FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2013679716> ?p ?o ?g. }

• W2013679716 endingPage "17129" @default.
• W2013679716 startingPage "17121" @default.
• W2013679716 abstract "Fibroblast growth factor (FGF) signaling begins with the formation of a ternary complex of FGF, FGF receptor (FGFR), and heparan sulfate (HS). Multiple models have been proposed for the ternary complex. However, major discrepancies exist among those models, and none of these models have evaluated the functional importance of the interacting regions on the HS chains. To resolve the discrepancies, we measured the size and molar ratio of HS in the complex and showed that both FGF1 and FGFR1 simultaneously interact with HS; therefore, a model of 2:2:2 FGF1·HS·FGFR1 was shown to fit the data. Using genetic and biochemical methods, we generated HSs that were defective in FGF1 and/or FGFR1 binding but could form the signaling ternary complex. Both genetically and chemically modified HSs were subsequently assessed in a BaF3 cell mitogenic activity assay. The ability of HS to support the ternary complex formation was found to be required for FGF1-stimulated cell proliferation. Our data also proved that specific critical groups and sites on HS support complex formation. Furthermore, the molar ratio of HS, FGF1, and FGFR1 in the ternary complex was found to be independent of the size of HS, which indicates that the selected model can take place on the cell surface proteoglycans. Finally, a mechanism for the FGF·FGFR signaling complex formation on cell membrane was proposed, where FGF and FGFR have their own binding sites on HS and a distinct ternary complex formation site is directly responsible for mitogenic activity. Fibroblast growth factor (FGF) signaling begins with the formation of a ternary complex of FGF, FGF receptor (FGFR), and heparan sulfate (HS). Multiple models have been proposed for the ternary complex. However, major discrepancies exist among those models, and none of these models have evaluated the functional importance of the interacting regions on the HS chains. To resolve the discrepancies, we measured the size and molar ratio of HS in the complex and showed that both FGF1 and FGFR1 simultaneously interact with HS; therefore, a model of 2:2:2 FGF1·HS·FGFR1 was shown to fit the data. Using genetic and biochemical methods, we generated HSs that were defective in FGF1 and/or FGFR1 binding but could form the signaling ternary complex. Both genetically and chemically modified HSs were subsequently assessed in a BaF3 cell mitogenic activity assay. The ability of HS to support the ternary complex formation was found to be required for FGF1-stimulated cell proliferation. Our data also proved that specific critical groups and sites on HS support complex formation. Furthermore, the molar ratio of HS, FGF1, and FGFR1 in the ternary complex was found to be independent of the size of HS, which indicates that the selected model can take place on the cell surface proteoglycans. Finally, a mechanism for the FGF·FGFR signaling complex formation on cell membrane was proposed, where FGF and FGFR have their own binding sites on HS and a distinct ternary complex formation site is directly responsible for mitogenic activity. heparan sulfate fibroblast growth factor FGF receptor completely desulfated and N-sulfated heparin sulfate completely desulfated and N-acetylated heparin 6-O-desulfated heparin O-sulfotransferase Chinese hamster ovary unsaturated uronic acid N-sulfated GlcN 2-O-sulfated ΔUA N- and 6-O-sulfated GlcN Heparan sulfate (HS)1 is a linear and highly sulfated polysaccharide, consisting of 50–150 basic disaccharide repeats of uronic acid and d-glucosamine units (1Bernfield M. Gotte M. Park P.W. Reizes O. Fitzgerald M.L. Lincecum J. Zako M. Annu. Rev. Biochem. 1999; 68: 729-777Crossref PubMed Scopus (2332) Google Scholar). Sulfation can occur at 2-O of the uronic acid and 3-O, 6-O, and N of thed-glucosamine and is catalyzed by a variety of sulfotransferases. Each modification is incomplete, which leads to sequence variation on HS, and it is very likely that critical sulfate groups determine the specificity of HS-protein interactions (2Rosenberg R.D. Shworak N.W. Liu J. Schwartz J.J. Zhang L. J. Clin. Invest. 