 1 mm DTT, and 0.1% PFO or SDS. Sedimentation was performed with a Beckman SW 41 rotor at 100,000 × g for 18 h at 4 °C. Fractions (0.5 ml) were collected, followed by trichloroacetic acid precipitation, separation by SDS-PAGE, transfer to PVDF membranes, and detection of ABCC1 by Western blot analysis using monoclonal antibody MRPr1 as a probe. Protein markers (thyroglobulin (669 kDa), laminin (400 and 200 kDa), catalase (232 kDa), and bovine serum albumin (66 kDa)) were separated and fractionated under the same conditions and detected by Coomassie Blue staining of the SDS-polyacrylamide gel of each fraction.Gel Filtration Chromatography—Gel filtration chromatography was perform using anÁKTA purifier system with a Superose 6 HR column as described previously (17Xu J. Liu Y. Yang Y. Bates S. Zhang J.-T. J. Biol. Chem. 2004; 279: 19781-19789Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar). Briefly, 100 μg of plasma membranes were first extracted with PFO or SDS in buffer containing 50 mm Tris-HCl (pH 7.4), 150 mm NaCl, and 100 mm DTT for 30 min at room temperature and then subjected to centrifugation at 11,000 × g for 10 min. The supernatants were injected into the column equilibrated with elution buffer (50 mm Tris-HCl (pH 7.4), 150 mm NaCl, 1 mm DTT, and 0.1% PFO or SDS). Fractions (0.5 ml each) were collected, followed by trichloroacetic acid precipitation. The retention of human ABCC1 was determined by separation of each fraction by SDS-PAGE and transfer to PVDF membranes, followed by detection of ABCC1 by Western blot analysis. Protein markers (laminin (400 and 200 kDa), β-galactosidase (116 kDa), and bovine serum albumin (66 kDa)) were separated using the ÁKTA purifier system under the same conditions and detected using the UV detector of theÁKTA purifier system.Chemical Cross-linking—A stable HEK293 cell clone expressing human ABCC1 (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) in culture was washed three times with phosphate-buffered saline and then treated with different concentrations of DSP at room temperature for 30 min, followed by the addition of Tris (pH 7.4) to a final concentration of 20 mm and incubation for another 15 min to terminate the cross-linking reaction. Crude membranes were prepared as described previously (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar), followed by separation by SDS-PAGE in the absence or presence of 100 mm DTT before transfer to PVDF membranes and Western blot analysis using monoclonal antibody MRPr1 as a probe.Immunoprecipitation—Immunoprecipitation was performed essentially as described previously (17Xu J. Liu Y. Yang Y. Bates S. Zhang J.-T. J. Biol. Chem. 2004; 279: 19781-19789Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar, 23Dong Z. Zhang J.-T. Mol. Biol. Cell. 2003; 14: 3942-3951Crossref PubMed Scopus (91) Google Scholar). Briefly, cells were washed three times with ice-cold phosphate-buffered saline and then lysed with lysis buffer (50 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1 mm EDTA, and 1% Triton X-100). The cell lysate was cleared of insoluble materials by centrifugation and used for immunoprecipitation. For inhibition of glycosylation, tunicamycin treatment was performed prior to lysate preparation as described previously (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). For immunoprecipitation, cell lysates (1.5 mg) were first precleared by incubation with 1 μg of normal mouse IgG at 4 °C for 4 h, followed by the addition of 50 μl of protein G-agarose beads (50% slurry) and incubation at 4 °C for 3 h with rotation and centrifugation at 500 × g for 5 min. The cleared supernatants were then incubated with 10 μg of anti-FLAG or anti-HA antibody at 4 °C with rotation for 2 h before mixing with 50 μl of protein G-agarose slurry. The mixtures were further incubated at 4 °C for 3 h with rotation, followed by centrifugation to collect precipitates, which were then washed five times with lysis buffer and used for Western blotting.