1997; 99: 2062-2070Crossref PubMed Scopus (258) Google Scholar). Along the HS chain, the majority of sulfated residues are clustered in short functional domains separated by relatively less sulfated oligosaccharide sequences (3Gallagher J.T. J. Clin. Invest. 2001; 108: 357-361Crossref PubMed Scopus (283) Google Scholar). Heparin resembles these functional domains and is widely used for the functional study of HS. One major function of HS is to interact with fibroblast growth factors (FGFs) and their receptors (FGFRs) and form FGF·HS·FGFR signaling complexes (4Yayon A. Klagsbrun M. Esko J.D. Leder P. Ornitz D.M. Cell. 1991; 64: 841-848Abstract Full Text PDF PubMed Scopus (2094) Google Scholar, 5Rapraeger A.C. Krufka A. Olwin B.B. Science. 1991; 252: 1705-1708Crossref PubMed Scopus (1292) Google Scholar, 6Spivak-Kroizman T. Lemmon M.A. Dikic I. Ladbury J.E. Pinchasi D. Huang J. Jaye M. Crumley G. Schlessinger J. Lax I. Cell. 1994; 79: 1015-1024Abstract Full Text PDF PubMed Scopus (596) Google Scholar, 7Esko J.D. Selleck S.B. Annu. Rev. Biochem. 2002; 71: 435-471Crossref PubMed Scopus (1254) Google Scholar). Defects in HS can cause complete losses of FGF, Hedgehog, and Wingless signaling pathways and lead to severe abnormality in embryonic development (8Perrimon N. Bernfield M. Nature. 2000; 404: 725-728Crossref PubMed Scopus (662) Google Scholar, 9Lander A.D. Selleck S.B. J. Cell Biol. 2000; 148: 227-232Crossref PubMed Scopus (225) Google Scholar). The involvement of HS in the FGF molecular signaling complex suggests that FGF activity and specificity may be modulated by HS and in turn by enzymes that synthesize and degrade HS. FGFs and FGFRs play critical roles in the control of many fundamental cellular processes, such as cell proliferation, differentiation, and migration (10Schlessinger J. Cell. 2000; 103: 211-225Abstract Full Text Full Text PDF PubMed Scopus (3557) Google Scholar, 11Lemmon M.A. Schlessinger J. Trends Biochem. Sci. 1994; 19: 459-463Abstract Full Text PDF PubMed Scopus (434) Google Scholar, 12Galzie Z. Kinsella A.R. Smith J.A. Biochem. Cell Biol. 1997; 75: 669-685Crossref PubMed Scopus (183) Google Scholar, 13Naski M.C. Ornitz D.M. Front. Biosci. 1998; 3: D781-D794Crossref PubMed Google Scholar). There are 23 known FGFs and five types of FGFRs in humans (14Sleeman M. Fraser J. McDonald M. Yuan S. White D. Grandison P. Kumble K. Watson J.D. Murison J.G. Gene (Amst.). 2001; 271: 171-182Crossref PubMed Scopus (212) Google Scholar). FGF1 and FGF2 were the first to be isolated and were called acidic and basic FGF, respectively. Studies performed primarily on FGF2 have identified a stretch of basic residues in the polypeptide chain as participating in the heparin-binding site (15Faham S. Hileman R.E. Fromm J.R. Linhardt R.J. Rees D.C. Science. 1996; 271: 1116-1120Crossref PubMed Scopus (740) Google Scholar). FGFRs belong to a group of receptor tyrosine kinases and are activated through FGFs and HS induced dimerization (10Schlessinger J. Cell. 2000; 103: 211-225Abstract Full Text Full Text PDF PubMed Scopus (3557) Google Scholar). The unspliced form of FGFR contains an intracellular tyrosine kinase domain, a trans-membrane region, an extracellular region containing three Ig domains, a string of acidic residues between the first and second Ig domains (16Givol D. Yayon A. FASEB J. 1992; 6: 3362-3369Crossref PubMed Scopus (400) Google Scholar), and an HS binding site in the second Ig domain (17Kan M. Wang F. Xu J. Crabb J.W. Hou J. McKeehan W.L. Science. 1993; 259: 1918-1921Crossref PubMed Scopus (476) Google Scholar). The Ig domain I has been shown to be dispensable, and receptor variants containing only the Ig domain II and III (औ form) have been found to exhibit an equivalent degree of binding to FGFs as the variants containing all three domains (α form). Ig domain III can undergo differential splicing and thereby exhibits IIIb and IIIc forms (16Givol D. Yayon A. FASEB J. 1992; 6: 3362-3369Crossref PubMed Scopus (400) Google Scholar). All receptors show redundant specificity for ligand binding (i.e. one receptor may bind to several FGFs, and one FGF may bind to more than one receptor) (12Galzie Z. Kinsella A.R. Smith J.A. Biochem. Cell Biol. 1997; 75: 669-685Crossref PubMed Scopus (183) Google Scholar). FGF1 interacts with almost all FGFRs, and FGFR1 is a common receptor for many ligands; thus, we have chosen FGF1 and FGFR1 to carry out our studies. Although the importance of HS in FGF signaling is well documented, the exact roles of HS in the signaling complex are less well characterized. One key issue concerns the minimum size of HS in the signaling complex. This size of HS reflects the spatial arrangement of FGF and FGFR in the complex; thus, this parameter is critical for modeling the FGFR signaling complex. Basically, there are three modes of interaction between multiple proteins and a single chain of HS (Fig. 1), designated as the cis, trans, and mix mode. Mix mode contains both cis and trans modes. Different modes of interaction require HS with different lengths to participate. So far, various models with different modes of HS-protein interactions and thus different HS length requirements have been proposed. For example, hexasaccharide (dp6) was found to be able to link two FGF1 in a trans mode (18DiGabriele A.D. Lax I. Chen D.I. Svahn C.M. Jaye M. Schlessinger J. Hendrickson W.A. Nature. 1998; 393: 812-817Crossref PubMed Scopus (329) Google Scholar) (Fig. 1B, IV); dodecasaccharide (dp12) was thought to be the minimum length for linking one FGF2 and one FGFR1 in a cis mode (19Guimond S. Maccarana M. Olwin B.B. Lindahl U. Rapraeger A.C. J. Biol. Chem. 1993; 268: 23906-23914Abstract Full Text PDF PubMed Google Scholar) (Fig.1A, I); and hexadecasaccharide (dp16) was proposed to be able to fully span a heparin binding site created by a 2:2 FGF1·FGFR2 complex in a mix mode (Fig. 1C,VI) (20Stauber D.J. DiGabriele A.D. Hendrickson W.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 49-54Crossref PubMed Scopus (214) Google Scholar). On the other hand, the shortest biologically active heparin oligosaccharide has been reported to be an octasaccharide (dp8) (21Ornitz D.M. Yayon A. Flanagan J.G. Svahn C.M. Levi E. Leder P. Mol. Cell. Biol. 1992; 12: 240-247Crossref PubMed Scopus (562) Google Scholar), hexasaccharide (dp6) (22Gambarini A.G. Miyamoto C.A. Lima G.A. Nader H.B. Dietrich C.P. Mol. Cell Biochem. 1993; 124: 121-129Crossref PubMed Scopus (44) Google Scholar, 23Zhou F.Y. Kan M. Owens R.T. McKeehan W.L. Thompson J.A. Linhardt R.J. Hook M. Eur. J. Cell Biol. 1997; 73: 71-80PubMed Google Scholar), trisaccharide, or even disaccharide (dp2) (24Ostrovsky O. Berman B. Gallagher J. Mulloy B. Fernig D.G. Delehedde M. Ron D. J. Biol. Chem. 2002; 277: 2444-2453Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar, 25Ornitz D.M. Herr A.B. Nilsson M. Westman J. Svahn C.M. Waksman G. Science. 1995; 268: 432-436Crossref PubMed Scopus (270) Google Scholar). These contradictory findings prompted us to design a more accurate method to determine the size of HS in FGFR signaling complex. A second key issue that remains controversial concerns the stoichiometry of HS in the FGF·FGFR signaling complex. Intracellular signaling is believed to be initiated from receptor dimerization and trans-phosphorylation (10Schlessinger J. Cell. 2000; 103: 211-225Abstract Full Text Full Text PDF PubMed Scopus (3557) Google Scholar, 26Heldin C.H. Cell. 1995; 80: 213-223Abstract Full Text PDF PubMed Scopus (1445) Google Scholar), but models with different stoichiometry for HS and FGF have been proposed (Fig. 1). For example, a single HS chain binds one FGF and two FGFRs (27Springer B.A. Pantoliano M.W. Barbera F.A. Gunyuzlu P.L. Thompson L.D. Herblin W.F. Rosenfeld S.A. Book G.W. J. Biol. Chem. 1994; 269: 26879-26884Abstract Full Text PDF PubMed Google Scholar) (Fig. 1A,III); a single HS chain binds two FGFs, which in turn bind two FGFRs (18DiGabriele A.D. Lax I. Chen D.I. Svahn C.M. Jaye M. Schlessinger J. Hendrickson W.A. Nature. 