[3H]LTC4 Transport Assay—ATP-dependent transport of [3H]LTC4 into inside-out plasma membrane vesicles was measured using a rapid filtration method as described previously (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 24Loe D.W. Almquist K.C. Deeley R.G. Cole S.P.C. J. Biol. Chem. 1996; 271: 9675-9682Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar). Briefly, 2 μg of membrane vesicles were incubated at 25 °C for 2 min in 25 μl of transport buffer (50 mm Tris-HCl, 250 mm sucrose, and 0.02% sodium azide (pH 7.4)) containing 4 mm ATP or AMP, 10 mm MgCl2, 100 μg/ml creatine kinase, 10 mm creatine phosphate, and 50 nm [3H]LTC4 (0.01 μCi) and mixed with 1 ml of ice-cold transport buffer, followed by filtration under vacuum through a glass-fiber filter (type GF/B, Whatman). Filters were immediately washed twice with 5 ml of ice-cold transport buffer and then dried before measurement of radioactivity by scintillation counting.RESULTSPFO Extraction and PFO-PAGE Analyses of Human ABCC1—To investigate the oligomeric status of human ABCC1, we first employed PFO-PAGE. PFO is a mild ionic detergent that does not break the noncovalent interactions between protein subunits of an oligomer at appropriate concentrations and therefore permits extraction and determination of the oligomeric status of membrane proteins by PFO-PAGE. This method has been used successfully to study the oligomeric status of several membrane proteins (17Xu J. Liu Y. Yang Y. Bates S. Zhang J.-T. J. Biol. Chem. 2004; 279: 19781-19789Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar, 25Ramjeesingh M. Li C. Kogan I. Wang Y. Huan L.J. Bear C.E. Biochemistry. 2001; 40: 10700-10706Crossref PubMed Scopus (43) Google Scholar, 26Kedei N. Szabo T. Lile J.D. Treanor J.J. Olah Z. Iadarola M.J. Blumberg P.M. J. Biol. Chem. 2001; 276: 28613-28619Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar, 27Mitic L.L. Unger V.M. Anderson J.M. Protein Sci. 2003; 12: 218-227Crossref PubMed Scopus (88) Google Scholar, 28Hong M. Xu W. Yoshida T. Tanaka K. Wolff D.J. Zhou F. Inouye M. You G. J. Biol. Chem. 2005; 280: 32285-32290Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar).We first tested the optimal PFO concentration to extract human ABCC1 from plasma membranes of HEK293 cells expressing ectopic human ABCC1 (20Yang Y. Chen Q. Zhang J.-T. J. Biol. Chem. 2002; 277: 44268-44277Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) using SDS-PAGE and Western blot analysis. As shown in Fig. 2A, PFO at concentrations of 0.5% and above can effectively extract human ABCC1 from membranes. When the PFO-extracted human ABCC1 proteins were separated by PFO-PAGE, most migrated with an estimated molecular mass of ∼569 kDa at low concentrations (e.g. 0.5%) of PFO (Fig. 2B). The SDS-extracted ABCC1 proteins migrated with an estimated molecular mass of ∼258 kDa and were assumed to be monomers (Fig. 2B and Table 1). Thus, most of the ABCC1 proteins extracted with 0.5% PFO migrated likely as dimers (Table 1). However, more monomeric ABCC1 proteins were apparent when higher concentrations (e.g. 4%) of PFO were used for extraction (Fig. 2B), suggesting that higher concentrations of PFO can dissociate ABCC1 into monomers.FIGURE 2Analysis of human ABCC1 by PFO-PAGE and nondenaturing PAGE. A, PFO extraction. Membranes isolated from HEK293 cells expressing human wild-type ABCC1 were extracted with PFO at various concentrations, followed by centrifugation. All supernatant (lanes 1–6) and pellet (lanes 7–12) fractions were then solubilized in SDS sample buffer for SDS-PAGE and Western blot analysis. B, PFO-PAGE. Supernatants from membranes extracted with various concentrations of PFO were first separated by PFO-PAGE, followed by Western blot analysis. A fraction extracted with SDS was also used as a control (lane 5). C, nondenaturing PAGE. Supernatants from membranes extracted with Triton X-100 were first separated by nondenaturing PAGE, followed by Western blot analysis (lane 1). SDS-extracted membranes were used as a control (lane 2). D, dimer; M, monomer.View Large Image Figure ViewerDownload Hi-res image Download (PPT)TABLE 1Summary of the apparent molecular masses and oligomeric states of human ABCC1Method of separationMolecular massNo. of subunitsaThe number of ABCC1 subunits was calculated based on the apparent molecular mass measured using each method in the presence of SDS, under which condition ABCC1 was assumed to migrate as a monomer. Note that the apparent molecular mass of ABCC1 in SDS varied as determined using different methods of separation. However, the ratio between the molecular mass determined in the presence of PFO or Triton X-100 and that determined in the presence of SDS was always close to 2.Oligomeric statekDaPFO-PAGE PFO5692.2Dimer PFO2581.0Monomer SDS2581.0MonomerNondenaturing PAGE Triton X-1005341.9Dimer SDS2891.0MonomerGradient sedimentation PFO3192.4Dimer SDS1321.0MonomerGel filtration PFO4122.2Dimer PFO2021.1Monomer SDS1891.0MonomerCross-linking/SDS-PAGE +DSP3141.9Dimer -DSP1681.0Monomera The number of ABCC1 subunits was calculated based on the apparent molecular mass measured using each