1998; 393: 812-817Crossref PubMed Scopus (329) Google Scholar) (Fig. 1B, IV); and one each of FGF, HS, and FGFR first form an FGF·HS·FGFR half-complex, two of which then dimerize (28Schlessinger J. Plotnikov A.N. Ibrahimi O.A. Eliseenkova A.V. Yeh B.K. Yayon A. Linhardt R.J. Mohammadi M. Mol. Cell. 2000; 6: 743-750Abstract Full Text Full Text PDF PubMed Scopus (974) Google Scholar) (Fig.1C, VII). Because the size of HS can be up to 150 disaccharide repeats, and only shorter oligosaccharides no more than 7 disaccharide repeats (dp14) were used for modeling study in most cases, one unresolved question is whether the models established with shorter oligosaccharides can be extended to the cell surface HS proteoglycans. HSs from different tissues or developmental stages have different fine structures (29Allen B.L. Filla M.S. Rapraeger A.C. J. Cell Biol. 2001; 155: 845-858Crossref PubMed Scopus (126) Google Scholar, 30Lindahl U. Kusche-Gullberg M. Kjellen L. J. Biol. Chem. 1998; 273: 24979-24982Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar) and can activate or inhibit FGF signaling pathways (31Zhang Z. Coomans C. David G. J. Biol. Chem. 2001; 276: 41921-41929Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 32Pye D.A. Vives R.R. Hyde P. Gallagher J.T. Glycobiology. 2000; 10: 1183-1192Crossref PubMed Scopus (105) Google Scholar, 33Guimond S.E. Turnbull J.E. Curr. Biol. 1999; 9: 1343-1346Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). It is believed that this phenomenon is caused by replacing of critical functional groups during the synthesis of the HSs (2Rosenberg R.D. Shworak N.W. Liu J. Schwartz J.J. Zhang L. J. Clin. Invest. 1997; 99: 2062-2070Crossref PubMed Scopus (258) Google Scholar, 32Pye D.A. Vives R.R. Hyde P. Gallagher J.T. Glycobiology. 2000; 10: 1183-1192Crossref PubMed Scopus (105) Google Scholar, 34Berry D. Kwan C.P. Shriver Z. Venkataraman G. Sasisekharan R. FASEB J. 2001; 15: 1422-1424Crossref PubMed Scopus (15) Google Scholar). The critical functional groups on HS interacting with FGFs (19Guimond S. Maccarana M. Olwin B.B. Lindahl U. Rapraeger A.C. J. Biol. Chem. 1993; 268: 23906-23914Abstract Full Text PDF PubMed Google Scholar, 23Zhou F.Y. Kan M. Owens R.T. McKeehan W.L. Thompson J.A. Linhardt R.J. Hook M. Eur. J. Cell Biol. 1997; 73: 71-80PubMed Google Scholar, 35Turnbull J.E. Fernig D.G. Ke Y. Wilkinson M.C. Gallagher J.T. J. Biol. Chem. 1992; 267: 10337-10341Abstract Full Text PDF PubMed Google Scholar) or FGFRs (24Ostrovsky O. Berman B. Gallagher J. Mulloy B. Fernig D.G. Delehedde M. Ron D. J. Biol. Chem. 2002; 277: 2444-2453Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar, 36Loo B.M. Kreuger J. Jalkanen M. Lindahl U. Salmivirta M. J. Biol. Chem. 2001; 276: 16868-16876Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 37McKeehan W.L. Wu X. Kan M. J. Biol. Chem. 1999; 274: 21511-21514Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar) have been investigated previously. For example, 2-O sulfation at an iduronic acid was found critical for FGF2 binding (38Maccarana M. Casu B. Lindahl U. J. Biol. Chem. 1993; 268: 23898-23905Abstract Full Text PDF PubMed Google Scholar), and 6-O-sulfation was found to be important for FGFR1 binding (37McKeehan W.L. Wu X. Kan M. J. Biol. Chem. 1999; 274: 21511-21514Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 39Pye D.A. Vives R.R. Turnbull J.E. Hyde P. Gallagher J.T. J. Biol. Chem. 1998; 273: 22936-22942Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar). However, less information about the relationship between critical groups on HS mediating FGF·HS·FGFR ternary complex formation to the groups required for FGF or FGFR binding has been available. With in vitro modification of HS and a gel mobility shift assay (40Wu Z.L. Zhang L. Beeler D.L. Kuberan B. Rosenberg R.D. FASEB J. 2002; 16: 539-545Crossref PubMed Scopus (48) Google Scholar), we have measured the minimum HS size and the molar ratio among FGF1, HS, and FGFR1 as a function of HS size and showed that both FGF1 and FGFR1 interact with HS in the complex. Based upon these results, we suggest that a 2:2:2 FGF1·HS·FGFR1 model best fits the data. In addition, utilizing a cell genetic study, we have found that there are different critical groups at different sites on HS involved in the ternary complex formation and FGF and FGFR binding interactions. We also find that the ability of HS to form a ternary complex with FGF1 and FGFR1 is a prerequisite for FGF1-stimulated mitogenic activity. Based on these data, we propose a mechanism showing how the FGF1·FGFR1 signaling complex is formed on HS cell surface proteoglycan. Heparin oligosaccharides (dp4 to dp24) were purchased from Iduron (Manchester, UK). Completely desulfated andN-sulfated heparin sulfate (DSNS) and completely desulfated and N-acetylated heparin (DSNAc) were from Seikagaku America (Falmouth, MA). FGF1 and FGFR1b (IIIc)/Fc were from R&D Systems (Minneapolis, MN). 3′-Phosphoadenosine 5′-phosphosulfate was fromCalbiochem. 3-O-sulfotransferase (3-OST-1) and 6-OST-1 were prepared as previously described (40Wu Z.L. Zhang L. Beeler D.L. Kuberan B. Rosenberg R.D. FASEB J. 2002; 16: 539-545Crossref PubMed Scopus (48) Google Scholar). The CHOpgsA-745 cell line and 6-O-desulfated heparin (6ODS) were kind gifts from Dr. Jeffrey D. Esko (University of California, San Diego). Preparation of35S-labeled 3′-phosphoadenosine 5′-phosphosulfate, radiolabeling of HS, autoradiograph, and gel analysis were the same as previously described (40Wu Z.L. Zhang L. Beeler D.L. Kuberan B. Rosenberg R.D. FASEB J. 2002; 16: 539-545Crossref PubMed Scopus (48) Google Scholar). Anti-FGF1 antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, California). The CHO-K1 cell line was from ATCC (Manassas, VA). 2-OST-deficient cell CHOpgsF-17 was prepared as described (41Zhang L. Lawrence R. Schwartz J.J. Bai X. Wei G. Esko J.D. Rosenberg R.D. J. Biol. Chem. 2001; 276: 28806-28813Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Fetal bovine serum was from Invitrogen. Protein A, Alexa Fluor® 647 conjugate was from Molecular Probes, Inc. (Eugene, OR). The heparin sample (20 mg) was digested with a mixture of heparinase and heparantinase I and II (Seikagaku Corp., Tokyo, Japan) at 37 °C for 2 h in 50 ml of buffer of 2 mm Ca(Ac)2, 20 mm sodium acetate, pH 7.0. The digestion products were separated with a C18-reversed phase column (IPRP-HPLC) (Vydac, Lake Forest, CA). The sample was eluted with 2.5, 6, 10.5, 18, and 507 acetonitrile in 40 mmNH4H2PO4 and 1 mmtetrabutylammonium dihydrophosphate (Sigma) for 15, 15, 45, 25, and 20 min, respectively, and was monitored with light absorbance at 232 nm (41Zhang L. Lawrence R. Schwartz J.J. Bai X. Wei G. Esko J.D. Rosenberg R.D. J. Biol. Chem. 2001; 276: 28806-28813Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The extracellular domain of FGFR1, including Ig domain II and IIIc (from residue 142 to 365) (42Pellegrini L. Burke D.F. von Delft F. Mulloy B. Blundell T.L. Nature. 2000; 407: 1029-1034Crossref PubMed Scopus (630) Google Scholar, 43Plotnikov A.N. Schlessinger J. Hubbard S.R. Mohammadi M. Cell. 1999; 98: 641-650Abstract Full Text Full Text PDF PubMed Scopus (513) Google Scholar) was PCR-cloned from a Human Placenta Quik-clone TM cDNA library (Clontech, Palo Alto, California). The PCR forward primer was GATAACACCAAACCAAACCG, and the backward primer was CCTCTCTTCCAGGGCTTCCA. The PCR product was expressed in a pBAD/TOPO ThioFusion TM Expression System (Invitrogen). The expressed protein was a fusion protein with thioredoxin at the C-terminal and was refolded in 150 mm NaCl, 10 mm Tris, pH 8.0, 107 glycerol, 1 mml-cysteine. For a typical 20-ॖl binding reaction, 1 ॖl of FGF1, 1 ॖl of FGFR1, and 0.1 ॖl of HS or heparin were added into an appropriate volume of binding buffer. The concentrations of FGF1, FGFR1, and HS were adjusted as needed before the reaction. The reaction was incubated at 23 °C for 20 min. The binding buffer contained 137 mm NaCl, 2.7 mm KCl, 4.3 mm Na2HPO4, 10 mm of MgCl2, and 1.4 mmKH2PO4 and 127 glycerol. Half of the reaction was loaded onto a native 4.57 polyacrylamide gel. The gel was run at 6 V/cm for 70 min. After the run, the gel was dried under vacuum and exposed to a phosphor imager plate. Suspension cultures of FGFR1a (IIIc)-expressing BaF3 cells (a generous gift from professor D. M. Ornitz) were maintained in AIM V medium (Invitrogen), supplemented with 5 nm recombinant mouse interleukin-3 (R&D Systems). For mitogenic assays, 50 ॖl of AIM V medium (serum-free) containing HSs and FGF-1 at final concentrations of 1 ॖg/ml and 5 nm, respectively, were plated into a 96-well assay plate. Cells were washed and resuspended in AIM V medium (serum-free), and 2,500 cells were added to each well for a total volume of 100 ॖl. The cells were then incubated at 37 °C with 57 CO2 for 24 h; afterward, 100 ॖl of Syto-11 dye (Molecular Probes), which was prepared in 10 mm Tris, 1 mm EDTA, 50 mm NaCl, pH 8.0, was added to each well and incubated for 30 min at 37 °C. The sample was excited at 508 nm, and the fluorescence emission at 527 nm was then measured using the SpectraMax Gemini XS (Molecular Devices, Inc., Sunnyvale, CA). The data were analyzed with Softmax