method in the presence of SDS, under which condition ABCC1 was assumed to migrate as a monomer. Note that the apparent molecular mass of ABCC1 in SDS varied as determined using different methods of separation. However, the ratio between the molecular mass determined in the presence of PFO or Triton X-100 and that determined in the presence of SDS was always close to 2. Open table in a new tab To determine that the formation of dimeric ABCC1 was not due to the use of PFO, the nonionic detergent Triton X-100 was used for extraction, followed by nondenaturing PAGE and Western blot analysis. ABCC1 extracted with SDS was used as a control. As shown in Fig. 2C, Triton X-100-extracted ABCC1 migrated with an apparent molecular mass of 534 kDa, whereas SDS-extracted ABCC1 migrated with an apparent molecular mass of 289 kDa. Assuming that ABCC1 extracted with SDS migrated as a monomer, we conclude that the ∼534-kDa ABCC1 protein extracted with Triton X-100 is likely a dimer (Table 1).Analysis of Human ABCC1 by Sucrose Density Gradient Sedimentation—Sucrose density gradient sedimentation was also used to determine the size of human ABCC1. ABCC1 was first extracted from membranes with PFO or SDS as a control and then subjected to sucrose density gradient sedimentation, followed by fractionation, trichloroacetic acid precipitation, SDS-PAGE, and Western blot analysis as described under “Experimental Procedures.” As shown in Fig. 3 (A and B), ABCC1 extracted with PFO was detected between fractions 7 and 11 with a peak in fraction 9, with an estimated molecular mass of 319 kDa. On the other hand, ABCC1 extracted with SDS was detected between fractions 15 and 16 (Fig. 3C), with an estimated average molecular mass of 132 kDa (Fig. 3D). Thus, the majority of ABCC1 proteins extracted with PFO likely exist as dimers, assuming that ABCC1 proteins extracted with SDS behave as monomers (Table 1).FIGURE 3Analysis of human ABCC1 by sucrose density gradient sedimentation. Membrane proteins (100 μg) were extracted with PFO (A) or SDS (C), and the soluble fractions were layered on top of continuous sucrose gradients, followed by centrifugation, fractionation, trichloroacetic acid precipitation, SDS-PAGE, and Western blotting as described under “Experimental Procedures.” ABCC1 in each fraction was quantified by measuring the intensity of the Western blot using Scion software and plotted against the fraction number. The marker proteins thyroglobulin (TG), catalase (CA), bovine serum albumin (BSA) in PFO and β-galactosidase (BG) and laminin (LA) in SDS were analyzed under the same conditions as those described for ABCC1. The apparent molecular masses of ABCC1 in PFO (B) and SDS (D) were estimated based on the linear regression of the fractionation of the molecular mass markers. AU, arbitrary units.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Analysis of Human ABCC1 by Gel Filtration Chromatography—We next performed gel filtration chromatography separation of ABCC1 extracted with PFO or SDS as a control using a Superose 6 HR column, followed by trichloroacetic acid precipitation and Western blot analysis. As shown in Fig. 4 (A and B), human ABCC1 extracted with PFO eluted in fractions with retentions of 8–14 ml. The two peak fractions with retentions of 10 and 12.5 ml had estimated molecular masses of 412 and 202 kDa, respectively. On the other hand, ABCC1 extracted with SDS eluted between fractions of 9.5–11 ml, with an estimated molecular mass of 189 kDa at the peak (Fig. 4, C and D). Thus, the two peak fractions of ABCC1 extracted with PFO are likely dimeric and monomeric forms, respectively (Table 1).FIGURE 4Analysis of human ABCC1 by gel filtration chromatography. Membrane proteins (100 μg) were extracted with PFO (A) or SDS (C), and the soluble fractions were subjected to separation by fast protein liquid chromatography. Fractions (0.5 ml) were collected, followed by trichloroacetic acid precipitation and Western blot analysis using" @default.
• W2012956711 created "2016-06-24" @default.
• W2012956711 creator A5023363049 @default.
• W2012956711 creator A5030529771 @default.
• W2012956711 creator A5045603980 @default.
• W2012956711 creator A5058562415 @default.
• W2012956711 creator A5075200916 @default.
• W2012956711 creator A5075883718 @default.
• W2012956711 creator A5080041707 @default.
• W2012956711 date "2007-03-01" @default.
• W2012956711 modified "2023-10-15" @default.
• W2012956711 title "Regulation of Function by Dimerization through the Amino-terminal Membrane-spanning Domain of Human ABCC1/MRP1" @default.