software, and each data point presented was the average of a triplicate determination. Nearly confluent monolayers of cells in a T-75 flask were detached by adding 10 ml of phosphate-buffered saline containing 107 fetal bovine serum and 2 mm EDTA and centrifuged. The cell pellets were placed on ice. About 1 × 106 cells were first mixed with 20 ॖl of phosphate-buffered saline (137 mm NaCl, 2.7 mm KCl, 4.3 mm Na2HPO4, 10 mm MgCl2, and 1.4 mmKH2PO4) and 1 ॖg of FGFR1औ (IIIc)/Fc, and then 4 ॖg of protein A-Alexa Fluor® 647 conjugate was added. Protein A binds to the Fc region of FGFR1औ (IIIc)/Fc. In a separate experiment, 0.5 ॖg of FGF1 was also added at this point. After 15 min of incubation, the cells were washed once with 10 ml of phosphate-buffered saline and resuspended in 300 ml of phosphate-buffered saline containing 107 fetal bovine serum. Flow cytometry was performed with FACScan and FACStar instruments (Becton Dickinson). Previously, we applied gel mobility shift assay to study antithrombin III/HS interaction (40Wu Z.L. Zhang L. Beeler D.L. Kuberan B. Rosenberg R.D. FASEB J. 2002; 16: 539-545Crossref PubMed Scopus (48) Google Scholar). The same method was applied to study FGF/HS/FGFR interactions. A ladder of defined lengths of oligosaccharides from dp2 to dp24 was first radiolabeled with 6-OST-1 sulfotransferases (40Wu Z.L. Zhang L. Beeler D.L. Kuberan B. Rosenberg R.D. FASEB J. 2002; 16: 539-545Crossref PubMed Scopus (48) Google Scholar) and examined on a 157 PAGE gel (Fig.2A). The labeled ladder was then applied to gel mobility shift assays with FGF1 or FGFR1 (Fig.2B). FGF1 could bind to tetrasaccharide (dp4) and longer chains, whereas FGFR1 only showed significant binding to octasaccharide (dp8) and longer chains. The mobility of the binary complex FGF1·HS was greater than that of FGFR1·HS. When equivalents of FGF1 and FGFR1 were mixed with excess dp18 and applied to the assay, a distinct band, with mobility greater than FGFR1·HS but less than FGF1·HS, was observed (Fig. 3A), suggesting the formation of a ternary complex among FGF1, FGFR1, and HS. This ternary complex could be observed when the concentrations of FGF1 and FGFR1 were as low as 128 nm, although either no or less binary complexes of HS·FGFR1 and FGF1·HS could be observed at this concentration, suggesting the cooperative binding among HS, FGF, and FGFR. Cooperative binding is a characteristic of FGF·HS·FGFR ternary complex formation (44Nugent M.A. Edelman E.R. Biochemistry. 1992; 31: 8876-8883Crossref PubMed Scopus (205) Google Scholar, 45Pantoliano M.W. Horlick R.A. Springer B.A. Van Dyk D.E. Tobery T. Wetmore D.R. Lear J.D. Nahapetian A.T. Bradley J.D. Sisk W.P. Biochemistry. 1994; 33: 10229-10248Crossref PubMed Scopus (229) Google Scholar).Figure 3Observation of FGF1·HS·FGFR1 ternary complex.A, complex formation and its concentration dependence. Excess dp18 was used for the reactions, and the concentrations of FGF1 and FGFR1 in the binding reactions are indicated. F1:HS, binary complex of FGF1 and HS;HS:R1, binary complex of HS and FGFR1; F1:HS:R1, ternary complex of FGF1, HS, and FGFR1. B, thermal stability of the binary and ternary complexes. Around 0.8 mm each of FGF1, FGFR1, and dp18 were used in all of the binding reactions. The heating temperature and the duration (min) for each reaction are indicated. C, ternary complex formation on CHO cells assayed with flow cytometry. The cells were sequentially sorted without any protein, with FGFR1औ (IIIc)/Fc, and with both FGF1 and FGFR1औ (IIIc)/Fc. Left panel, HS-deficient CHOpgsA-745 cell. Middle panel, HS-expressing CHO-K1 cell.Right panel, a CHO cell expressing 2-O-sulfation negative HS. The fluorescence-tagged FGFR1औ (IIIc)/Fc was monitored. F1, FGF1;R1/Fc, FGFR1b (IIIc)/Fc.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To further confirm that the above ternary complex did form at the native state of the proteins, binding samples were heated before loading onto a gel (Fig. 3B). After the sample was heated at 47 °C, the binary complex of HS·FGFR1 significantly decreased, whereas the binary complex of FGF1·HS was stable. Heating at 60 °C caused the disappearance of both of the binary complexes but not the ternary complex. Heating at 100 °C caused the disappearance of all of the complexes. This experiment suggests that the native state of the proteins is required for the ternary complex formation, and the order of the thermal stability of the complexes is FGF1·HS·FGFR1 > FGF1·HS > HS·FGFR1. To determine whether the observed ternary complex can form on cells with membrane HS proteoglycan under similar binding conditions, we carried out flow cytometry assays with CHO cells and FGFR1औ (IIIc)/Fc in the presence or absence of FGF1. FGFR1औ (IIIc)/Fc contained the same functional domains as the FGFR1 used in the gel shift assays, except for the inclusion of an Fc region of IgG. The binding of FGFR1औ (IIIc)/Fc to CHO cells was monitored (Fig. 3C). The HS-deficient CHOpgsA-745 cell showed no binding, even in the presence of FGF1. On the other hand, HS-expressing wild type CHO-K1 cells had weak binding, but this binding was greatly enhanced when FGF1 was added. These experiments suggest that FGFR1औ (IIIc)/Fc can bind to the HS proteoglycan on the cell membrane and form a much tighter ternary complex together with FGF1. Interestingly, a 2-OST-deficient cell CHOpgsF-17 did not bind to FGFR1औ (IIIc)/Fc alone but also showed a much stronger binding in the presence of FGF1, suggesting the formation of the ternary complex in the absence of 2-O-sulfation (Fig. 3C). To determine the minimum oligosaccharide that can initiate the ternary complex with FGF1 and FGFR1, the labeled ladder (Fig. 2A) was applied to a gel shift assay with both FGF1 and FGFR1 (Fig. 4A). The ternary complex could be observed with tetrasaccharide and larger oligosaccharides but not with disaccharide. To confirm the above observation, another gel was visualized with anti-FGF1 antibody (Fig. 4B). FGF1 had a low mobility in a native gel electrophoresis. The binding of HS to FGF1 added negative charges to FGF1, and the resulting FGF1·HS complex moved faster than the free FGF. The further addition of FGFR1 slowed FGF1·HS complex because of the formation of the ternary complex. The ternary complexes were observed with tetrasaccharide and longer oligosaccharides but not with disaccharide. This experiment confirmed that tetrasaccharide was the minimum HS required for the formation of a ternary complex of FGF1, HS, and FGFR1. First, we determined the ratio of FGF1 and FGFR1 in the ternary complex. In this experiment, a fixed amount of FGF1 but increasing amounts of FGFR1 were added to a series of binding reactions (Fig.5A). The bands of the ternary complexes were subjected to densitometry analysis (Fig. 5B), and the band density was plotted against the molar equivalents of FGFR1 to FGF1 (Fig. 5C). The slope of the curve declined sharply when FGFR1 was equivalent to FGF1, suggesting that FGF1 and FGFR1 have a 1:1 ratio in the ternary complex. The continuing increase in band intensity above equivalence might be caused by a shift of equilibrium, since excess FGFR1 (the reactant) generated more product (the ternary complex) formation and caused the disappearance of the FGF1·HS. At the level of 4 eq of FGFR1, there was almost no FGF1·HS observed. We further measured the molar ratio of HS in the ternary complex. In a series of binding reactions with the oligosaccharide ladder (Fig.1A), each reaction contained 250 ng of oligosaccharide (from dp4 to dp24), 16 pmol of FGF1, and 64 pmol of FGFR1. The 4:1 molar concentration ratio of FGFR1 to FGF1 overwhelmingly favored the formation of FGF1·HS·FGFR1, so that almost all the FGF1 was incorporated into the ternary complex (Fig. 5A). After electrophoresis, the amount of the oligosaccharide present in the ternary complex in each reaction was calculated by densitometry analysis, and the molar ratio between the oligosaccharide and FGF1 in the ternary complexes was then determined (see Table II). It was surprising to find that, independent of the size of HS, the ratio was consistently near 1:1. Considering the 1:1 ratio between FGF1 and FGFR1, this result suggests that the ternary complex has a molar ratio" @default.
• W2013679716 created "2016-06-24" @default.
• W2013679716 creator A5031033913 @default.
• W2013679716 creator A5043006821 @default.
• W2013679716 creator A5077691756 @default.
• W2013679716 creator A5078526337 @default.
• W2013679716 creator A5079233267 @default.
• W2013679716 creator A5081909358 @default.
• W2013679716 creator A5086346589 @default.