• W2012956711 cites W1502426706 @default.
• W2012956711 cites W1599388734 @default.
• W2012956711 cites W1890023926 @default.
• W2012956711 cites W1965303038 @default.
• W2012956711 cites W1970218983 @default.
• W2012956711 cites W1980679007 @default.
• W2012956711 cites W1982692981 @default.
• W2012956711 cites W1987709211 @default.
• W2012956711 cites W1993729684 @default.
• W2012956711 cites W1994635276 @default.
• W2012956711 cites W2002900184 @default.
• W2012956711 cites W2006434892 @default.
• W2012956711 cites W2007438995 @default.
• W2012956711 cites W2017283606 @default.
• W2012956711 cites W2019183482 @default.
• W2012956711 cites W2027085827 @default.
• W2012956711 cites W2039136259 @default.
• W2012956711 cites W2039384470 @default.
• W2012956711 cites W2045899706 @default.
• W2012956711 cites W2047949724 @default.
• W2012956711 cites W2049408889 @default.
• W2012956711 cites W2051864088 @default.
• W2012956711 cites W2052968739 @default.
• W2012956711 cites W2053374243 @default.
• W2012956711 cites W2053569971 @default.
• W2012956711 cites W2055213615 @default.
• W2012956711 cites W2055549127 @default.
• W2012956711 cites W2059742450 @default.
• W2012956711 cites W2062464623 @default.
• W2012956711 cites W2063986131 @default.
• W2012956711 cites W2064266177 @default.
• W2012956711 cites W2072208750 @default.
• W2012956711 cites W2076893872 @default.
• W2012956711 cites W2081213990 @default.
• W2012956711 cites W2084424427 @default.
• W2012956711 cites W2088720250 @default.
• W2012956711 cites W2094761998 @default.
• W2012956711 cites W2095374177 @default.
• W2012956711 cites W2098001934 @default.
• W2012956711 cites W2148444697 @default.
• W2012956711 cites W2159854260 @default.
• W2012956711 cites W2161632561 @default.
• W2012956711 cites W2165538823 @default.
• W2012956711 cites W2168095256 @default.
• W2012956711 cites W2170560435 @default.
• W2012956711 cites W4239783585 @default.
• W2012956711 doi "https://doi.org/10.1074/jbc.m700152200" @default.
• W2012956711 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17264072" @default.
• W2012956711 hasPublicationYear "2007" @default.
• W2012956711 type Work @default.
• W2012956711 sameAs 2012956711 @default.
• W2012956711 citedByCount "48" @default.
• W2012956711 countsByYear W20129567112012 @default.
• W2012956711 countsByYear W20129567112013 @default.
• W2012956711 countsByYear W20129567112014 @default.
• W2012956711 countsByYear W20129567112016 @default.
• W2012956711 countsByYear W20129567112017 @default.
• W2012956711 countsByYear W20129567112018 @default.
• W2012956711 countsByYear W20129567112019 @default.
• W2012956711 countsByYear W20129567112020 @default.
• W2012956711 countsByYear W20129567112021 @default.
• W2012956711 countsByYear W20129567112022 @default.
• W2012956711 countsByYear W20129567112023 @default.
• W2012956711 crossrefType "journal-article" @default.
• W2012956711 hasAuthorship W2012956711A5023363049 @default.
• W2012956711 hasAuthorship W2012956711A5030529771 @default.
• W2012956711 hasAuthorship W2012956711A5045603980 @default.
• W2012956711 hasAuthorship W2012956711A5058562415 @default.
• W2012956711 hasAuthorship W2012956711A5075200916 @default.
• W2012956711 hasAuthorship W2012956711A5075883718 @default.
• W2012956711 hasAuthorship W2012956711A5080041707 @default.
• W2012956711 hasBestOaLocation W20129567111 @default.
• W2012956711 hasConcept C104317684 @default.
• W2012956711 hasConcept C12554922 @default.
• W2012956711 hasConcept C134306372 @default.
• W2012956711 hasConcept C14036430 @default.
• W2012956711 hasConcept C167625842 @default.
• W2012956711 hasConcept C185592680 @default.
• W2012956711 hasConcept C2779664074 @default.
• W2012956711 hasConcept C3018824666 @default.
• W2012956711 hasConcept C31258907 @default.
• W2012956711 hasConcept C33923547 @default.
• W2012956711 hasConcept C36503486 @default.
• W2012956711 hasConcept C41008148 @default.
• W2012956711 hasConcept C41625074 @default.
• W2012956711 hasConcept C55493867 @default.

• next