• W2013679716 date "2003-05-01" @default.
• W2013679716 modified "2023-10-14" @default.
• W2013679716 title "The Involvement of Heparan Sulfate (HS) in FGF1/HS/FGFR1 Signaling Complex" @default.
• W2013679716 cites W1494551606 @default.
• W2013679716 cites W1519091149 @default.
• W2013679716 cites W1559464451 @default.
• W2013679716 cites W1578995377 @default.
• W2013679716 cites W1799377625 @default.
• W2013679716 cites W1849896198 @default.
• W2013679716 cites W1944551911 @default.
• W2013679716 cites W1965144118 @default.
• W2013679716 cites W1965947453 @default.
• W2013679716 cites W1969640970 @default.
• W2013679716 cites W1971351550 @default.
• W2013679716 cites W1971359142 @default.
• W2013679716 cites W1971540677 @default.
• W2013679716 cites W1972078597 @default.
• W2013679716 cites W1974873948 @default.
• W2013679716 cites W1978974209 @default.
• W2013679716 cites W1986532077 @default.
• W2013679716 cites W2005944250 @default.
• W2013679716 cites W2006641366 @default.
• W2013679716 cites W2008940139 @default.
• W2013679716 cites W2012374953 @default.
• W2013679716 cites W2019074842 @default.
• W2013679716 cites W2023938246 @default.
• W2013679716 cites W2028068676 @default.
• W2013679716 cites W2030155901 @default.
• W2013679716 cites W2033702973 @default.
• W2013679716 cites W2034664769 @default.
• W2013679716 cites W2044563596 @default.
• W2013679716 cites W2047125237 @default.
• W2013679716 cites W2050256171 @default.
• W2013679716 cites W2052103374 @default.
• W2013679716 cites W2057404061 @default.
• W2013679716 cites W2061348601 @default.
• W2013679716 cites W2070294819 @default.
• W2013679716 cites W2080289581 @default.
• W2013679716 cites W2081441817 @default.
• W2013679716 cites W2083432523 @default.
• W2013679716 cites W2087086162 @default.
• W2013679716 cites W2099860083 @default.
• W2013679716 cites W2100585860 @default.
• W2013679716 cites W2107983150 @default.
• W2013679716 cites W2116215301 @default.
• W2013679716 cites W2122965729 @default.
• W2013679716 cites W2149594557 @default.
• W2013679716 cites W2150365588 @default.
• W2013679716 cites W2156014566 @default.
• W2013679716 cites W2161568920 @default.
• W2013679716 cites W2165233782 @default.
• W2013679716 cites W2166363199 @default.
• W2013679716 cites W2169147580 @default.
• W2013679716 cites W2169829977 @default.
• W2013679716 cites W2393861604 @default.
• W2013679716 cites W4211075026 @default.
• W2013679716 cites W4235231077 @default.
• W2013679716 doi "https://doi.org/10.1074/jbc.m212590200" @default.
• W2013679716 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12604602" @default.
• W2013679716 hasPublicationYear "2003" @default.
• W2013679716 type Work @default.
• W2013679716 sameAs 2013679716 @default.
• W2013679716 citedByCount "138" @default.
• W2013679716 countsByYear W20136797162012 @default.
• W2013679716 countsByYear W20136797162013 @default.
• W2013679716 countsByYear W20136797162014 @default.
• W2013679716 countsByYear W20136797162015 @default.
• W2013679716 countsByYear W20136797162016 @default.
• W2013679716 countsByYear W20136797162017 @default.
• W2013679716 countsByYear W20136797162018 @default.
• W2013679716 countsByYear W20136797162019 @default.
• W2013679716 countsByYear W20136797162020 @default.
• W2013679716 countsByYear W20136797162021 @default.
• W2013679716 countsByYear W20136797162022 @default.
• W2013679716 countsByYear W20136797162023 @default.
• W2013679716 crossrefType "journal-article" @default.
• W2013679716 hasAuthorship W2013679716A5031033913 @default.
• W2013679716 hasAuthorship W2013679716A5043006821 @default.
• W2013679716 hasAuthorship W2013679716A5077691756 @default.
• W2013679716 hasAuthorship W2013679716A5078526337 @default.
• W2013679716 hasAuthorship W2013679716A5079233267 @default.
• W2013679716 hasAuthorship W2013679716A5081909358 @default.
• W2013679716 hasAuthorship W2013679716A5086346589 @default.
• W2013679716 hasBestOaLocation W20136797161 @default.
• W2013679716 hasConcept C153074725 @default.
• W2013679716 hasConcept C170493617 @default.
• W2013679716 hasConcept C185592680 @default.
• W2013679716 hasConcept C191709040 @default.
• W2013679716 hasConcept C2778041096 @default.

• next